CN108624514A - One plant of m5-2 Pei Lijin Bipolaris Bipolaris peregianensis and its application - Google Patents
One plant of m5-2 Pei Lijin Bipolaris Bipolaris peregianensis and its application Download PDFInfo
- Publication number
- CN108624514A CN108624514A CN201810663498.8A CN201810663498A CN108624514A CN 108624514 A CN108624514 A CN 108624514A CN 201810663498 A CN201810663498 A CN 201810663498A CN 108624514 A CN108624514 A CN 108624514A
- Authority
- CN
- China
- Prior art keywords
- bipolaris
- pei
- lijin
- peregianensis
- herbicide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Agronomy & Crop Science (AREA)
- Dentistry (AREA)
- Plant Pathology (AREA)
- Pest Control & Pesticides (AREA)
- Environmental Sciences (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The present invention relates to one plant of 2 Pei Lijin Bipolaris of m5Bipolaris peregianensisAnd its application.The bacterial strain was preserved in Guangdong Province's Culture Collection, preserving number on July 11st, 2016：GDMCC.NO:60057.The m5 2 Pei Lijin Bipolaris provided by the invention obtained from Bermuda grass diseased plantBipolaris peregianensisGrassy weed can effectively be prevented and kill off, the herbicide being made from it is environmentally friendly, can inhibit the drug resistance and development of drug resistance of weeds, is conducive to the popularization of pollution-free food and organic agriculture, and it is at low cost, pollution-free, to Crop securify.
Description
Technical field
The invention belongs to field of biological control, and in particular to one plant of m5-2 Pei Lijin BipolarisBipolaris peregianensisAnd its application.
Background technology
Chemical herbicide because its effect is rapid, using characteristics such as simplicity, rapidly developed in China, however, with
Chemical agent is widely used so that the huge pollution of environment and Pesticide Residue have seriously affected agroecological sustainable development
Exhibition.Therefore, the development and utilization of biological pesticide plays important role in environmentally friendly agricultural and weeds comprehensive treatment (IPM).
Microbial herbicide is a kind of herbicide developed as raw material using living microorganisms and its metabolite, because it endangers to environment
Evil is small and becomes the important research direction in one, herbicide field.Recently the study found that plant pathogenic fungi live body and its secretion
Secondary metabolite have activity of weeding.Microorganism weeding is developed using weeds disease fungus live body and its secondary metabolite
Agent generally has the characteristics that action site and the mode of action are multifarious, weeds be not likely to produce drug resistance, development cost it is low, to ring
Border is harmless, shows good development prospect.
Bermuda grass (Cynodon dactylon(Linn.) Pers.) also known as Bermuda grass, it is distributed widely in the world
Each department.It is good dyke strengthening soil-keeping plants for herbaceos perennial, it is common that lawn or court are built with paving；But works as and be grown on
When orchard or farmland, then the difficult injurious weed eliminated.Bermuda grass fertility is strong, the speed of growth is fast, growth period is long, adaptability
By force, it can be grown in various soil environments.The Bermuda grass in farmland also often competes moisture content and nutrient with crops, seriously affects work
It is close by field even can to form dominant population when serious, causes crop Severe Reduction for object growth and development and quality and yield.
To Bermuda grass weeds to prevent and kill off method main at present or by artificial or chemical method, artificial weeding is taken a lot of work expense
When, and chemical weed control causes environmental pollution and leads to the generation of weed population resistance, so seek except the above two methods with
The outer method for preventing and kill off Bermuda grass has become further urgent.The research and development of biological weed killer is paid more and more attention at present,
Becoming an effective new way using control of microorganisms Weed infestation, it may have huge market prospects.
Invention content
It is an object of the invention to overcome preventing and kill off for Bermuda grass weeds in the prior art time-consuming, environmental pollution is easily caused
And lead to the defect of the generation of weed population resistance, one plant of m5-2 Pei Lijin Bipolaris is providedBipolaris peregianensis.M5-2 Pei Lijin Bipolaris provided by the inventionBipolaris peregianensisCan effectively it prevent
Except grassy weed.
Another object of the present invention is to provide the m5-2 Pei Lijin BipolarisBipolaris peregianensis
Application in cutting weeds.
Another object of the present invention is to provide a kind of herbicides.
For achieving the above object, the present invention adopts the following technical scheme that：
One plant of m5-2 Pei Lijin BipolarisBipolaris peregianensis, the bacterial strain is on July 11st, 2016, guarantor
It is hidden in Guangdong Province's Culture Collection, preserving number：GDMCC.NO:60057.
The new strains m5-2 of the present invention（Bipolaris peregianensis）On July 11st, 2016, it is preserved in wide
East saves Culture Collection, preserving number：GDMCC.NO:60057.The bacterial strain is through morphology and molecular biology identification
Pei Lijin Bipolaris, be under the jurisdiction of cochliobolus category (Cochliobolus Drechsler the) [imperfect stage:Bipolaris
(BipolarisShoemarker)], lattice spore chamber Cordycepps (Pleosporaceae Nitschke), lattice spore chamber Zoopagales
(Pleosporales LuttrellBarr), lattice spore Loculoascomycetidae (Pleosporomycetidae), seat capsule Gammaproteobacteria
(Dothideoetes), Nang Junmen (Ascomycota), mycota (Fungi).
Inventor obtains the bacterial strain by following approach and identifies, it is multiple to China area grass family diseases into
Row investigation after finding Bermuda grass disease, records Disease symptoms and shoots field damage symptom, acquire the grass cutting blade of morbidity in detail
And stalk, carry out microscopy after taking back laboratory.
The isolation and purification process of pathogen is as follows：
Morbidity Bermuda grass, which is caught an illness on blade, there is brown to the ellipse of mulberry, the spot of fusiformis, as spot expands, leaf
Sheath, stem, root are also infected.Blade surface generates black mustiness object, as conidiophore under conditions of humidity, works as morbidity
When more serious, most plant withered deaths, and form the withered grass spot of dark brown.Selection scab typically fall ill grass cutting blade punching
After wash clean, the fritter tissues that intersection cuts the mm of 3 mm × 3 are good for from the disease of site of pathological change, the completion of sample clip is placed on
1 min is sterilized in 2.5% liquor natrii hypochloritis, is changed clothes 3 times with sterile water again later, immigration potato dextrose agar
PDA, addition gentamicin (1mL/L) is to inhibit bacterial growth ］ on culture medium, 25 DEG C of constant temperature incubations.It is protected after pathogen is purified
It is stored on PDA slant mediums, it is spare to be placed in 4 DEG C of freezer storages.
Preferably, the rDNA-ITS sequences of the bacterial strain such as SEQ ID NO：Shown in 1.
Preferably, it is 70 mm, black, felt that the bacterial strain, which is the colony diameter formed after culture 5d in PDA culture medium,
Shape, bacterium colony back side taupe；The mycelia yellowish-brown of the bacterial strain has branch, and more diaphragms, conidiophore Dan Sheng, minority, which collects, gives birth to,
Cylindric or shape of going down on one's knees, brown are 4 ~ 9 μm wide up to 94.5 ~ 147 μm；Conidium is bent, spindle, wide ellipse, secretly
Brown has 6 ~ 10 false dissepiments, 58.5 ~ 84.5 × 13.5 ~ 18.5 μm of size.
The Morphological Identification of the pathogen is as follows：
Monospore purifying and culture, by inoculation in PDA culture medium, 25 DEG C of constant temperature incubations 5 are carried out to the fungi that separation obtains
Each colonial morphology is observed and recorded after d.The conidial production of continuous observation pathogen bacterium colony, and under an optical microscope
Observe its form and conidial fructification feature, measure 50 pathogen spores and sporophore size etc., consult related monograph document into
Row identification.After growing 5 d at 25 DEG C in PDA culture medium, the colony diameter of culture is up to 70 mm, black, felted, the bacterium colony back side
Taupe.Bacterium colony is not easy to produce spore in PDA culture medium, and mycelia yellowish-brown has branch, more diaphragms, conidiophore Dan Sheng, minority
Collection life, cylindric or shape of going down on one's knees, brown are 4 ~ 9 μm wide up to 94.5 ~ 147 μm.Conidium is bent, spindle, wide ellipse
Shape, crineous have 6 ~ 10 false dissepiments, 9 most, 58.5 ~ 84.5 × 13.5 ~ 18.5 μm of size.Pass through morphology and culture
Character observe, and investigate document [Manamgoda, D. S., Rossman, A. Y., Castlebury, L. A.,
Crous, P. W., Madrid, H., Chukeatirote, E., & Hyde, K. D. (2014). The genusbipolaris. Studies in mycology, 79, 221-288.].Primarily determine that pathogen is that Pei Lijinping navels are compacted
Spore (Bipolaris peregianensis)。
The molecular biosciences identification of the pathogen is as follows：
Strains tested is transferred in fresh PDA culture medium and is cultivated 10 days, scraped mycelia with the transfer needle of sterilizing, reference
DNA secure plant genes group DNA extraction kit specifications（Takara, Dalian）Pathogenic bacteria gene group is carried
It takes.Utilize the design rDNA-ITS such as White area universal primer ITS-1（5’-TCCGTAGGTGAACCTGCGG-3’）And ITS-4
（5’-TCCTCCGCTTATTGATATGC-3’）（Give birth to the synthesis of work biology Co., Ltd in Shanghai）, to be isolated from Bermuda grass pathogen base
Because group is that template carries out PCR amplification, it is contemplated that about 580 bp of product.PCR amplification system：2×Taq PCR MasterMix 25 μL
（Takara, Dalian）, each 1 μ L of 20 μm of ol/L primers, 1 μ L of template DNA add sterilizing distilled water to 50 μ L.PCR reacts item
Part：94 DEG C of preheating 4min；94 DEG C of 40s, 62 DEG C of 45s, 72 DEG C of 1min, totally 32 recycle；72 DEG C of 10 min of extension.To own
PCR products, which are separately added into 0.1% Ago-Gel, carries out electrophoresis, after ethidium bromide staining, is detected in gel imager,
By PCR product Shanghai Sheng Gong Co., Ltds（Raw work, Shanghai）Carry out DNA sequencing.By the ITS sequence of separating obtained pathogen with
Gen-Bank nucleic acid databases are compared, according to the morphological feature of germ, cultural colony and pathogenic, binding sequence analysis,
Pathogen is identified.It is used in combination MEGA5.0 to carry out Phylogenetic Analysis and chadogram structure, with Neighbor-joining methods
Chadogram is built, number of bootstrapping is 1000 times.After being expanded to the r DNA-ITS sequences of cause of disease bacteria strain m5-2, PCR is produced
Object is sequenced after purification, and sequencing obtains the r DNA-ITS sequence fragments of 580 bp or so respectively, is consistent with desired clip size.Profit
With the BLAST softwares in the websites NCBI, sequence analysis is carried out to the sequence of surveyed bacterial strain：The bacterial strain pathogen and Pei Lijin
The homology of Bipolaris has reached 99 %.It is by sequence alignment result secondary proof Bermuda grass pathogenic bacteriaB. peregianensis.From the phylogenetic tree of structure it is found that being isolated from the Pei Lijin Bipolaris and ncbi database of Bermuda grass
HaveB. peregianensisGather in same taxon, and Bipolaris (Bipolaris) cannot gather at one point
Branch, to prove that from bacterial strain of the present invention be Pei Lijin Bipolaris.
Above-mentioned m5-2 Pei Lijin Bipolaris is also claimed in the present inventionBipolaris peregianensisIt is cleaning
Application in grass.
Preferably, the weeds are grassy weed.
It is further preferable that the grassy weed is Bermuda grass, eleusine indica, lady's-grass or Herba panici repentics.
The m5-2 Pei Lijin BipolarisBipolaris peregianensisIt is applicable to non-grass family growing area
In farmland and gardens, it is preferred for preventing and kill off grassy weed in dicotyledon, orchard and garden environment.
A kind of herbicide, the weeding include above-mentioned bacterial strains m5-2 Pei Lijin BipolarisBipolaris peregianensisRaw toxin, active somatic cell mycelia and conidial mixture.
Signified Raw toxin of the invention is the secondary metabolite of the bacterial strain.
Herbicide provided by the invention is environmentally friendly, can inhibit the drug resistance and development of drug resistance of weeds, is conducive to green
The popularization of food and organic agriculture, and it is at low cost, pollution-free, to Crop securify.
Raw toxin, active somatic cell mycelia and conidial mixture in the herbicide can be prepared via a method which
It arrives：Take the bacterial strain m5-2 Pei Lijin BipolarisBipolaris peregianensisPathogen bacterium after cultivating 5 d
It falls edge and is beatened to take bacteria cake 5 and be inoculated in dehydrated potato powder agar fluid nutrient medium, in 25 DEG C of 10 d of culture in shaking table, then mistake
Filter obtains the Extracted toxin liquid and active somatic cell mycelia and conidium mixture of bacterial strain.
The herbicide can be processed into a variety of dosage forms, such as liquor, emulsion, suspending agent, pulvis, granule, wettable powder, water
Dispersible granule etc. is preferably processed into the dosage form suitable for being spray applied.Carrier used in above-mentioned dosage form is subjected in Pesticide Science
Carrier, preferably pesticide field is common and is being biologically inert carrier, can be the form of solid or liquid.Gu
The example of body carrier includes mineral, such as clay, talcum, kaolin, montmorillonite, white carbon, zeolite, silica and diatomite；Plant material
Material, such as corn flour, bean powder or starch；High-molecular compound, such as polyvinyl alcohol, polyglycols.The example of liquid-carrier includes various
Organic solvent, such as decane and dodecane, vegetable oil, mineral oil and water.
As needed, the cosurfactants such as surfactant, adhesive, stabilizer can be used in herbicide of the invention,
Antioxidant or PH adjustments etc. can be used in such as polysorbas20, Tween 80, stabilizer.Mitogenetic spore in herbicide provided by the invention
Subnumber amount changes with the form of preparation and the method for application.
Preferably, when the herbicide is pulvis, granule, wettable powder or water dispersible granules（That is solid pharmaceutical preparation）
When, conidial quantity is 1 × 10 in the herbicide5~1×108A spore/gram.
It is further preferable that conidial quantity is 1 × 10 in the herbicide6~1×107A spore/gram.
Preferably when the herbicide is liquor, emulsion or suspending agent, conidium in the flushing liquor of the herbicide
Content be 1 × 104~1×106 A spore/mL.
It is further preferable that conidial content is 1 × 10 in the flushing liquor of the herbicide5~1×106 A spore/
mL。
The herbicide of the present invention can be used cooperatively with other suitable chemical herbicide, to reduce chemical herbicide
Dosage reduces the pollution to environment.
Compared with prior art, the present invention has the advantages that：
The m5-2 Pei Lijin Bipolaris provided by the invention obtained from Bermuda grass diseased plantBipolaris peregianensis
Grassy weed can be effectively prevented and kill off, the herbicide being made from it is environmentally friendly, can inhibit the drug resistance and development of drug resistance of weeds,
Be conducive to the popularization of pollution-free food and organic agriculture, and it is at low cost, pollution-free, to Crop securify.
Description of the drawings
Fig. 1 is m5-2 Pei Lijin BipolarisBipolaris peregianensisConidium picture.
Specific implementation mode
With reference to embodiment, the present invention is further explained.These embodiments are merely to illustrate the present invention rather than limitation
The scope of the present invention.Test method without specific conditions in lower example embodiment usually according to this field normal condition or is pressed
The condition suggested according to manufacturer；Used raw material, reagent etc., unless otherwise specified, being can be from the business such as conventional market
The raw materials and reagents that approach obtains.The variation for any unsubstantiality that those skilled in the art is done on the basis of the present invention
And it replaces and belongs to scope of the present invention.
The separation of 1 pathogen of embodiment and purifying, CHARACTERISTICS IDENTIFICATION
（1）The isolation and purification of pathogen
Morbidity Bermuda grass, which is caught an illness on blade, there is brown to the ellipse of mulberry, the spot of fusiformis, as spot expands, leaf
Sheath, stem, root are also infected.Blade surface generates black mustiness object, as conidiophore under conditions of humidity, works as morbidity
When more serious, most plant withered deaths, and form the withered grass spot of dark brown.Selection scab typically fall ill grass cutting blade punching
After wash clean, the fritter tissues that intersection cuts the mm of 3 mm × 3 are good for from the disease of site of pathological change, the completion of sample clip is placed on
1 min is sterilized in 2.5% liquor natrii hypochloritis, is changed clothes 3 times with sterile water again later, immigration potato dextrose agar
PDA, addition gentamicin (1ml/L) is to inhibit bacterial growth ］ on culture medium, 25 DEG C of constant temperature incubations.It is protected after pathogen is purified
It is stored on PDA slant mediums, it is spare to be placed in 4 DEG C of freezer storages.
（2）The Morphological Identification of pathogen
Monospore purifying and culture, by inoculation in PDA culture medium, 25 DEG C of constant temperature incubations 5 are carried out to the fungi that separation obtains
Each colonial morphology is observed and recorded after d.The conidial production of continuous observation pathogen bacterium colony, and under an optical microscope
Observe its form and conidial fructification feature, measure 50 pathogen spores and sporophore size etc., consult related monograph document into
Row identification.After growing 5 d at 25 DEG C in PDA culture medium, the colony diameter of culture is up to 70 mm, black, felted, the bacterium colony back side
Taupe.Bacterium colony is not easy to produce spore in PDA culture medium, and mycelia yellowish-brown has branch, more diaphragms, conidiophore Dan Sheng, minority
Collection life, cylindric or shape of going down on one's knees, brown are 4 ~ 9 μm wide up to 94.5 ~ 147 μm.Conidium（Such as Fig. 1）Bending, spindle,
Wide ellipse, crineous have 6 ~ 10 false dissepiments, 9 most, 58.5 ~ 84.5 × 13.5 ~ 18.5 μm of size.Pass through morphology
It is observed with cultural colony, and investigates document [Manamgoda, D. S., Rossman, A. Y., Castlebury, L.
A., Crous, P. W., Madrid, H., Chukeatirote, E., & Hyde, K. D. (2014). The
genus bipolaris. Studies in mycology, 79, 221-288.].Primarily determine that pathogen is Pei Lijin
Bipolaris (Bipolaris peregianensis)。
（3）The molecular biosciences of pathogen is identified
Strains tested is transferred in fresh PDA culture medium and is cultivated 10 days, scraped mycelia with the transfer needle of sterilizing, reference
DNA secure plant genes group DNA extraction kit specifications（Takara, Dalian）Pathogenic bacteria gene group is carried
It takes.Utilize the design r DNA-ITS such as White area universal primer ITS-1（5’-TCCGTAGGTGAACCTGCGG-3’）And ITS-4
（5’-TCCTCCGCTTATTGATATGC-3’）（Give birth to the synthesis of work biology Co., Ltd in Shanghai）, to be isolated from Bermuda grass pathogen base
Because group is that template carries out PCR amplification, it is contemplated that about 580 bp of product.PCR amplification system：2×Taq PCR MasterMix 25 μL
（Takara, Dalian）, each 1 μ L of 20 μm of ol/L primers, 1 μ L of template DNA add sterilizing distilled water to 50 μ L.PCR reacts item
Part：94 DEG C of preheating 4min；94 DEG C of 40s, 62 DEG C of 45s, 72 DEG C of 1min, totally 32 recycle；72 DEG C of 10 min of extension.To own
PCR products, which are separately added into 0.1% Ago-Gel, carries out electrophoresis, after ethidium bromide staining, is examined in gel imager
It surveys, by PCR product Shanghai Sheng Gong Co., Ltds（Raw work, Shanghai）Carry out DNA sequencing.By the ITS sequence of separating obtained pathogen
It is compared with Gen-Bank nucleic acid databases, according to the morphological feature of germ, cultural colony and pathogenic, binding sequence point
Analysis, identifies pathogen.It is used in combination MEGA5.0 to carry out Phylogenetic Analysis and chadogram structure, uses Neighbor-
Joining methods build chadogram, and number of bootstrapping is 1000 times.The rDNA-ITS sequences of cause of disease bacteria strain M5-2 are expanded
Afterwards, PCR product is sequenced after purification, sequencing obtains the r DNA-ITS sequence fragments of 580 bp or so respectively, big with desired segment
It is small to be consistent.Using the BLAST softwares in the websites NCBI, sequence analysis is carried out to the sequence of surveyed bacterial strain：The bacterial strain pathogen
99 % are reached with the homology of Pei Lijin Bipolaris.It is by sequence alignment result secondary proof Bermuda grass pathogenic bacteriaB. peregianensis.From the phylogenetic tree of structure it is found that being isolated from the Pei Lijin Bipolaris and ncbi database of Bermuda grass
HaveB. peregianensisGather in same taxon, and Bipolaris (Bipolaris) cannot gather at one point
Branch, to prove that from bacterial strain of the present invention be Pei Lijin Bipolaris..
Specifically, rDNA-ITS sequences are as follows：
TCCGTAGGTGAACCTGCGGAGGGATCATTACACAACAAAATATGAAGGCCTGGCTTCGCGGCCGGCTGAAATA
TTTTTTTTCACCCGTGTCTTTTGCGCACTTGTTGTTTCCTGGGCGGGCTCGCCCGCCACCAGGACCAAACCATAAAC
CTTTTTCTTTTGCAGTTTTCATCAGCGTCAGTAAAAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGG
TTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT
GAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGG
TGTTGGGCGTTTTTTGTCTCTCCTTGCGGGAGACTCGCCTTAAAACGATTGGCAGCCGGCCTACTGGTTTCGGAGCG
CAGCACATTTTTTGCGCTTTGTATCAGGAGAAAAGGACGGTACTCCATCAAGACGTTTACATTTTTAACTTTTGACC
TCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA。
2 m5-2 Pei Lijin Bipolaris of embodimentBipolaris peregianensisBiological test
By Inoculation Method, m5-2 bacterial strains are measured to the pathogenic of common weed and crops seedling stage, to understand its host's model
It encloses.
Test plant (list is shown in Table 1) seed is seeded in the plastic flowerpot of 10 cm of diameter, each 9 basin of plant seeding,
It it is being 25 DEG C, the photoperiod is to be cultivated in the environment of 12 h substitute.It is inoculated with when test plant reaches 2-4 piece true leaves, according to
The plant size of test plant retains 5 ~ 10 plants per basin.
Using two kinds of inoculation methods：(1) spore suspension spray-on process is used to be inoculated with：The bacterial strain m5-2 is cultivated in PDA
After 10 d of base culture, spore is scraped with sterile cover slips, is equipped to 1 × 106The aqueous solution of a spore/ml.Use micro-sprayer
The spore suspension of mixing is uniformly sprayed onto for trying on plant, each 3 basin of plant inoculating.(2) secondary metabolite spray-on process
Inoculation：Pathogen colony edges of the bacterial strain m5-2 after cultivating 5 d is beatened to take bacteria cake 5 and is inoculated in dehydrated potato powder agar solution
In body culture medium, in 25 DEG C of 10 d of culture in shaking table, then filters, obtain bacterial strain Raw toxin, with micro-sprayer by mixing
Spore suspension be uniformly sprayed onto for examination plant on, each 3 basin of plant inoculating.Another 3 basin spray sterile water compares.After inoculation
Plant is placed in closed container moisturizing culture at room temperature and for 24 hours, then moves on in growth cabinet and cultivate, and daily illumination/dark is handed over
For 12h, temperature 28 DEG C/25 DEG C (illumination/dark), relative humidity 90%.After being inoculated with 1 week incidence is recorded by following standards.
Severity Scaling standard：0 grade is fallen ill for no plant；1 grade：Incidence of leaf is 1% ~ 10%；2 grades：Incidence of leaf is 10% ~ 30%；3 grades：
Incidence of leaf is 30% ~ 50%；4 grades：Incidence of leaf is 50% ~ 70%；5 grades：Incidence of leaf is 70% ~ 100%.
Pathogenicity result
Carries out activity of weeding detection with the bacterial strain spore and 9 kinds of weeds of Raw toxin pair and 5 kinds of crops, find bacterial strain conidium and
Raw toxin for examination weeds to all having certain killing activity.Wherein bacteria cake is to standing grain such as Herba panici repentics, lady's-grass, Bermuda grass, eleusine indicas
Undergraduate course weeds lethality reaches 4 grades or more, and Raw toxin has reached 5 grades to the lethality of several weeds.To centella, jealous woman slurry
Grass, the pathogenic of alternanthera philoxeroides have reached more by force 2-3 grades, however weaker to the lethality of tassel flower, bacteria cake and Raw toxin
Pathogenic is 1 grade.Have to rice and corn weak pathogenic, therapeutic intensity is 1-2 grades, and to soybean, watermelon and radish are without cause
Characteristic of disease.Blade is compareed without disease symptom.
1 bacterial strain m5-2 conidiums of table from go out toxin to the pathogenic of different plants
| For trying plant | Conidium | Raw toxin | Control |
| Herba panici repentics | 4 | 5 | 0 |
| Centella | 3 | 2 | 0 |
| Drink slurry grass | 3 | 3 | 0 |
| Lady's-grass | 4 | 5 | 0 |
| Tassel flower | 1 | 1 | 0 |
| Bermuda grass | 5 | 5 | 0 |
| Alternanthera philoxeroides | 2 | 3 | 0 |
| Bidens pilosa | 2 | 1 | 0 |
| Eleusine indica | 5 | 5 | 0 |
| Rice | 2 | 1 | 0 |
| Corn | 1 | 2 | 0 |
| Soybean | 0 | 0 | 0 |
| Watermelon | 0 | 0 | 0 |
| Radish | 0 | 0 | 00 |
Note：Severity Scaling standard：Severity Scaling standard：0 grade is fallen ill for no plant；1 grade：Incidence of leaf is 1% ~ 10%；2 grades：Hair
Sick blade is 10% ~ 30%；3 grades：Incidence of leaf is 30% ~ 50%；4 grades：Incidence of leaf is 50% ~ 70%；5 grades：Incidence of leaf is 70%
~100%。
Sequence table
<110>South of the Five Ridges college of education
<120>One plant of m5-2 Pei Lijin Bipolaris Bipolaris peregianensis and its application
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 587
<212> DNA
<213>Pei Lijin Bipolaris (Bipolaris peregianensis)
<400> 1
tccgtaggtg aacctgcgga gggatcatta cacaacaaaa tatgaaggcc tggcttcgcg 60
gccggctgaa atattttttt tcacccgtgt cttttgcgca cttgttgttt cctgggcggg 120
ctcgcccgcc accaggacca aaccataaac ctttttcttt tgcagttttc atcagcgtca 180
gtaaaaaaca atgtaattat tacaactttc aacaacggat ctcttggttc tggcatcgat 240
gaagaacgca gcgaaatgcg atacgtagtg tgaattgcag aattcagtga atcatcgaat 300
ctttgaacgc acattgcgcc ctttggtatt ccaaagggca tgcctgttcg agcgtcattt 360
gtaccttcaa gctttgcttg gtgttgggcg ttttttgtct ctccttgcgg gagactcgcc 420
ttaaaacgat tggcagccgg cctactggtt tcggagcgca gcacattttt tgcgctttgt 480
atcaggagaa aaggacggta ctccatcaag acgtttacat ttttaacttt tgacctcgga 540
tcaggtaggg atacccgctg aacttaagca tatcaataag cggagga 587
Claims (10)
1. one plant of m5-2 Pei Lijin BipolarisBipolaris peregianensis, which is characterized in that the bacterial strain in
On July 11st, 2016, it is preserved in Guangdong Province's Culture Collection, preserving number：GDMCC.NO:60057.
2. m5-2 Pei Lijin Bipolaris according to claim 1Bipolaris peregianensis, which is characterized in that
The bacterial strain rDNA-ITS sequences such as SEQ ID NO：Shown in 1.
3. m5-2 Pei Lijin Bipolaris according to claim 1Bipolaris peregianensis, which is characterized in that
The bacterial strain is that the colony diameter that is formed is 70 mm after cultivating 5d in PDA culture medium, black, felted, and bacterium colony back side ash is brown
Color；The mycelia yellowish-brown of the bacterial strain has branch, more diaphragms, conidiophore Dan Sheng, minority collection life, cylindrical shape or shape of going down on one's knees,
Brown, it is 4 ~ 9 μm wide up to 94.5 ~ 147 μm；Conidium is bent, spindle, wide ellipse, crineous, has 6 ~ 10 vacations
Diaphragm, 58.5 ~ 84.5 × 13.5 ~ 18.5 μm of size.
4. Pei Lijin Bipolaris m5-2 Pei Lijin Bipolaris described in claim 1Bipolaris peregianensis
Application in cutting weeds.
5. applying according to claim 4, which is characterized in that the weeds are grassy weed.
6. applying according to claim 5, which is characterized in that the grassy weed is Bermuda grass, eleusine indica, lady's-grass or hard
Bone grass.
7. a kind of herbicide, which is characterized in that the herbicide includes any m5-2 Pei Lijinping navels of claim 1 ~ 3
Compacted sporeBipolaris peregianensisRaw toxin, active somatic cell mycelia and conidial mixture.
8. herbicide according to claim 7, which is characterized in that the dosage form of the weeding is liquor, emulsion, suspension
Agent, pulvis, granule, wettable powder or water dispersible granules.
9. herbicide according to claim 8, which is characterized in that when the herbicide is pulvis, granule, wettable powder
Or when water dispersible granules, conidial quantity is 1 × 10 in the herbicide formulations5~1×108A spore/gram.
10. herbicide according to claim 8, which is characterized in that when the herbicide is liquor, emulsion or suspending agent,
Conidial content is 1 × 10 in the flushing liquor of the herbicidal formulations4~1×106 A spore/mL.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810663498.8A CN108624514B (en) | 2018-06-25 | 2018-06-25 | M5-2 helminthosporium Bipolaris peregianensis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810663498.8A CN108624514B (en) | 2018-06-25 | 2018-06-25 | M5-2 helminthosporium Bipolaris peregianensis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108624514A true CN108624514A (en) | 2018-10-09 |
| CN108624514B CN108624514B (en) | 2020-06-05 |
Family
ID=63688298
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810663498.8A Active CN108624514B (en) | 2018-06-25 | 2018-06-25 | M5-2 helminthosporium Bipolaris peregianensis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108624514B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021208989A1 (en) * | 2020-04-17 | 2021-10-21 | 南京农业大学 | Bipolaris yamadae (y.nisik.) shoemaker, and screening and identification method therefor and use thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1994092A (en) * | 2006-12-26 | 2007-07-11 | 浙江省农业科学院 | A biological weed killer and preparation process thereof |
| CN101586083A (en) * | 2009-06-09 | 2009-11-25 | 中国农业科学院农业资源与农业区划研究所 | Setaria bipolaris strain and use for preventing and killing off weed |
| CN101712933A (en) * | 2010-01-18 | 2010-05-26 | 中国农业科学院农业资源与农业区划研究所 | Curvularia bacterial strain and application thereof in preventing and weeding weeds |
| CN101735956A (en) * | 2010-01-05 | 2010-06-16 | 中国农业科学院农业资源与农业区划研究所 | Fungal metabolite and application of fungal metabolite serving as herbicide |
| CN107418900A (en) * | 2017-05-25 | 2017-12-01 | 南京农业大学 | A kind of millet Bipolaris bacteria strain, its screening technique and application thereof |
-
2018
- 2018-06-25 CN CN201810663498.8A patent/CN108624514B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1994092A (en) * | 2006-12-26 | 2007-07-11 | 浙江省农业科学院 | A biological weed killer and preparation process thereof |
| CN101586083A (en) * | 2009-06-09 | 2009-11-25 | 中国农业科学院农业资源与农业区划研究所 | Setaria bipolaris strain and use for preventing and killing off weed |
| CN101735956A (en) * | 2010-01-05 | 2010-06-16 | 中国农业科学院农业资源与农业区划研究所 | Fungal metabolite and application of fungal metabolite serving as herbicide |
| CN101712933A (en) * | 2010-01-18 | 2010-05-26 | 中国农业科学院农业资源与农业区划研究所 | Curvularia bacterial strain and application thereof in preventing and weeding weeds |
| CN107418900A (en) * | 2017-05-25 | 2017-12-01 | 南京农业大学 | A kind of millet Bipolaris bacteria strain, its screening technique and application thereof |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021208989A1 (en) * | 2020-04-17 | 2021-10-21 | 南京农业大学 | Bipolaris yamadae (y.nisik.) shoemaker, and screening and identification method therefor and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108624514B (en) | 2020-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101822272B (en) | Streptomyces griseoflavus and application thereof in biological prevention and control of plant diseases | |
| CN101851597B (en) | Streptomyces griseoflavus for resisting alfalfa diseases and screening method thereof | |
| CN103224904B (en) | Rhodopseudomonas strain, biocontrol microbial inoculum and biocontrol fermentation liquid, and corresponding preparation methods and application thereof in controlling phytophthora blight of pepper | |
| CN110292051B (en) | Fruit and vegetable disease inhibitor and application thereof | |
| CN108034601A (en) | One bacillus amyloliquefaciens and its application | |
| CN109207412A (en) | A kind of resistance to bacterial wilt biocontrol bacterial strain and its application | |
| CN112359084A (en) | Preparation and prevention and treatment application of mycoprotein in bacillus subtilis fermentation product | |
| CN102154193B (en) | Method for inducing Phytophthora capsici to produce large amount of sporangia | |
| CN101586083B (en) | Setaria bipolaris strain and use for preventing and killing off weed | |
| CN106119134A (en) | Talaromyces flavus Y28 and the application in preventing and treating fruit tree putrefaction disease thereof | |
| CN111778174B (en) | Bacillus subtilis with inhibiting effect on citrus sand skin disease and screening method thereof | |
| CN101712933B (en) | Curvularia bacterial strain and application thereof in preventing and weeding weeds | |
| CN109735456A (en) | The prominent Exserohilum bacterium of one plant of mouth and its application in prevention and treatment paddy land weed semen euphorbiae | |
| CN108624514A (en) | One plant of m5-2 Pei Lijin Bipolaris Bipolaris peregianensis and its application | |
| CN109735457A (en) | One plant of mutagenesis Infected barnyardgrass and its application in prevention and treatment barnyard grass | |
| CN105316258A (en) | Strain 1LN2 for preventing and treating rice sheath blight disease and application of strain 1LN2 | |
| CN109077068A (en) | A kind of application of fungi rod method in prevention and control exotic invasive weed Yellow calla | |
| CN102382776B (en) | Small spore phoma microspora for controlling conyza sumatrensis | |
| CN108102992A (en) | One plant of aurantia Exiguobacterium sp and its application in tomato root-knot eelworm is prevented | |
| CN101555456A (en) | Fusarium philoceroides | |
| RU2307158C2 (en) | Bacillus subtilus M1 STRAIN WITH FUNGICIDAL AND FUNGISTATIC ACTIVITY TO CULTURED PLANT DISEASE EXCITANTS | |
| CN110260976B (en) | Method for obtaining applied dose of microorganism AM and DSE fungus combined microbial inoculum by thermal infrared monitoring | |
| CN110205258B (en) | Streptomyces bacterial strain PBS9 for preventing and treating potato scab and application thereof | |
| CN111440745A (en) | Microbial flora for preventing and treating wheat scab and separation method thereof | |
| CN101919412A (en) | Colletotrichum Corda strain and biological herbicide containing spores thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |