CN1037278C - Exogenous genes products made from tussah chrysalis - Google Patents
Exogenous genes products made from tussah chrysalis Download PDFInfo
- Publication number
- CN1037278C CN1037278C CN 92103655 CN92103655A CN1037278C CN 1037278 C CN1037278 C CN 1037278C CN 92103655 CN92103655 CN 92103655 CN 92103655 A CN92103655 A CN 92103655A CN 1037278 C CN1037278 C CN 1037278C
- Authority
- CN
- China
- Prior art keywords
- gene
- dna
- antheraea pernyi
- nuclear polyhedrosis
- polyhedrosis virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a method for producing exogenous gene products by antheraea pernyi pupas in gene engineering, which comprises the steps: an antheraea pernyi nuclear polyhedrosis virus expression carrier is constructed; antheraea pernyi pupas are utilized as a living body parasitifer; wild ApNPVDNA and recombinant plasmid DNA are transfected to antheraea pernyi cells or the antheraea pernyi pupas to form recombinant viruses loaded with exogenous genes after the exogenous genes are cloned to an antheraea pernyi NPV expression carrier; then the antheraea pernyi pupas are infected by thee recombinant viruses obtained by purification, namely that the gene product is expressed and produced in a large scale in the antheraea pernyi pupas. The present invention has stable and rich resources by adopting the antheraea pernyi pupas as the living body parasitifer and can identify signal sequences of the gene, and the expression amount is more than 100 times higher than that of autographa california.
Description
The present invention relates to a kind of engineered DNA or RNA, carrier and plasmid, or its separation, preparation or purifying; Its host's application.
At present in the world widespread use equal the autographa californica nuclear polyhedrosis virus that nineteen eighty-three sets up (below be abbreviated as AcNPV) vector expression system by U.S. scientist GESmith, though have the output of expression height, the anti-source property of expressed exogenous genes products, immunogenicity and biological function all with the similar superiority of its native protein, but since the autographa californica nuclear polyhedrosis virus vector expression system be with SF
9Insect cell is the host, cultivates insect cell culture medium cost cost height in a large number, and the condition equipment requirements is tight, and technical difficulty is big, has therefore limited the practical application of this vector expression system.People seek new live body host again for this reason, as Chinese invention patent (on December 17th, 1986) disclosed a kind of＜produce the method for useful matter (application number 85104701), its principal character is by producing useful matter at the silkworm nuclear-polyhedrosis virus (BmNPV) of bombyx mori cell or host internal breeding reorganization.This recombinating silkworm nucleus multiple the body of angle virus DNA that recombinates in body and produce is a distrand DNA, it comprises and originally is present in 5 of polyhedrin structural gene upstream ' terminal promoter region, and translation initiation password and one produce useful matter gene and part polyhedrin structural gene and its downstream 3 ' terminal silkworm nuclear-polyhedrosis virus dna fragmentation.Its weak point be silkworm with hibernate of ovum, not diapause in pupa time can only be done expressive host with larva; And silkworm larva needs manually to watch fosterly in indoor, and mass production is the cost height not only, the factory management difficulty, and behaviour does trouble; Particularly the infective virus operation easier is big, and larva is easily hemorrhage or scratch each other and very easily cause infectation of bacteria behind infective virus, septicemia takes place, the larva of morbidity not only can not expression product, but also can pollute, i.e. blood sampling is dead after its larva morbidity in addition, can not weave silk and do cocoon, does not reach the comprehensive utilization purpose.
In view of above-mentioned weak point of the prior art, the object of the present invention is to provide a kind of cocoon chrysalis that utilizes to be the live body host, be the method that the carrier great expression is produced the foreign gene engineering product with tussah nucleopolyhedrosis virus (ApNPV).
Purpose of the present invention can realize by following measure:
A kind of method of producing exogenous genes products with cocoon chrysalis, it is characterized in that: (1) determines the position of Antheraea pernyi nuclear polyhedrosis virus polyhedron gene in the Antheraea pernyi nuclear polyhedrosis virus genome, (2) make up series with the said Antheraea pernyi nuclear polyhedrosis virus polyhedron gene of step (1) and shift expression vector, (3) obtain the foreign gene dna sequence dna of encode specific protein matter, and operationally be connected and obtain reorganization and shift and express vector plasmid DNA with the carrier of step (2), (4) expression vector plasmid DNA and Antheraea pernyi nuclear polyhedrosis virus DNA cotransfection tussah cell or cocoon chrysalis are shifted in said reorganization, reorganization and produce the reorganization Antheraea pernyi nuclear polyhedrosis virus have the foreign gene dna sequence dna in body, (5) the reorganization Antheraea pernyi nuclear polyhedrosis virus with step (4) infects cocoon chrysalis, and recombinant virus is bred in cocoon chrysalis, the required exogenous gene expression product of separation and purification in the cocoon chrysalis of (6) said infection from step (5).The said transfer expression vector of step (2) comprises the Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence before Antheraea pernyi nuclear polyhedrosis virus polyhedron gene upstream 5 ' end mRNA transcription initiation site, the all DNA sequence of polyhedron gene mRNA transcription initiation site to the translation initiation password, a foreign gene connection site, all or part of polyhedrin structural gene, the Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence of polyhedrin structural gene downstream 3 ' end.The polyhedron gene translation initiation codon ATG that shifts in the expression vector sports ATT, at its downstream different positions the foreign gene connection site is arranged, and can connect a foreign gene dna sequence dna that has the encode specific protein matter of translation initiation codon.The said reorganization of step (3) is shifted and is expressed the preceding Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence of mRNA transcription initiation site that vector plasmid DNA comprises Antheraea pernyi nuclear polyhedrosis virus polyhedron gene upstream 5 ' end, the all DNA sequence of polyhedron gene mRNA transcription initiation site to the translation initiation password, a foreign gene dna sequence dna, all or part of polyhedrin structural gene, the Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence of polyhedrin structural gene downstream 3 ' end.The said reorganization Antheraea pernyi nuclear polyhedrosis virus that has the foreign gene dna sequence dna produces through reorganization at tussah cell or cocoon chrysalis step 4, and can in above-mentioned host, breed, separate the reorganization Antheraea pernyi nuclear polyhedrosis virus that obtains having the foreign gene dna sequence dna with terminal dilution method with the plaque method, reorganization is that foreign gene and the generation of Antheraea pernyi nuclear polyhedrosis virus polyhedron gene are replaced or inserted in other zone.The said reorganization Antheraea pernyi nuclear polyhedrosis virus that has the foreign gene dna sequence dna, it does not form polyhedron, its said viral DNA is a double-stranded DNA, comprise the preceding Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence of Antheraea pernyi nuclear polyhedrosis virus polyhedron gene upstream 5 ' end mRNA transcription initiation site, the all DNA sequence of polyhedron gene mRNA transcription initiation site to the translation initiation password, a foreign gene dna sequence dna, all or part of polyhedrin structural gene, the Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence of the structure gene downstream 3 of polyhedrin ' end.Said reorganization Antheraea pernyi nuclear polyhedrosis virus is to breed in cocoon chrysalis, and the expression alien gene product, obtains required expression product through separation and purification.
The Antheraea pernyi nuclear polyhedrosis virus expression vector has been set up in the present invention, utilize cocoon chrysalis to be the live body host, with exogenous gene cloning behind the Antheraea pernyi nuclear polyhedrosis virus expression vector, with wild Antheraea pernyi nuclear polyhedrosis virus DNA with recombinant plasmid dna transfection tussah cell or cocoon chrysalis, formation is loaded with the recombinant virus of foreign gene, with purified resulting recombinant virus infection cocoon chrysalis, can in tussah silkworm chrysalis body, great expression produce this gene prod again.
The Antheraea pernyi nuclear polyhedrosis virus genome is a double-stranded circular dna molecular.Nuclear polyhedron gene wherein is the expressing gene in late period of virus, is single copy gene coding, intronless.The promotor efficient of this gene is very high; The expression level of itself is up to about 50% of whole cell protein; The polyhedrosis gene coding region is a nonessential region, and foreign gene inserts this zone does not influence duplicating of virus, and formed recombinant virus is a noninclusion virus.Will be with the virus particle of density gradient centrifugation purifying, extractive Antheraea pernyi nuclear polyhedrosis virus DNA carries out the restriction enzyme enzyme spectrum analysis through ordinary methods such as phenol/chloroforms, agarose gel electrophoresis, be transferred to nitrocellulose filter, and be that probe carries out molecular hybridization with Douglas fir poison moth nucleopolyhedrosis virus nuclear polyhedron gene, determined the position of polyhedrin protein gene in tussah nucleopolyhedrosis virus genome; And with the dna fragmentation of escherichia coli vector plasmid PAT153 or Puc19 clone, contained this gene of propagation; Promptly 5 ' the BamHI--PstI fragment of PvuII--BamHI fragment and the 3 ' end of end, be template with single stranded DNA and double-stranded DNA respectively, adopt the dideoxy sequence analysis method that the dna fragmentation of being cloned is carried out nucleotide sequence analysis, read whole coding sequence 735bp and its two flanking regions part non-coding sequence of tussah nucleopolyhedrosis virus nuclear polyhedron gene; Adopt primer extension method to determine that the mRNA transcripting start point of this gene is positioned at--50 A (VITAMIN B4) site, and then determined 5 ' terminal gene expression regulation sequence of this gene, the i.e. position of promotor.Adopt sudden change of artificial synthetic oligonucleotide's primer pilot point and PCR technology such as (Polymerase Chain Reaction), the initiator codon of tussah nucleopolyhedrosis virus polyhedron gene is removed ATG sport ATT, cut away respectively simultaneously+2～+ 140, + 9～+ 140 and+37～+ 140 polyhedrin structural genes 5 ' terminal encoding sequence, set up pAp M740,741, serial genes transfer vectors such as 748 and 736, the establishment of these carriers, kept efficiently expressing 5 ' end group that transcribing of RNA play an important role because of regulating and controlling sequence, all nucleotide sequences and part 5 ' end have the encoding sequence of great effect, translation initiation password (being mutated into ATT) rear section nucleotide sequence to the translation of exogenous gene expression before from the mRNA transcriptional start point to translation initiation password.With foreign gene such as human interleukin-4, people α--Interferon, rabbit, the DE glycoprotein gene is cloned respectively in four carriers being set up, the extracting recombinant plasmid dna, and with extractive Antheraea pernyi nuclear polyhedrosis virus DNA transfection tussah ovarian cell or cocoon chrysalis, treat tussah cell or cocoon chrysalis infection morbidity after, get its viral liquid, adopt plaque method or terminal dilution method to separate the foreign gene recombinant virus, recombinant virus does not form polyhedron.With isolating recombinant virus infection cocoon chrysalis, incubated at room is treated the viral pupal cell liquid of silkworm chrysalis morbidity back collection, centrifugal decon, utilize known method, as gel-filtration, ion exchange chromatography, the expressed exogenous genes products of method separation and purification such as hydrophobic chromatography, affinity chromatography.Above-mentioned recombinant virus also can infect pernyi larvae, the expression alien gene material.
Method of the present invention has following advantage compared to existing technology: Antheraea pernyi nuclear polyhedrosis virus carrier of the present invention--cocoon chrysalis live body host expression system be with the cocoon chrysalis for the live body host carries out expression of exogenous gene, thereby demonstrate a series of superiority.1. at first this tussah is that wild silkworm is a kind of economic raising insect of China's special product, and it has a whole set of production and sales system, has every year up to ten thousand tons of silkworm chrysalises to be utilized, aboundresources, stable.2. other economic insects such as tussah and silkworm are different, and it is to survive the winter with pupa diapause, can preserve half a year to one year under 2～4 ℃, and the characteristics that this is unique become cocoon chrysalis and are better than other economic optimal baculovirus vector expressive hosts of insects of raising.After the tussah cocoon skin is cut open in addition, still can do staple fiber sale resource and obtain comprehensive utilization, 3. the cocoon chrysalis pupal cell is big, need not raise, do not creep yet, can realize mechanize, batch production production foreign gene material, 4. tussah mainly is organized as fatty body in pupa time in the body, it is very responsive to the tussah nucleopolyhedrosis virus, whole pupal cell is organized almost and is all festered behind the tussah nucleopolyhedrosis virus infection cocoon chrysalis, liquefaction forms a large amount of polyhedroies, and this compares with the baculovirus infection tissue culture cells, and its infection rate is much higher; 5. the tussah silkworm chrysalis can be discerned Mammals, as Ro 24-7472/000 and other species, as the signal sequence of viral DE glycoprotein gene, can carry out correct modification justacrine in the body fluid of extracellular to expressed albumen, the expressing protein that is secreted in the body fluid is stablized easy purifying.6. the expression amount of cocoon chrysalis by volume calculates and will be higher than autographa californica nuclear polyhedrosis virus--SF
9Expression system is more than 100 times.Promptly a silkworm chrysalis is equivalent to 15 150 square centimeters Tissue Culture Flask (300ml insect substratum), and a silkworm chrysalis (comprising the cocoon skin) has only about 5 fens (about 1 cent), its value of 300ml insect substratum will be up to 16.35 dollars, and cost is lower than autographa californica nuclear polyhedrosis virus--SF
9Thousands of times of cell expression systems.7. it is simple to express production unit, management easy to operate.Utilize cocoon chrysalis to carry out simple, the easy to operate management of expression, equipment of exogenous genes products for the live body host, tussah cocoon can be cut open with machinery, silkworm chrysalis is behind ethanol disinfection, available machines used is carried out the recombinant virus infectable infection automatically, as long as metainfective silkworm chrysalis places 18～20 ℃, after 20 days, the basic all liquefaction of silkworm chrysalis tissue, remove by filter the chitin shell, centrifugal decon can carry out protein purification, and autographa californica nuclear polyhedrosis virus--SF
9Cell expression system is cultivated insect cell in a large number, needs the strict culture tank of high quality, singly is that a culture tank just needs two, 300,000 dollars, and equipment price is very expensive; Want controlled temperature in the culturing process in addition, every factor such as pH value, strictness prevents other microbiological contamination, in case pollute, whole one jar of cell is just done useless, technical difficulty is big, requires height, has a big risk; Even silkworm virus vector expression system, owing to be the live body host no matter in management with larva, the infectable infection recombinant virus; On preventing to pollute very big difficulty is arranged all; 8. set up the technology of tussah nucleopolyhedrosis virus DNA and recombinant plasmid dna direct transfection cocoon chrysalis, make the insect baculovirus expression vector technology easier, the recombination fraction height, 9. studies show that tussah nucleopolyhedrosis virus nuclear polyhedron is individual bigger than autographa californica nuclear polyhedrosis virus and silkworm nuclear-polyhedrosis virus nuclear polyhedron, tussah nucleopolyhedrosis virus nuclear polyhedrin gene promoter is strong, confirm through nucleotide sequence analysis, it is nearly 1/3 different with autographa californica nuclear polyhedrosis virus and Bombyx mori nuclear polyhydrosis virus that the promoter sequence of tussah nucleopolyhedrosis virus caryogram polyhedron gene has, in 8 that expression is played a decisive role high conservative nucleotide sequences, Antheraea pernyi nuclear polyhedrosis virus just has 2 places to replace, and autographa californica nuclear polyhedrosis virus is almost all identical with the promoter sequence of the gene of Bombyx mori nuclear polyhydrosis virus nuclear polyhedrin.
Description of drawings is as follows:
Fig. 1 is tussah nucleopolyhedrosis poisonous carrier one a cocoon chrysalis live body host expression system synoptic diagram of the present invention.
Fig. 2 is the clone and the enzyme spectrum analysis synoptic diagram of tussah nucleopolyhedrosis virus nuclear polyhedron gene of the present invention.
Fig. 3 is the establishment synoptic diagram of tussah nucleopolyhedrosis virus expression vector pApM 740 of the present invention.
Fig. 4 is the establishment synoptic diagram of tussah nucleopolyhedrosis virus expression vector pApM 741,748,736 of the present invention.
Fig. 5 be among the present invention DE glycoprotein at the expression synoptic diagram of tussah silkworm chrysalis body.
The invention will be further described to utilize the example shown in the accompanying drawing: at tussah nucleopolyhedrosis poisonous carrier shown in Figure 1--in the tussah live body host expression system synoptic diagram, at first prepare tussah nucleopolyhedrosis virus--DNA: with the cocoon chrysalis body wall percutaneous puncture-inoculation tussah nucleopolyhedrosis virus of termination of diapause, place 18～20 ℃ to hatch, collect silkworm chrysalis body fluid low-speed centrifugal remove slag matter and viral polyhedron after about 7 days, with supernatant 4 ℃ of following 29K ultracentrifugations 2 hours, supernatant discarded is suspended in precipitation among 0.1 * TE (PH=7.6), deposited 10～14 hours at 4 ℃, sucrose density gradient centrifugation, respectively the 4.75ml 50% sucrose-0.1 * TE of preparation and 4.75ml 10% sucrose-0.1 * TE are slowly joined successively earlier and form bed course in the centrifuge tube, add 1.8ml virus particle sample then, at 4 ℃ of following 20K after centrifugal 90 minutes, usually in centrifuge tube, locate to have a virion subband clearly on the lower side, careful sucking-off, and with 3 times of 0.1 * TE dilutions, centrifugal 90 minutes of 4 ℃ of following 30K; Discard supernatant, with the virus particle amount of being suspended in 10mM Tris--Hcl (PH=7.5)--in the 1mME DTA damping fluid, the 10%SDS that adds 1/20 volume, 1/10 volume 20mg/ml Proteinase K, 50 ℃ are incubated 2～5 hours, use phenol/chloroform, each extracting secondary of chloroform, the water dna solution can directly use or ethanol sedimentation after be dissolved among 1 * TE stand-byly again, tussah nucleopolyhedrosis virus--the DNA that so obtains can be used for next step gene clone and transfection.
The clone of polyhedron gene, determining of nucleotide sequence analysis and tussah nucleopolyhedrosis virus nuclear polyhedron gene rna transcription starting point: with the tussah nucleopolyhedrosis virus--DNA uses restriction enzyme Ecor1 respectively, BamHI, PstI, HindIII, the PvuII enzymolysis, 0.8% agarose gel electrophoresis, and fragment transferred on the nitrocellulose filter, with Douglas fir poison moth nucleopolyhedrosis virus nuclear polyhedron gene probe hybridization, the DE fragment of BamHI has specific hybrid as a result, this two fragment is cloned into respectively on the PAT153 plasmid BamHI site, forms pApD and pApE plasmid.With further the DE fragment being carried out enzyme spectrum analysis with quadrat method, nucleic acid hybridization, determine that blessing silkworm nucleopolyhedrosis virus nuclear polyhedron gene lays respectively at PvuII--BamHI1.4Kb fragment on the D fragment and the BamHI--Pst 2.6kb fragment on the E fragment, two fragments are separated respectively, and be cloned on the corresponding site SacI--BamHI--Pst1 of PUC19 plasmid, form
PAp1426 plasmids, then this plasmid is prepared the 1.4Kb fragment with EcoR1 (PUCl9 carrier point of contact) and BamHI enzymolysis, and be cloned in the M13 phage vector, extract single stranded DNA and carry out sequential analysis as template, read from the BamH1 site, read this gene 5 ' end 141bp encoding sequence and portion gene regulating and controlling sequence, according to this gene nucleotide series of reading out, artificial synthetic oligonucleotide's primer, be that template is carried out tussah nucleopolyhedrosis virus nuclear polyhedron gene whole coding sequence and 5 ' end directly with the pAp1426 plasmid double-stranded DNA that is loaded with tussah nucleopolyhedrosis virus nuclear polyhedron gene, the analysis of 3 ' distolateral alar part non-coding sequence, as shown in Figure 2.Sequence (+142～+ 166) synthetic minus strand Oligonucleolide primers according to Antheraea pernyi nuclear polyhedrosis virus nuclear polyhedron gene, sequence is: 5 ' G A CC A T G T A A T T G T C T A A A G G A T C 3 ' is a template with Antheraea pernyi nuclear polyhedrosis virus nucleopolyhedrosis virus mRNA, press the synthetic cDNA of primer extension method, and be that the DNA standard specimen of template preparation carries out the sequential analysis acrylamide gel electrophoresis simultaneously with same primers as and pAp1426 plasmid DNA.Antheraea pernyi nuclear polyhedrosis virus rna transcription starting point position--50 baculovirus is examined the A (VITAMIN B4) last (A A T A A G T AC A T T) of the 4th Nucleotide of 12 Nucleotide of polyhedron gene high conservative regulating and controlling sequence as a result.
In the establishment synoptic diagram of Fig. 3 and Antheraea pernyi nuclear polyhedrosis virus expression vector pApM 740,741,748,736 shown in Figure 4, according to result such as determine to clone's the segmental zymogram of BamHI DE that is loaded with Antheraea pernyi nuclear polyhedrosis virus nuclear polyhedron gene and dna sequence analysis and mRNA transcripting start point, Pstl--BamHI3.4kb, the BamHI--Pasl3.3kb that will be loaded with Antheraea pernyi nuclear polyhedrosis virus nuclear polyhedron gene encoding sequence and 5 ' end and 3 ' terminal non-coding sequence respectively are cloned in the PUC19 vector plasmid, have set up PD
34And PE
33Plasmid, will be loaded with then Antheraea pernyi nuclear polyhedrosis virus nuclear polyhedron gene 5 ' end group because of the PD34 plasmid DNA SacI--BamHl0.9kb fragment cloning of regulating and controlling sequence and 141bp 5 ' end encoding sequence in M13 mp18, the preparation single stranded DNA.Nucleotide sequence synthetic oligonucleotide primer thing according to these gene codon ATG both sides: 3 ' ... G A T A T T G A T A A G G T C T ... 5 ', adopt the method for Eckstein to carry out the point mutation that Oligonucleolide primers guides.With the sudden change after DNA transformed into escherichia coli gained plaque with 32
pThe Oligonucleolide primers of mark is that probe is hybridized, and obtains positive mutant strain.The M13 phage that is loaded with the mutant DNA sequence is increased in JM103 host bacterium, and the extracting double-stranded DNA separates the SacI--BamHI fragment, and this fragment cloning is returned in the PD34 vector plasmid.The BamHI--PstI fragment of Antheraea pernyi nuclear polyhedrosis virus nuclear polyhedron gene+142 rear section encoding sequences and 3 ' terminal flanking sequence will be loaded with again in the PE33 plasmid, this segment is cloned into the BamHI--PstI site of PD34 through the series clone, set up pAp M740 transfer vector, the exogenous gene cloning site is+the 141BamHI point of contact.The PvuII--BamHI1.4kb fragment cloning (P14) in the PUC19 carrier of 5 ' terminal gene regulating and controlling sequence will be loaded with, and according to the synthetic positive strand primer of PUC19 carrier DNA sequence: 5 ' ... C G A C G T T G T A A A A CG A C G G C C A G T ... 3 ', then according to Antheraea pernyi nuclear polyhedrosis virus nuclear polyhedron gene 5 ' terminal encoding sequence, three minus strand primers have been synthesized respectively, will+2～+ 140 or+9～+ 140 and 10～+ 140 sequences remove, and three minus strand primers of adding BamHI enzyme point of contact sequence are as follows respectively: (+) 1,5 ' ... GTATGAGTAATGGATCCTAGTTATAGGAAATTTTAC ... 3 '; (+) 8,5 '
BamHIGGTCGGCCGGTATGGATCCTCTGGAATAGTTATAGG…3′；(+36)，5′…
BamHICTTGTTGTCGGATCC AGATCTGCGACCAATGGTCGG ... 3 ' with the P14 plasmid DNA be
BamHI BgI II template is carried out the PCR reaction with above-mentioned 3 pairs of primers respectively, and 3 PCR product fragments are cut with the BamHI--SacI enzyme respectively, separates the SacI--BamHI fragment; The pApM740 transfer vector is cut with the BamHI--SacI enzyme, remove BamHI--SacI 0.9Kb fragment, and as carrier, again isolating PCR SacI--BamHI fragment is cloned into respectively and has set up pAp M 741,748 and 736 transfer vectors in this carrier, its exogenous gene cloning site respectively+1 ,+8 and+36 BamHI point of contact.
In Fig. 5, the contained expression of exogenous gene of tussah nucleopolyhedrosis poisonous carrier is example with carrier pAp M 748 at cocoon chrysalis expression in vivo DE glycoprotein gene: the DE glycoprotein gene is cloned on the BamHI site of carrier pApM748, through amplification, extracting reorganization foreign gene plasmid DNA, then with Antheraea pernyi nuclear polyhedrosis virus--DNA transfection cocoon chrysalis, and in incubated at room, after the about week, silkworm chrysalis body surface generation pathological change, silkworm chrysalis tissue fester after about 20 days, liquefaction, get under the silkworm chrysalis body fluid mirror and observe, there are a large amount of polyhedrosis viruses to exist, collect transfection silkworm chrysalis body fluid extracting DNA, oligonucleotide with synthetic DE protein gene distinguished sequence is that primer carries out PCR mensuration, found that DE gene band, PCR amplified synthetic DE gene fragment is carried out enzyme spectrum analysis and its enzyme of sequencing is the DE protein gene, show that this gene recombinated in the Antheraea pernyi nuclear polyhedrosis virus genome, in order to confirm the stability of the virus that the transfection silkworm chrysalis forms, the silkworm chrysalis body fluid of transfection morbidity is carried out 10 times of dilutions with the insect substratum, be respectively 10 °, 10
-2, 10
-4With 10
-6Concentration, diluent with this different concns infects cocoon chrysalis again, the silkworm chrysalis of two weeks postoperative infection is fallen ill successively, its invasioning sequence is to infect high concentration diluting liquid to the lower concentration diluent, the morbidity silkworm chrysalis is typical viral pupa illness and pathology, for whether the further DE albumen that confirms is got viral pupal cell liquid by expression and is carried out immunoprecipitation and SDS--PAGEWestern blotting detection with the special adpedance body of DE albumen, and with autographa californica nuclear polyhedrosis virus--SF
9The DE albumen that vector expression system is expressed found that in contrast this DE protein gene really is formed on the cocoon chrysalis expression in vivo with non-fusion rotein, its expression amount and autographa californica nuclear polyhedrosis virus--SF
9Vector expression system relatively (V/V) is high more than 100 times.In Fig. 5, A is the PCR detected result of reorganization DE gene: (a1) 1--untransfected cocoon chrysalis contrast, the 2--Antheraea pernyi nuclear polyhedrosis virus infects the cocoon chrysalis contrast, the contrast of 3--pApM 748--DE plasmid DNA transfection cocoon chrysalis, 4,5, the cocoon chrysalis of 6--cotransfection, the contrast of 7--DE gene PCR, B is that expressed proteic immunoprecipitation of DE and Westernolotting analyzes: 1, the anti-DE serum of 9--; 2--does not infect the cocoon chrysalis contrast; The 3--Antheraea pernyi nuclear polyhedrosis virus infects cocoon chrysalis contrast, 4～8, the cocoon chrysalis of 10～16--recombinant virus infection; 16--autographa californica nuclear polyhedrosis virus carrier is at SF
9Express the contrast of DE albumen in the cell.
Claims (7)
1, a kind of method of producing exogenous genes products with cocoon chrysalis is characterized in that:
(1) determine the position of Antheraea pernyi nuclear polyhedrosis virus polyhedron gene in the Antheraea pernyi nuclear polyhedrosis virus genome,
(2) make up series with the said Antheraea pernyi nuclear polyhedrosis virus polyhedron gene of step (1) and shift expression vector,
(3) obtain the foreign gene dna sequence dna of encode specific protein matter, and operationally be connected acquisition reorganization transfer expression vector plasmid DNA with the carrier of step (2),
(4) said reorganization is shifted expressed vector plasmid DNA and Antheraea pernyi nuclear polyhedrosis virus DNA cotransfection tussah cell or cocoon chrysalis, reorganization in body and generation has the reorganization Antheraea pernyi nuclear polyhedrosis virus of foreign gene dna sequence dna,
(5) the reorganization Antheraea pernyi nuclear polyhedrosis virus with step (4) infects cocoon chrysalis, and recombinant virus is bred in cocoon chrysalis,
(6) the required exogenous gene expression product of separation and purification in the cocoon chrysalis of said infection from step (5).
2, method of producing exogenous genes products with cocoon chrysalis according to claim 1, it is characterized in that the Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence before the said transfer expression vector of step (2) comprises Antheraea pernyi nuclear polyhedrosis virus polyhedron gene upstream 5 ' end mRNA transcription initiation site, the all DNA sequence of polyhedron gene mRNA transcription initiation site to the translation initiation password, a foreign gene connection site, all or part of polyhedrin structural gene, the Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence of polyhedrin structural gene downstream 3 ' end.
3, method of producing exogenous genes products with cocoon chrysalis according to claim 1 and 2, the polyhedron gene translation initiation codon ATG that it is characterized in that shifting in the expression vector sports ATT, at its downstream different positions the foreign gene connection site is arranged, can connect a foreign gene dna sequence dna that has the encode specific protein matter of translation initiation codon.
4, method of producing exogenous genes products with cocoon chrysalis according to claim 1, it is characterized in that the said reorganization transfer of step (3) expression vector plasmid DNA comprises the preceding Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence of mRNA transcription initiation site of Antheraea pernyi nuclear polyhedrosis virus polyhedron gene upstream 5 ' end, the all DNA sequence of polyhedron gene mRNA transcription initiation site to the translation initiation password, a foreign gene dna sequence dna, all or part of polyhedrin structural gene, the Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence of polyhedrin structural gene downstream 3 ' end.
5, method of producing exogenous genes products with cocoon chrysalis according to claim 1, it is characterized in that the said reorganization Antheraea pernyi nuclear polyhedrosis virus that has the foreign gene dna sequence dna of step 4 produces through reorganization at tussah cell or cocoon chrysalis, and can in above-mentioned host, breed, separate the reorganization Antheraea pernyi nuclear polyhedrosis virus that obtains having the foreign gene dna sequence dna with terminal dilution method with the plaque method, reorganization is that foreign gene and the generation of Antheraea pernyi nuclear polyhedrosis virus polyhedron gene are replaced or inserted in other zone.
6, method of producing exogenous genes products with cocoon chrysalis according to claim 5, it is characterized in that the said reorganization Antheraea pernyi nuclear polyhedrosis virus that has the foreign gene dna sequence dna, it does not form polyhedron, wherein said viral DNA is a double-stranded DNA, comprise the preceding Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence of Antheraea pernyi nuclear polyhedrosis virus polyhedron gene upstream 5 ' end mRNA transcription initiation site, the all DNA sequence of polyhedron gene mRNA transcription initiation site to the translation initiation password, a foreign gene dna sequence dna, all or part of polyhedrin structural gene, the Antheraea pernyi nuclear polyhedrosis virus DNA partial sequence of the structure gene downstream 3 of polyhedrin ' end.
7, method of producing exogenous genes products with cocoon chrysalis according to claim 1 is characterized in that said reorganization Antheraea pernyi nuclear polyhedrosis virus is to breed in cocoon chrysalis, and the expression alien gene product, obtains required expression product through separation and purification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 92103655 CN1037278C (en) | 1992-05-08 | 1992-05-08 | Exogenous genes products made from tussah chrysalis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 92103655 CN1037278C (en) | 1992-05-08 | 1992-05-08 | Exogenous genes products made from tussah chrysalis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1078260A CN1078260A (en) | 1993-11-10 |
| CN1037278C true CN1037278C (en) | 1998-02-04 |
Family
ID=4940357
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 92103655 Expired - Lifetime CN1037278C (en) | 1992-05-08 | 1992-05-08 | Exogenous genes products made from tussah chrysalis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1037278C (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP4701336B2 (en) * | 2001-04-18 | 2011-06-15 | 独立行政法人農業生物資源研究所 | Transformed silkworm producing human collagen |
| CN101871944B (en) * | 2010-06-02 | 2013-07-10 | 中国农业科学院茶叶研究所 | Qualitative detection method of tea geometrid nuclear polyhedrosis virus |
| CN103555675B (en) * | 2013-11-12 | 2016-06-22 | 辽宁省农业科学院大连生物技术研究所 | Insect cell High Five application in cultivating Antheraea pernyi nuclear polyhedrosis virus |
| CN104073518A (en) * | 2014-04-21 | 2014-10-01 | 广西医科大学 | Method for preparing recombinant human epidermal growth factor by adopting castor silkworm chrysalis as bioreactor |
| CN110592139B (en) * | 2019-09-26 | 2021-09-03 | 辽宁省海洋水产科学研究院 | Construction method and application of tussah nuclear polyhedrosis virus shuttle vector |
| CN113528579A (en) * | 2021-06-25 | 2021-10-22 | 大连理工大学 | Transfection reagent and method for obtaining recombinant baculovirus by directly transfecting tussah pupa |
-
1992
- 1992-05-08 CN CN 92103655 patent/CN1037278C/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| CN1078260A (en) | 1993-11-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5194376A (en) | Baculovirus expression system capable of producing foreign gene proteins at high levels | |
| Hink et al. | Expression of three recombinant proteins using baculovirus vectors in 23 insect cell lines | |
| Kool et al. | Detection and analysis of Autographa californica nuclear polyhedrosis virus mutants with defective interfering properties | |
| KR920001368B1 (en) | Method for producing a recombinent baculovirus expression vector | |
| Fischer et al. | Structure and transcription of the Drosophila mulleri alcohol dehydrogenase genes | |
| NO173944B (en) | PROCEDURE FOR THE PREPARATION OF A RECOMBINANT BACULOVIRUS EXPRESSION VECTOR | |
| CN101712955B (en) | Process for producing physiologically active protein using genetically modified silkworm | |
| CN1037278C (en) | Exogenous genes products made from tussah chrysalis | |
| KR930000273B1 (en) | Method for producing useful substances | |
| CN104099371A (en) | Application of KAP26.1 gene as exogenous gene introduced into cashmere goat cells and used for improving wool fineness | |
| JPH0365191A (en) | Spheroidine isolated dna and recombinant insect pox virus expression vector | |
| Yamamoto et al. | New and highly efficient method for silkworm transgenesis using Autographa californica nucleopolyhedrovirus and piggyBac transposable elements | |
| EP0323974B1 (en) | Method for producing a heterologous protein in insect cells | |
| CN100392083C (en) | DNA encoding ovine adenovirus (OAV 287) and its use as a viral vector | |
| CN110205333B (en) | Corn dwarf disease induction gene P3a and construction method and application of genetic transformation system thereof | |
| JP2818836B2 (en) | Method using recombinant vaccinia virus capable of growing in CHO cells | |
| CN101003803A (en) | Method for preparing active protein of acetylcholine esterase of housefly, and application | |
| Guo et al. | Silk gland specific secretory expression of egfp gene in silkworm Bombyx mori with rAcMNPV system | |
| RU2619161C2 (en) | Recombinant dna elements for recombinant proteins expression in the host cell | |
| WO2023213008A1 (en) | High-strength silk comprising various spider silk proteins and preparation method therefor | |
| Miller | Exploring the gene organization of baculoviruses | |
| KR100921812B1 (en) | Technique for Producing Recombinant Baculovirus Directly in Silkworm Larvae | |
| JP4353754B2 (en) | Gene transfer vector to insect and gene product production method | |
| KR100270928B1 (en) | TRANSITIONAL VECTOR, PBM10 USING p10 GENE OF BOMBYX MORI NUCLEOCAPSIDE POLYHEDRON VIRUS VB2(KCTC8873P) AND METHOD FOR PREPARATION THEREOF | |
| EP0975787A1 (en) | Entomopoxvirus-based gene delivery vector for vertebrates |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CX01 | Expiry of patent term |
Expiration termination date: 20120508 Granted publication date: 19980204 |