CN1078260A - Produce the method for exogenous genes products with cocoon chrysalis - Google Patents

Abstract

A kind of method that is used for engineered with cocoon chrysalis production exogenous genes products, it has set up the Antheraea pernyi nuclear polyhedrosis virus expression vector, utilize cocoon chrysalis to be the live body host, with exogenous gene cloning behind the tussah NPV expression vector, with wild ApNPV DNA with the delicate or cocoon chrysalis of recombinant plasmid dna transfection tussah, formation is loaded with the recombinant virus of foreign gene, with the recombinant virus infection cocoon chrysalis of purified gained, can great expression produce this gene prod in tussah silkworm chrysalis body again.The present invention adopts the signal sequence that cocoon chrysalis is stable as live body host aboundresources, can discern gene, and expression amount is higher than autographa california more than 100 times.

Description

Produce the method for exogenous genes products with cocoon chrysalis

The present invention relates to a kind of engineered DNA or RNA, carrier and plasmid, or its separation, preparation or purifying; Its host's application.

At present in the world widespread use equal the autographa californica nuclear polyhedrosis virus that nineteen eighty-three sets up (below be abbreviated as AcNPV) vector expression system by U.S. scientist GESmith, though have the output of expression height, the anti-source property of expressed exogenous genes products, immunogenicity and biological function all with the similar superiority of its native protein, but since the AcNPV vector expression system be with SF ₉Deng insect cell is the host, cultivates insect cell culture medium cost cost height in a large number, and the condition equipment requirements is tight, and technical difficulty is big, has therefore limited the practical application of this vector expression system.People seek new live body host again for this reason, as Chinese invention patent (on December 17th, 1986) disclosed a kind of＜produce the method for useful matter (application number 85104701), its principal character is by producing useful matter at the silkworm nuclear-polyhedrosis virus (BmNPV) of bombyx mori cell or host internal breeding reorganization, this reorganization BmNPV DNA that recombinates in body and produce is a distrand DNA, it comprises and originally is present in 5 of polyhedrin structural gene upstream ' terminal promoter region, translation initiation password and one produce useful matter gene and part polyhedrin structural gene and its downstream 3 ' terminal BmNPV dna fragmentation, its weak point is that silkworm is with hibernate of ovum, not diapause in pupa time can only be done expressive host with larva; And silkworm larva needs manually in indoor feeding, and mass production is the cost height not only, the factory management difficulty, and behaviour does trouble; Particularly the infective virus operation easier is big, and larva is easily hemorrhage or scratch each other and very easily cause infectation of bacteria behind infective virus; Septicemia takes place, and the larva of morbidity not only can not expression product, but also can pollute, and i.e. blood sampling is dead after its larva morbidity in addition, can not weave silk and do cocoon, reaches the comprehensive utilization purpose.

In view of above-mentioned weak point of the prior art, the object of the present invention is to provide a kind of cocoon chrysalis that utilizes to be the live body host, be the method that the carrier great expression is produced the foreign gene engineering product with tussah nucleopolyhedrosis virus (ApNPV).

Purpose of the present invention can realize by following measure:

A kind of method that is used for engineered as silkworm chrysalis production exogenous genes products, it is that the ApNPV DNA that the virus particle with purifying obtains through extracting carries out restriction enzyme enzyme spectrum analysis, agarose gel electrophoresis, Southern transfer printing, and be that probe carries out molecular hybridization and determines the position of polyhedron gene in the ApNPV genome with OpNPV nuclear polyhedron gene, it is characterized in that:

A. (PAT 153 to use the escherichia coli vector plasmid, Puc 19) clone, the dna fragmentation of contained this gene of propagation is the BamH I-Pst I fragment of Pvu II-BamH I fragment and the 3 ' end of 5 ' end, be that template adopts the dideoxy sequence analysis method that the dna fragmentation of being cloned is carried out nucleotide sequence analysis with single stranded DNA and double-stranded DNA respectively, read whole coding sequence 735bp and its two flanking regions part non-coding sequence of the gene of making silkworm NPV nuclear polyhedrin, adopt Primer Extension method to determine that this gene mRNA transcripting start point is positioned at the A site of nt-50, and then determine the position of 5 ' terminal gene expression regulation sequence of this gene;

B, adopt technology such as sudden change of artificial synthetic oligonucleotide's primer pilot point and PCR that the initiator codon of ApNPV polyhedron gene is removed (ATG sports ATT) to cut away nt+2～+ 140, nt+9～+ 140 and nt+37～+ 1405 ' terminal encoding sequence simultaneously respectively, set up PAPM740,741, serial genes transfer vectors such as 748 and 736;

C, foreign gene is cloned into respectively in four carriers being set up, the extracting recombinant plasmid dna, and, treat to get its viral liquid respectively with plaque method or terminal dilution method separation foreign gene recombinant virus behind tussah cell or the cocoon chrysalis infection morbidity with extractive APNPV DNA transfection tussah ovarian cell or cocoon chrysalis;

D can obtain exogenous genes products with isolating recombinant virus infection cocoon chrysalis through separation, purifying.

The Antheraea pernyi nuclear polyhedrosis virus expression vector has been set up in the present invention, utilize cocoon chrysalis to be the live body host, with exogenous gene cloning behind the tussah NPV expression vector, with wild APNPV DNA with recombinant plasmid dna transfection tussah cell or cocoon chrysalis, formation is loaded with the recombinant virus of foreign gene, with purified resulting recombinant virus infection cocoon chrysalis, can in tussah silkworm chrysalis body, great expression produce this gene prod again.

The tussah NPV viral genome is a double-stranded circular dna molecular.Nuclear polyhedron gene wherein is the expressing gene in late period of virus, is the single copy gene coding, does not have to include molecule.The promotor efficient of this gene is very high; The expression level of itself is up to about 50% of whole cell protein; The polyhedrosis gene coding region is a nonessential region, and foreign gene inserts this zone does not influence duplicating of virus, and formed recombinant virus is a noninclusion virus.Will be with the virus particle of density gradient centrifugation purifying, extractive APNPV DNA carries out the restriction enzyme enzyme spectrum analysis through ordinary methods such as phenol/chloroforms, agarose gel electrophoresis, the Southern transfer printing, and be that probe carries out molecular hybridization with OpNPV nuclear polyhedron gene, determined the position of polyhedrin protein gene in the APNPV genome; And with the dna fragmentation of escherichia coli vector plasmid (PAT153, Puc19) clone, contained this gene of propagation; Promptly 5 ' the BamH I-Pst I fragment of Pvu II-BamH I fragment and the 3 ' end of end, be template with single stranded DNA and double-stranded DNA respectively, adopt the dideoxy sequence analysis method that the dna fragmentation of being cloned is carried out nucleotide sequence analysis, read whole coding sequence 735bp and its two flanking regions part non-coding sequence of tussah NPV nuclear polyhedron gene; Adopt Primer Exteusion method to determine that the mRNA transcripting start point of this gene is positioned at the A(VITAMIN B4 of nt-50) site, and then determined the position of 5 ' terminal gene expression regulation sequence (promotor) of this gene, adopt sudden change of artificial synthetic oligonucleotide's primer pilot point and PCR(Polymerase Chain Reaction) etc. technology, the initiator codon of APNPV polyhedron gene is removed (ATG sports ATT), nt+2～+ 140 have been cut away simultaneously respectively, nt+9～+ 140 and nt+37～+ 140 5 ' terminal encoding sequence, set up PAPM740,741, serial genes transfer vectors such as 748 and 736, the establishment of these carriers, having kept has the encoding sequence (translation initiation password (being mutated into ATT) rear section nucleotide sequence) of great effect to efficiently expressing 5 ' end group that transcribing of RNA play an important role to the translation of exogenous gene expression because of regulating and controlling sequence (mRNA transcriptional start point to the translation initiation password all nucleotide sequences) and part 5 ' end.With foreign gene (as human interleukin-4, the human, the DE glycoprotein gene) in four carrier that the clone is set up respectively, the extracting recombinant plasmid dna, and with extractive APNPV DNA transfection tussah ovarian cell or cocoon chrysalis, after treating tussah cell or cocoon chrysalis infection morbidity, get its viral liquid, adopt plaque method (tussah NPV sensitive cells) or terminal dilution method (cocoon chrysalis) to separate foreign gene recombinant virus (recombinant virus does not form polyhedron).With isolating recombinant virus infection cocoon chrysalis, incubated at room is treated the viral pupal cell liquid of silkworm chrysalis morbidity back collection, the centrifugal matter extremely of going, utilize known method (as gel-filtration, ion exchange chromatography, methods such as hydrophobic chromatography, affinity chromatography) the expressed exogenous genes products of separation and purification.Above-mentioned recombinant virus also can infect pernyi larvae, the expression alien gene material, in addition, confirm through test, giant silkworm nuclear polyhedrosis virus (AyNPV) and philosamia cynhtia ricini nuclear polyhedrosis virus also have infectivity to cocoon chrysalis, and giant silkworm NPV DNA and Semen Ricini silkworm NPV DNA transfection cocoon chrysalis are achieved success.Tussah NPV carrier PAPM740,741,748 and 736 and ACNPV DNA transfection SF ₉Cell is succeedd.Form hybrid virus; Be that the APNPV polyhedron gene has replaced the AcNPV polyhedron gene, and the expression of DE glycoprotein is successful.Tussah NPV virus can infect a day silkworm larva, pupa and tissue culture cells and castor-oil plant silkworm chrysalis, larva and tissue culture cells.

Method of the present invention has following advantage compared to existing technology: tussah NPV virus vector of the present invention-cocoon chrysalis live body host expression system be with the cocoon chrysalis for the live body host carries out expression of exogenous gene, thereby demonstrate a series of superiority.1. at first this tussah is that wild silkworm is a kind of economic raising insect of China's special product, and it has a whole set of production and sales system, has every year up to ten thousand tons of silkworm chrysalises to be utilized, aboundresources, stable.2. other economic insects such as tussah and silkworm are different, and it is to survive the winter with pupa diapause, can preserve half a year to one year under 2～4 ℃, and the characteristics that this is unique become cocoon chrysalis and are better than other economic optimal baculovirus vector expressive hosts of insects of raising.The tussah cocoon skin is cut back (or living pupa and cocoon-reeling) open in addition, still can do staple fiber sells, comprehensive utilization, 3. the cocoon chrysalis pupal cell is big, need not raise, do not creep yet, can realize mechanize, batch production production foreign gene material, 4. tussah mainly is organized as fatty body in pupa time in the body, it is very responsive to tussah NPV virus, and whole pupal cell is organized almost and all festered behind the tussah NPV virus infection cocoon chrysalis, and liquefaction forms a large amount of polyhedroies, this compares with the baculovirus infection tissue culture cells, and its infection rate is much higher; 5. the tussah silkworm chrysalis can be discerned the signal sequence of Mammals (as Ro 24-7472/000) and other species (as viral DE glycoprotein) gene, can carry out correct modification justacrine in cell body fluid to expressed albumen, the expressing protein that is secreted in the body fluid is stablized easy purifying.6. the expression amount of cocoon chrysalis by volume calculates and will be higher than AcNPV-SF ₉Expression system is more than 100 times.Promptly a silkworm chrysalis is equivalent to 15 150 square centimeters Tissue Culture Flask (300ml insect substratum), and a silkworm chrysalis (comprising the cocoon skin) has only (about 1 cent) about 5 minutes, its value of 300ml insect substratum (comprising the 30ml calf serum) will be up to 16.35 dollars, and cost is lower than AcNPV-SF ₉Thousands of times of cell expression systems.7. it is simple to express production unit, management easy to operate.Utilize cocoon chrysalis to carry out simple, the easy to operate management of expression, equipment of exogenous genes products for the live body host, tussah cocoon can be cut open with machinery, silkworm chrysalis is behind ethanol disinfection, available machines used is carried out the recombinant virus infectable infection automatically, as long as metainfective silkworm chrysalis places room temperature (18～20 ℃), after 20 days, the basic all liquefaction of silkworm chrysalis tissue, remove by filter the chitin shell, centrifugal decon can carry out protein purification, and AcNPV-SF ₉Cell expression system is cultivated insect cell in a large number, needs the strict culture tank of high quality, singly is that a culture tank just needs two, 300,000 dollars, and equipment price is very expensive; Want controlled temperature in the culturing process in addition, every factor such as pH value, strictness prevents other microbiological contamination, in case pollute, whole one jar of cell is just done useless, technical difficulty is big, requires height, has a big risk; Even silkworm (BmNPV) virus vector expression system, owing to be the live body host no matter in management with larva, the infectable infection recombinant virus; On preventing to pollute very big difficulty is arranged all; 8. set up the technology of tussah NPV DNA and recombinant plasmid dna direct transfection cocoon chrysalis, make the insect baculovirus expression vector technology easier, the recombination fraction height, 9. studies show that tussah NPV nuclear polyhedron is individual bigger than AcNPV and silkworm NPV nuclear polyhedron, tussah NPV nuclear polyhedrin gene promoter is strong, confirm through nucleotide sequence analysis, it is nearly 1/3 different with AcNPV and BmNPV that the promoter sequence of tussah NPV caryogram polyhedron gene has, in 8 that expression is played a decisive role high conservative nucleotide sequences, tussah NPV just has 2 places to replace, and AcNPV is almost all identical with the promoter sequence of the gene of BmNPV nuclear polyhedrin.

Drawing is described as follows:

Fig. 1 is that tussah NPV carrier of the present invention is to cocoon chrysalis live body host expression system synoptic diagram.

Fig. 2 is the clone and the enzyme spectrum analysis synoptic diagram of ApNPV nuclear polyhedron gene of the present invention.

Fig. 3 is the establishment synoptic diagram of ApNPV expression vector PAPM740 of the present invention.

Fig. 4 is ApNPV expression vector PAPM741 of the present invention, 748,736 establishment synoptic diagram.

Fig. 5 be among the present invention DE glycoprotein at the expression synoptic diagram of tussah silkworm chrysalis body.

The invention will be further described to utilize the example shown in the accompanying drawing: in tussah NPV carrier shown in Figure 1-tussah live body host expression system synoptic diagram, at first prepare ApNPV-DNA: with the cocoon chrysalis body wall percutaneous puncture-inoculation APNPV virus of termination of diapause, place 18～20 ℃ to hatch, collect silkworm chrysalis body fluid low-speed centrifugal remove slag matter and viral polyhedron after about 7 days, with supernatant 4 ℃ of following 29K ultracentrifugations 2 hours, supernatant discarded is suspended in precipitation in 0.1 * TE(PH=7.6), deposited 10～14 hours at 4 ℃, sucrose density gradient centrifugation, respectively the 4.75ml 50% sucrose-0.1 * TE of preparation and 4.75ml 10% sucrose-0.1 * TE are slowly joined successively earlier and form bed course in the centrifuge tube, add the 1.8ml virion then and give sample, at 4 ℃ of following 20K after centrifugal 90 minutes, usually in centrifuge tube, locate to have a virion subband clearly on the lower side, careful sucking-off, and with 3 times of 0.1 * TE dilutions, centrifugal 90 minutes of 4 ℃ of following 30K; Discard supernatant, with the virus particle amount of being suspended in 10mM Tris-Hcl(PH=7.5)-1mME DTA damping fluid in, 10% SDS that adds 1/10 volume, 1/10 volume 20mg/ml Proteinase K, 50 ℃ are incubated 2～5 hours, use phenol/chloroform, each extracting secondary of chloroform, the water dna solution can directly use or ethanol sedimentation after be dissolved among 1 * TE stand-byly again, the ApNPV-DNA that so obtains can be used for next step gene clone and transfection.

The clone of polyhedron gene, determining of nucleotide sequence analysis and ApNPV nuclear polyhedron gene rna transcription starting point: ApNPV-DNA is used restriction enzyme EcoR I respectively, the BamH I, the Pst I, the Hind III, Pvu II enzymolysis, 0.8% agarose gel electrophoresis, and fragment transferred on the nitrocellulose filter, with yellow cloth poison moth nucleopolyhedrosis virus (OpNPV) nuclear polyhedron gene probe hybridization, the DE fragment of BamH I has specific hybrid as a result, this two fragment is cloned into respectively on the PAT153 plasmid BamH I site, forms PAPD and PAPE plasmid.With further the DE fragment being carried out enzyme spectrum analysis with quadrat method, nucleic acid hybridization, determine that ApNPV nuclear polyhedron gene lays respectively at Pvu II-BamH I (1.4Kb) fragment and the BamH I on the E fragment-Pst I (2.6Kb) fragment on the D fragment, two fragments are separated respectively, and be cloned on the corresponding site (Sac I-BamH I-Pst I) of PUC19 plasmid, form the PAP1426 plasmid, then this plasmid is prepared the 1.4Kb fragment with Ecor I (PUC19 carrier point of contact) and BamH I enzymolysis, and be cloned in the M13 phage vector, extract single stranded DNA and carry out sequential analysis as template, read from BamH I site, read this gene 5 ' end 141bp encoding sequence and portion gene regulating and controlling sequence, according to this gene nucleotide series of reading out, artificial synthetic oligonucleotide's primer, directly to be loaded with ApNPV nuclear polyhedron gene, PAP1426 plasmid double-stranded DNA is that template is carried out APNPV nuclear polyhedron gene whole coding sequence and 5 ' end, the analysis of 3 ' distolateral alar part non-coding sequence, as shown in Figure 2, sequence (nt+142～+ 166) synthetic minus strand Oligonucleolide primers according to ApNPV nuclear polyhedron gene, sequence is: 5 ' GACCATGTAATTGTCTAAAGGATC3 ' is a template with ApNPV nucleopolyhedrosis virus mRNA, press the synthetic cDNA of Primer extension method, and be that the DNA marker of template preparation carries out sequential analysis PAGE electrophoresis simultaneously with same primers as and PAP1426 plasmid DNA.ApNPV rna transcription starting point is positioned at the A(VITAMIN B4 of the 4th Nucleotide of 12 Nucleotide of the baculovirus nuclear polyhedron gene high conservative regulating and controlling sequence of nt-50 as a result) go up (AATAAGTACATT).

In Fig. 3 and ApNPV expression vector PAPM740 shown in Figure 4,741,748,736 establishment synoptic diagram, according to clone's the segmental zymogram of BamH I DE that is loaded with ApNPV nuclear polyhedron gene and dna sequence analysis result such as determine with R mRNA transcripting start point, Pstl-BamH I (3.4kb), the BamH I-Pas I (3.3kb) that will be loaded with ApNPV nuclear polyhedron gene encoding sequence and 5 ' end and 3 ' terminal non-coding sequence respectively are cloned in the PUC19 vector plasmid, have set up PD ₃₄And PE ₃₃Plasmid, will be loaded with then ApNPV nuclear polyhedron gene 5 ' end group because of PD34 plasmid DNA Sac I-BamH I (0.9kb) fragment cloning of regulating and controlling sequence and 141bP5 ' end encoding sequence in M13 mp18, prepare single stranded DNA.Nucleotide sequence synthetic oligonucleotide primer thing according to these gene initiation codon (ATG) both sides: 3 ' ... GATATTGATAAGGTCT ... 5 ', " Eckstein " method of employing is carried out the point mutation of Oligonucleolide primers guiding.With the sudden change after DNA transformed into escherichia coli gained plaque with ³²The Oligonucleolide primers of P mark is that probe is hybridized, and obtains positive mutant strain.The M13 phage that is loaded with the mutant DNA sequence is increased in JM103 host bacterium, and extracting RFDNA separates Sac I-BamH I fragment, and this fragment cloning is returned in the PD34 vector plasmid.BamH I-Pst I the fragment of ApNPV nuclear polyhedron gene nt+142 rear section encoding sequence and 3 ' terminal flanking sequence will be loaded with again in the PE33 plasmid, clone the BamH I-Pst I site of this fragment cloning through series to PD34, set up the PAPM740 transfer vector, the exogenous gene cloning site is nt+141BamH I point of contact.Pvu II-BamH I 1.4kb the fragment cloning (P14) in the PUC19 carrier of 5 ' terminal gene regulating and controlling sequence will be loaded with, and according to the synthetic positive strand primer of PUC19 carrier DNA sequence: 5 ' ... CGACGTTGTAAAACGACGGCCAGT ... 3 ', then according to ApNPV nuclear polyhedron gene 5 ' terminal encoding sequence, three minus strand primers have been synthesized respectively, with nt+2～nt+140, nt+9～+ 140 and nt+37～+ 140 sequences) remove, and three minus strand primers of adding BamH I enzyme point of contact sequence are as follows respectively: (+) 1,5 ' ... GTATGAGTAATGGATCCTAGTTATAGGAAATTTTAC ... 3 '; (+) 8,5 ' ... GGTCGGCCGGTAT GGATCCTCTGGAATAGTTATAGG

BamHI

3′;（+36），5′…CTTGTTGTC GGATCC AGATCTGCGACCAATGGTCGG…

BamHI BgIⅡ

3 ' be that template is carried out PCR reaction with above-mentioned 3 pairs of primers respectively with the P14 plasmid DNA, and 3 PCR product fragments are cut separation Sac I-BamH I fragment respectively with BamH I-Sac I enzyme; The PAPM740 transfer vector is cut with BamH I-Sac I enzyme, remove BamH I-Sac I 0.9Kb fragment, and as carrier, isolating PCR Sac I-BamH I fragment is cloned into respectively again and has set up PAPM741,748 and 736 transfer vectors in this carrier, its exogenous gene cloning site is respectively at nt+1, nt+8 and nt+36(BamH I point of contact).

In Fig. 5, the contained expression of exogenous gene of ApNPV carrier is example with carrier PAPM748 at cocoon chrysalis expression in vivo DE glycoprotein gene: the DE glycoprotein gene is cloned on the BamH I site of carrier PAPM748, through amplification, extracting reorganization foreign gene plasmid DNA, then with ApNPV-DNA transfection cocoon chrysalis, and in incubated at room, after the about week, silkworm chrysalis body surface generation pathological change, silkworm chrysalis tissue fester after about 20 days.Liquefaction, get under the silkworm chrysalis body fluid mirror and observe, there are a large amount of polyhedrosis viruses to exist, collect transfection silkworm chrysalis body fluid extracting DNA, oligonucleotide with synthetic DE protein gene distinguished sequence is that primer carries out PCR mensuration, found that DE gene band, PCR amplified synthetic DE gene fragment is carried out enzyme spectrum analysis and its enzyme of sequencing is the DE protein gene, show that this gene recombinated in the ApNPV genome, in order to confirm the stability of the virus that the transfection silkworm chrysalis forms, the silkworm chrysalis body fluid of transfection morbidity is carried out 10 times of dilutions with the Grace substratum, be respectively 10,10 ^-2, 10 ^-4With 10 ^-6Concentration, diluent with this different concns infects cocoon chrysalis again, the silkworm chrysalis of two weeks postoperative infection is fallen ill successively, its invasioning sequence is to infect high concentration diluting liquid to the lower concentration diluent, the morbidity silkworm chrysalis is typical viral pupa illness and pathology, for whether the further DE albumen that confirms is got viral pupal cell liquid by expression and is carried out immunoprecipitation and SDS-PAGE Western blotting detection with DE albumen specific antibody, and with AcNPV-SF ₉The DE albumen that vector expression system is expressed found that in contrast this DE protein gene really is formed on the cocoon chrysalis expression in vivo with non-fusion rotein, its expression amount and AcNPV-SF ₉Vector expression system relatively (V/V) is high more than 100 times.In Fig. 5, A is the PCR detected result of reorganization DE gene: (a1) 1-untransfected cocoon chrysalis contrast, 2-ApNPV infects the cocoon chrysalis contrast, the contrast of 3-PAPM748-DE plasmid DNA transfection cocoon chrysalis, 4,5, the cocoon chrysalis of 6-cotransfection, the contrast of 7-DE gene PCR, B is that expressed proteic immunoprecipitation of DE and Westernblotting analyzes: 1, the anti-DE serum of 9-; 2-does not infect the cocoon chrysalis contrast; 3-ApNPV infects cocoon chrysalis contrast, 4～8, the cocoon chrysalis of 10～16-recombinant virus infection; The 16-AcNPV carrier is at SF ₉Express the contrast of DE albumen in the cell.

Claims (1)

1, a kind of method that is used for engineered with cocoon chrysalis production exogenous genes products, it is that the APNPV DNA that the virus particle with purifying obtains through extracting carries out restriction enzyme enzyme spectrum analysis, agarose gel electrophoresis, Southern transfer printing, and be that probe carries out molecular hybridization and determines the position of polyhedron gene in the ApNPV genome with OpNPV nuclear polyhedron gene, it is characterized in that:

A. use escherichia coli vector plasmid (PAT153, Puc19) clone, the dna fragmentation of contained this gene of propagation is Pvu II--the BamHI--PstI fragment of BamHI fragment and 3 ' end of 5 ' end, be that template adopts the dideoxy sequence analysis method that the dna fragmentation of being cloned is carried out nucleotide sequence analysis with single stranded DNA and double-stranded DNA respectively, read whole coding sequence 735bp and its two flanking regions part non-coding sequence of the gene of tussah NPV nuclear polyhedrin, adopt Primer Extension method to determine that this gene mRNA transcripting start point is positioned at the A site of nt--50, and then determine the position of 5 ' terminal gene expression regulation sequence of this gene;

B, adopt technology such as sudden change of artificial synthetic oligonucleotide's primer pilot point and PCR that the initiator codon of ApNPV polyhedron gene is removed (ATG sports ATT) to cut away nt+2～+ 140, nt+9～+ 140 and nt+37～+ 140 5 ' terminal encoding sequence simultaneously respectively, set up PAPM740,741, serial genes transfer vectors such as 748 and 736;

C, foreign gene is cloned into respectively in four carriers being set up, the extracting recombinant plasmid dna, and, treat to get its viral liquid respectively with plaque method or terminal dilution method separation foreign gene recombinant virus behind tussah cell or the cocoon chrysalis infection morbidity with the delicate or cocoon chrysalis of extractive ApNPV DNA transfection tussah ovary;

D can obtain exogenous genes products with isolating recombinant virus infection cocoon chrysalis through separation, purifying.

Images