CN108624514B - M5-2 helminthosporium Bipolaris peregianensis and application thereof - Google Patents
M5-2 helminthosporium Bipolaris peregianensis and application thereof Download PDFInfo
- Publication number
- CN108624514B CN108624514B CN201810663498.8A CN201810663498A CN108624514B CN 108624514 B CN108624514 B CN 108624514B CN 201810663498 A CN201810663498 A CN 201810663498A CN 108624514 B CN108624514 B CN 108624514B
- Authority
- CN
- China
- Prior art keywords
- herbicide
- helminthosporium
- bipolaris
- peregianensis
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Agronomy & Crop Science (AREA)
- Dentistry (AREA)
- Plant Pathology (AREA)
- Pest Control & Pesticides (AREA)
- Environmental Sciences (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention relates to a strain of m5-2 perijinpingyangmuimBipolaris peregianensisAnd applications thereof. The strain is preserved in Guangdong province microorganism culture collection center in 2016, 7 and 11 days, and the preservation number is as follows: 60057 in GDMCC No. The m5-2 eukinsonia umbilicifolia obtained from Bermuda grass strains provided by the inventionBipolaris peregianensisThe herbicide can effectively prevent and remove gramineous weeds, is environment-friendly, can inhibit the development of drug resistance and drug resistance of weeds, is beneficial to the popularization of green food and organic agriculture, and has the advantages of low cost, no pollution and safety to crops.
Description
Technical Field
The invention belongs to the field of biological control, and particularly relates to a strain of m5-2 perijinpingyangmelinBipolaris peregianensisAnd applications thereof.
Background
Chemical herbicides are rapidly developed in China due to the characteristics of rapid action, simple and convenient use and the like, however, the sustainable development of agriculture ecology is seriously influenced by the problems of huge environmental pollution and pesticide residue along with the wide use of chemical agents. Therefore, the development and utilization of biopesticides play an important role in environmental protection agriculture and comprehensive weed control (IPM). Microbial herbicides are herbicides developed by taking a microbial living body and metabolites thereof as raw materials, and are an important research direction in the field of herbicides due to small harm to the environment. Recent studies have found that the living plant pathogenic fungi and secondary metabolites secreted by the living plant pathogenic fungi have herbicidal activity. The microbial herbicide developed by utilizing the living bodies of the pathogenic fungi of the weeds and the secondary metabolites thereof generally has the characteristics of diverse action sites and action modes, the weeds are not easy to generate drug resistance, the development cost is low, and the microbial herbicide is harmless to the environment and shows good development and application prospects.
Bermuda grass (root of Cynodon dactylon)Cynodon dactylon(Linn.) Pers.) also known as bermuda grass, which is widely distributed in various parts of the world. The perennial herbaceous plants are good dike-fixing and soil-retaining plants and are commonly used for laying lawns or court; but when growing in orchards or farmlands, are difficult to kill. The bermuda grass has strong reproductive capacity, high growth speed, long growth period and strong adaptability, and can grow in various soil environments. The bermuda grass in the farmland often competes with crops for water and nutrients, seriously influences the growth and development of the crops and the quality yield, and even can form a dominant population density in the field in severe cases to cause serious yield reduction of the crops.
The method for controlling the Bermuda grass is mainly dependent on an artificial or chemical method at present, the artificial weeding is labor-consuming and time-consuming, and the chemical weeding causes environmental pollution and causes the generation of weed population resistance, so that the method for controlling the Bermuda grass besides the two methods is increasingly required. At present, the research and development of biological herbicides are increasingly paid attention, and the utilization of microorganisms to control weed harm is becoming an effective new way and has huge market prospect.
Disclosure of Invention
The invention aims to overcome the defects that the control of the cynodon dactylon weeds in the prior art is labor-consuming and time-consuming, easily causes environmental pollution and causes the generation of weed population resistance, and provides a strain of m5-2 eupatorium adenophorumBipolaris peregianensis. The invention provides m5-2 helminthosporium peruvianumBipolaris peregianensisCan effectively prevent and kill gramineous weeds.
Another object of the present invention is to provide the m5-2 helminthosporium peruvianumBipolaris peregianensisApplication in weeding.
It is another object of the present invention to provide a herbicide.
In order to achieve the purpose, the invention adopts the following technical scheme:
m5-2 perijinpingyangmoBipolaris peregianensisThe strain is preserved in Guangdong province microorganism culture collection center at 2016, 7 and 11 days, and the preservation number is as follows: 60057 in GDMCC No.
The novel strain m5-2 (of the invention)Bipolaris peregianensis) Has been preserved in Guangdong province culture Collection in 2016, 7 and 11 days, and has the following preservation numbers: 60057 in GDMCC No. The strain is identified as helminthosporium perkinsonii by morphology and molecular biology, and belongs to the genus Courospora (A)CochliobolusDrechsler [ asexual stage: helminthosporium applanatum (A)BipolarisShoemarker )]The family Geotrichum (Pleosporaceae Nitschke), the order Geotrichum (Pleosporales Luttrell Barr), the subclass Geotrichum (Pleosporamycetidae), the class Ascomycetes (Dothideoetes), the phylum Sacycota (Ascomycota), the kingdom Fungi (Fungi).
The strain is obtained and identified by the inventor through the following ways, gramineae diseases in a plurality of areas of China are investigated, after the diseases of the bermuda grass are found, disease symptoms are recorded in detail and photographed as harmful symptoms in the field, and diseased weed leaves and stems are collected and taken back to a laboratory for microscopic examination.
The separation and purification process of pathogenic bacteria is as follows:
the brown to dark purple spots with oval and spindle shapes appear on the affected leaves of the bermuda grass, and the leaf sheath, stem and root are also infected along with the enlarged spots. Under the humid condition, black mildew-like substances are generated on the surfaces of the leaves, namely conidiophores, and when the disease is serious, most plants wither and die, and black brown subtiles are formed. Selecting typical diseased weed leaves with disease spots, washing, cutting small pieces of tissue with the size of 3 mm multiplied by 3 mm from the diseased joint of diseased parts, placing the cut samples in a sodium hypochlorite solution with the concentration of 2.5% for disinfection for 1min, then changing and washing with sterile water for 3 times, transferring the samples into a potato glucose agar (PDA, adding gentamicin (1mL/L) to inhibit bacterial growth) culture medium, and culturing at the constant temperature of 25 ℃. Purifying the pathogenic bacteria, storing on PDA slant culture medium, and storing in refrigerator at 4 deg.C.
Preferably, the rDNA-ITS sequence of said strain is as set forth in SEQ ID NO: 1 is shown.
Preferably, the bacterial strain is a colony formed after being cultured on a PDA culture medium for 5 days, the diameter of the colony is 70mm, the colony is black and felt-shaped, and the back of the colony is dark brown; the hypha of the strain is yellow brown, and has branches, multiple diaphragms, conidiophores and single growth, a few of the hypha are gathered to grow, are cylindrical or knee-bent, are brown, and have the length of 94.5-147 mu m and the width of 4-9 mu m; conidiophore is bent, spindle-shaped, wide oval, dark brown, has 6-10 false septa and has a size of 58.5-84.5 multiplied by 13.5-18.5 mu m.
The morphological identification of the pathogenic bacteria is as follows:
and (3) performing single-spore purification and culture on the fungi obtained by separation, inoculating the strain on a PDA (Potato dextrose agar) culture medium, and observing and recording the morphology of each colony after culturing at the constant temperature of 25 ℃ for 5 days. Continuously observing the generation condition of conidia of pathogenic bacteria colonies, observing the morphology and sporulation structural characteristics of the conidia under an optical microscope, measuring the sizes of 50 pathogenic bacteria spores and spore stalks, and the like, and consulting related monographs for identification. After 5 days of growth on PDA medium at 25 deg.C, the cultured colony diameter reaches 70mm, black, felt-like, and the colony back is dark brown. The bacterial colony is not easy to produce spores on a PDA culture medium, the hypha is yellow brown, has branches and multiple septa, the conidiophores are single, a few are gathered, cylindrical or knee-bent, brown, the length is 94.5-147 mu m, and the width is 4-9 mu m. Conidiophore is curved, spindle-shaped, wide oval, dark brown, has 6-10 false septa, 9 in most, and has size of 58.5-84.5 × 13.5-18.5 μm. Observed by morphology and culture traits, and examined in literature [ manamgada, d.s., Rossman, a.y., Castlebury, l.a., Crous, p.w., Madrid, h., chukautirote, e.,&Hyde, K. D. (2014). Thegenusbipolaris. Studies in mycology,79, 221-288.]. Preliminarily determines that the pathogenic bacteria is helminthosporium umbilicifolius (A)Bipolaris peregianensis)。
The molecular biological identification of the pathogenic bacteria is as follows:
the test strains were transferred to a fresh PDA medium and cultured for 10 days, and the mycelia were scraped off with a sterilized inoculating needle, and the genome of the pathogenic bacterium was extracted with reference to the DNA secure novel plant genome DNA extraction kit (Takara, Dalian). Designed rDNA-ITS region universal primers ITS-1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS-4 (5'-TCCTCCGCTTATTGATATGC-3') (synthesized by Shanghai Biotechnology Limited) by White, etc., and PCR amplification is carried out by taking pathogenic bacteria genome separated from Bermuda grass as a template,the expected product is about 580 bp. PCR amplification System: 2 XTaq PCR MasterMix 25. mu.L (Takara, Large Scale ligation), 20. mu. mol/L primers 1. mu.L each, template DNA 1. mu.L, sterile double distilled water to 50. mu.L. And (3) PCR reaction conditions: preheating at 94 deg.C for 4 min; 32 cycles of 94 ℃ for 40s, 62 ℃ for 45s and 72 ℃ for 1 min; extension at 72 ℃ for 10 min. All PCR products are respectively added into 0.1 percent agarose gel for electrophoresis, after being stained by ethidium bromide, the gel imager detects the products, and DNA sequencing is carried out on the PCR products by Shanghai Biochemical company Limited (Sheng, Shanghai). And comparing the ITS sequence of the pathogenic bacteria obtained by separation with a Gen-Bank nucleic acid database, and identifying the pathogenic bacteria according to morphological characteristics, culture characteristics and pathogenicity of the pathogenic bacteria by combining sequence analysis. And performing phylogenetic analysis and evolutionary tree construction by using MEGA5.0, and constructing the evolutionary tree by using a Neighbor-join method, wherein the self-development times are 1000. After the r DNA-ITS sequence of the pathogenic bacterium strain m5-2 is amplified, PCR products are purified and sequenced, and r DNA-ITS sequence fragments of about 580 bp are obtained respectively by sequencing and are consistent with the expected fragment size. The sequences of the tested strains were subjected to homology alignment using BLAST software in the NCBI website: the homology of the pathogenic bacteria of the strain and the helminthosporium perkinsonii reaches 99 percent. The pathogenic bacteria of the cynodon dactylon are proved to beB. peregianensis. From the phylogenetic tree constructed, Heliping navel helminthosporium isolated from Bermuda grass and NCBI database are availableB. peregianensisHelminthosporium verrucosum grouped in the same classification unit (Bipolaris) Cannot be gathered in one branch, thus proving that the strain of the invention is helminthosporium perkini.
The invention also claims the m5-2 helminthosporium peruvianumBipolaris peregianensisApplication in weeding.
Preferably, the weeds are grassy weeds.
More preferably, the grass weeds are bermudagrass, goosegrass herb, crab grass or stiff balsam stem.
The m5-2 Eulygodium bipolarisBipolaris peregianensisCan be applied to farmlands and gardens in non-gramineous planting areas, preferably dicotyledonous plants, orchards and garden environments for preventing and removing gramineous plantsAnd (4) weeds.
The herbicide comprises the strain m5-2 helminthosporium peruvianumBipolaris peregianensisThe mixture of crude toxin, living cell hyphae and conidia.
The crude toxin referred by the invention is a secondary metabolite of the strain.
The herbicide provided by the invention is environment-friendly, can inhibit the development of drug resistance and drug resistance of weeds, is beneficial to the popularization of green food and organic agriculture, and has the advantages of low cost, no pollution and safety to crops.
The mixture of crude toxin, living cell hypha and conidium in the herbicide can be prepared by the following method: taking the strain m5-2 Peijing creeping spelterBipolaris peregianensisAnd (3) beating 5 pieces of the bacterial cake at the edge of the colony of the pathogenic bacteria cultured for 5 days, inoculating the bacterial cake into a potato powder agar liquid culture medium, culturing for 10 days in a shaking table at 25 ℃, and then filtering to obtain a crude toxin extracting solution of the strain and a mixture of living cell hypha and conidia.
The herbicide can be processed into various formulations, such as liquid, emulsion, suspending agent, powder, granules, wettable powder, water dispersible granules and the like, and is preferably processed into formulations suitable for spraying application. The carrier used in the above dosage forms is an agriculturally pharmaceutically acceptable carrier, preferably a carrier which is commonly used in the agricultural chemical art and is biologically inert, and may be in solid or liquid form. Examples of the solid carrier include minerals such as clay, talc, kaolin, montmorillonite, white carbon, zeolite, silica and diatomaceous earth; plant materials, such as corn flour, bean flour or starch; high molecular compounds such as polyvinyl alcohol and polyglycol. Examples of liquid carriers include various organic solvents such as decane and dodecane, vegetable oil, mineral oil and water.
If necessary, cosurfactants such as surfactants, binders, stabilizers and the like, such as tween 20, tween 80 and the like, can be used as the herbicide of the invention, and antioxidants, PH regulators and the like can be used as the stabilizers. The number of conidia in the herbicide provided by the present invention varies depending on the form of the formulation and the method of application.
Preferably, when the herbicide is a dust, granule, wettable powder or water dispersible granule (i.e., solid formulation), the number of spores that grow in the herbicide is 1 × 105~1×108Spores per gram.
More preferably, the number of spores in the herbicide is 1X 106~1×107Spores per gram.
Preferably, when the herbicide is a liquid, emulsion or suspension, the content of spores in the spray of the herbicide is 1X 104~1×106spores/mL.
More preferably, the content of spores in the spray of the herbicide is 1 × 105~1×106spores/mL.
The herbicide of the present invention may be used together with other chemical herbicide to reduce the consumption of chemical herbicide and reduce environmental pollution.
Compared with the prior art, the invention has the following beneficial effects:
the m5-2 eukinsonia umbilicifolia obtained from Bermuda grass strains provided by the inventionBipolaris peregianensisThe herbicide can effectively prevent and remove gramineous weeds, is environment-friendly, can inhibit the development of drug resistance and drug resistance of weeds, is beneficial to the popularization of green food and organic agriculture, and has the advantages of low cost, no pollution and safety to crops.
Drawings
FIG. 1 shows m5-2 helminthosporium umbilicifoliiBipolaris peregianensisConidiophore picture.
Detailed Description
The invention is further illustrated by the following examples. These examples are intended to illustrate the invention and are not intended to limit the scope of the invention. Experimental procedures without specific conditions noted in the examples below, generally according to conditions conventional in the art or as suggested by the manufacturer; the raw materials, reagents and the like used are, unless otherwise specified, those commercially available from the conventional markets and the like. Any insubstantial changes and substitutions made by those skilled in the art based on the present invention are intended to be covered by the claims.
Example 1 isolation and purification of pathogenic bacteria, characterization
(1) Isolation and purification of pathogenic bacteria
The brown to dark purple spots with oval and spindle shapes appear on the affected leaves of the bermuda grass, and the leaf sheath, stem and root are also infected along with the enlarged spots. Under the humid condition, black mildew-like substances are generated on the surfaces of the leaves, namely conidiophores, and when the disease is serious, most plants wither and die, and black brown subtiles are formed. Selecting typical diseased weed leaves with disease spots, washing, cutting small pieces of tissue with the size of 3 mm multiplied by 3 mm from the diseased joint of diseased parts, placing the cut samples in a sodium hypochlorite solution with the concentration of 2.5% for disinfection for 1min, then changing and washing with sterile water for 3 times, transferring the samples into a potato glucose agar (PDA, adding gentamicin (1ml/L) to inhibit bacterial growth) culture medium, and culturing at constant temperature of 25 ℃. Purifying the pathogenic bacteria, storing on PDA slant culture medium, and storing in refrigerator at 4 deg.C.
(2) Morphological characterization of pathogenic bacteria
And (3) performing single-spore purification and culture on the fungi obtained by separation, inoculating the strain on a PDA (Potato dextrose agar) culture medium, and observing and recording the morphology of each colony after culturing at the constant temperature of 25 ℃ for 5 days. Continuously observing the generation condition of conidia of pathogenic bacteria colonies, observing the morphology and sporulation structural characteristics of the conidia under an optical microscope, measuring the sizes of 50 pathogenic bacteria spores and spore stalks, and the like, and consulting related monographs for identification. After 5 days of growth on PDA medium at 25 deg.C, the cultured colony diameter reaches 70mm, black, felt-like, and the colony back is dark brown. The bacterial colony is not easy to produce spores on a PDA culture medium, the hypha is yellow brown, has branches and multiple septa, the conidiophores are single, a few are gathered, cylindrical or knee-bent, brown, the length is 94.5-147 mu m, and the width is 4-9 mu m. Conidiophores (as shown in figure 1) are curved, spindle-shaped, wide oval, dark brown, and have 6-10 false septa, 9 in most, and 58.5-84.5 × 13.5-18.5 μm in size. Observed by morphology and culture traits, and examined the literature [ Manamgada, D.S., Rossman, A.Y., Castlebury, L.A., Crous, P.W., Madrid, H., Chukeatirote, E.,&Hyde, K. D.(2014). The genusbipolaris. Studies in mycology,79, 221-288.]. Preliminarily determines that the pathogenic bacteria is helminthosporium umbilicifolius (A)Bipolaris peregianensis)。
(3) Molecular biological identification of pathogenic bacteria
The test strains were transferred to a fresh PDA medium and cultured for 10 days, and the mycelia were scraped off with a sterilized inoculating needle, and the genome of the pathogenic bacterium was extracted with reference to the DNA secure novel plant genome DNA extraction kit (Takara, Dalian). PCR amplification was carried out using White et al designed r DNA-ITS region universal primers ITS-1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS-4 (5'-TCCTCCGCTTATTGATATGC-3') (synthesized by Shanghai Biotechnology Ltd.) using the genome isolated from Bermuda grass pathogenic bacteria as a template, and the expected product was about 580 bp. PCR amplification System: 2 XTaq PCR MasterMix 25. mu.L (Takara, Large Scale ligation), 20. mu. mol/L primers 1. mu.L each, template DNA 1. mu.L, sterile double distilled water to 50. mu.L. And (3) PCR reaction conditions: preheating at 94 deg.C for 4 min; 32 cycles of 94 ℃ for 40s, 62 ℃ for 45s and 72 ℃ for 1 min; extension at 72 ℃ for 10 min. All PCR products are respectively added into 0.1 percent agarose gel for electrophoresis, after being stained by ethidium bromide, the gel imager detects the products, and DNA sequencing is carried out on the PCR products by Shanghai Biochemical company Limited (Sheng, Shanghai). And comparing the ITS sequence of the pathogenic bacteria obtained by separation with a Gen-Bank nucleic acid database, and identifying the pathogenic bacteria according to morphological characteristics, culture characteristics and pathogenicity of the pathogenic bacteria by combining sequence analysis. And performing phylogenetic analysis and evolutionary tree construction by using MEGA5.0, and constructing the evolutionary tree by using a Neighbor-join method, wherein the self-development times are 1000. Amplifying rDNA-ITS sequence of pathogenic bacteria strain M5-2, purifying PCR product, sequencing, and sequencing to obtain r DNA-ITS sequence fragment of about 580 bp, which is in accordance with the expected fragment size. The sequences of the tested strains were subjected to homology alignment using BLAST software in the NCBI website: the homology of the pathogenic bacteria of the strain and the helminthosporium perkinsonii reaches 99 percent. The pathogenic bacteria of the cynodon dactylon are proved to beB. peregianensis. Pelamis isolated from Cynodon dactylon from the phylogenetic Tree thus constructedHelminthosporium umbiliciformis and NCBI databases are availableB. peregianensisHelminthosporium verrucosum grouped in the same classification unit (Bipolaris) Cannot be gathered in one branch, thus proving that the strain of the invention is helminthosporium perkini. .
Specifically, the rDNA-ITS sequence is as follows:
TCCGTAGGTGAACCTGCGGAGGGATCATTACACAACAAAATATGAAGGCCTGGCTTCGCGGCCGGCTGAAATATTTTTTTTCACCCGTGTCTTTTGCGCACTTGTTGTTTCCTGGGCGGGCTCGCCCGCCACCAGGACCAAACCATAAACCTTTTTCTTTTGCAGTTTTCATCAGCGTCAGTAAAAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGCGTTTTTTGTCTCTCCTTGCGGGAGACTCGCCTTAAAACGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACATTTTTTGCGCTTTGTATCAGGAGAAAAGGACGGTACTCCATCAAGACGTTTACATTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA。
example 2 m5-2 helminthosporium peruvianumBipolaris peregianensisBiological assay of
The pathogenicity of the m5-2 strain to common weeds and crop seedling stage is determined by an artificial inoculation method to know the host range.
Seeds of test plants (list shown in Table 1) were sown in plastic pots of 10 cm diameter, 9 pots were sown for each plant, and the plants were cultivated at 25 ℃ under an environment with 12-hour photoperiod alternation. And (4) inoculating when the test plants reach 2-4 true leaves, and reserving 5-10 plants in each pot according to the size of the test plants.
Two inoculation methods were used: (1) inoculating by adopting a spore suspension spraying method: after the strain m5-2 is cultured in PDA culture medium for 10 days, the spores are scraped by a sterile cover glass and prepared into a size of 1 × 106Spores/ml in water. The uniformly mixed spore suspension was uniformly sprayed onto the test plants using a micro-sprayer, and 3 pots were inoculated per plant. (2) Secondary metabolite spray inoculation: the strain m5-2 is prepared by beating 5 pieces of bacterial cake at the edge of the colony of the pathogenic bacteria cultured for 5 days, inoculating the 5 pieces of bacterial cake into a potato powder agar liquid culture medium, culturing for 10 days at 25 ℃ in a shaking table, and filtering to obtain the crude toxin of the strainAnd (3) uniformly spraying the uniformly mixed spore suspension onto the tested plants by using a micro sprayer, and inoculating 3 pots of each plant. Another 3 basins were sprayed with sterile water as a control. And placing the inoculated plants in a closed container, preserving moisture and culturing for 24h at the indoor temperature, then transferring the plants to an artificial climate box for culturing, wherein the illumination/darkness is alternated for 12h every day, the temperature is 28 ℃/25 ℃ (illumination/darkness) and the relative humidity is 90%. The onset of disease was described 1 week after inoculation according to the following criteria. Grading the disease condition standard: the 0 grade is no plant disease; level 1: 1% -10% of diseased leaves; and 2, stage: the diseased leaves are 10% -30%; and 3, level: the diseased leaves are 30% -50%; 4, level: 50% -70% of diseased leaves; and 5, stage: the diseased leaves are 70% -100%.
Determination of pathogenicity
The bacterial strain spores and the crude toxin are used for carrying out weeding activity detection on 9 weeds and 5 crops, and the bacterial strain conidia and the crude toxin are found to have certain lethal activity on tested weeds. Wherein the lethality of the fungus cake to gramineous weeds such as stiff-boned bugle, large crabgrass, cynodon dactylon, eleusine indica and the like reaches more than grade 4, and the lethality of the crude toxin to the weeds reaches grade 5. The pathogenicity to centella, creeping oxalis and alternanthera philoxeroides reaches grade 2-3, but the fatality to emilia songarica is weak, and the pathogenicity to bacterial cake and crude toxin is grade 1. Has weak pathogenicity on rice and corn, and curative strength of grade 1-2, but no pathogenicity on soybean, watermelon and radish. None of the control leaves had symptoms.
TABLE 1 pathogenicity of conidia and toxigenics of strain m5-2 on different plants
| Test plant | Conidia | Crude toxin | Control |
| Herb of Manyprickle bugle | 4 | 5 | 0 |
| Centella asiatica | 3 | 2 | 0 |
| All-grass of Hovenia dulcis | 3 | 3 | 0 |
| Tang style food | 4 | 5 | 0 |
| Dian hong (herba Duchesneae Indicae) | 1 | 1 | 0 |
| Bermuda grass | 5 | 5 | 0 |
| Hollow lotus seed | 2 | 3 | 0 |
| Herba Bidentis Bipinnatae | 2 | 1 | 0 |
| All-grass of Bull's tendon | 5 | 5 | 0 |
| Rice (Oryza sativa L.) with improved resistance to stress | 2 | 1 | 0 |
| Corn (corn) | 1 | 2 | 0 |
| Soybean | 0 | 0 | 0 |
| Watermelon | 0 | 0 | 0 |
| Radish (radish) | 0 | 0 | 00 |
Note: grading the disease condition standard: grading the disease condition standard: the 0 grade is no plant disease; level 1: 1% -10% of diseased leaves; and 2, stage: the diseased leaves are 10% -30%; and 3, level: the diseased leaves are 30% -50%; 4, level: 50% -70% of diseased leaves; and 5, stage: the diseased leaves are 70% -100%.
Sequence listing
<110> Ling south college of learning
<120> m5-2 helminthosporium Bipolaris peregianensis and application thereof
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>587
<212>DNA
<213> helminthosporium perguensis (Bipolaris peregianensis)
<400>1
tccgtaggtg aacctgcgga gggatcatta cacaacaaaa tatgaaggcc tggcttcgcg 60
gccggctgaa atattttttt tcacccgtgt cttttgcgca cttgttgttt cctgggcggg 120
ctcgcccgcc accaggacca aaccataaac ctttttcttt tgcagttttc atcagcgtca 180
gtaaaaaaca atgtaattat tacaactttc aacaacggat ctcttggttc tggcatcgat 240
gaagaacgca gcgaaatgcg atacgtagtg tgaattgcag aattcagtga atcatcgaat 300
ctttgaacgc acattgcgcc ctttggtatt ccaaagggca tgcctgttcg agcgtcattt 360
gtaccttcaa gctttgcttg gtgttgggcg ttttttgtct ctccttgcgg gagactcgcc 420
ttaaaacgat tggcagccgg cctactggtt tcggagcgca gcacattttt tgcgctttgt 480
atcaggagaa aaggacggta ctccatcaag acgtttacat ttttaacttt tgacctcgga 540
tcaggtaggg atacccgctg aacttaagca tatcaataag cggagga 587
Claims (9)
1. M5-2 helminthosporium Bipolaris peregianensis, characterized in that the strain is preserved in the Guangdong province collection of microorganisms and strains with the deposition number of 2016, 7, 11 days and 7 months: 60057 in GDMCC No.
2. The m5-2 helminthosporium Bipolaris pereginis of claim 1, wherein the sequence of the strain rDNA-ITS is as set forth in SEQ ID NO: 1 is shown.
3. The m5-2 helminthosporium Bipolaris peregianensis of claim 1, wherein the diameter of the colony formed after 5 days of culture on PDA medium is 70mm, the colony is black, felt-like, and the back of the colony is dark brown; the hypha of the strain is yellow brown, and has branches, multiple diaphragms, conidiophores and single growth, a few of the hypha are gathered to grow, are cylindrical or knee-bent, are brown, and have the length of 94.5-147 mu m and the width of 4-9 mu m; conidiophore is bent, spindle-shaped, wide oval, dark brown, has 6-10 false septa and has a size of 58.5-84.5 multiplied by 13.5-18.5 mu m.
4. Use of helminthosporium peruvii m5-2 helminthosporium pereganensis of claim 1 for weeding weeds, wherein the weeds are grassy weeds.
5. The use of claim 4, wherein the grass weeds are Bermuda grass, goosegrass herb, crab grass or garden balsam stem.
6. A herbicide comprising a mixture of crude toxin, viable cell hyphae and conidia of m5-2 helminthosporium Bipolaris peregianensis according to any one of claims 1 to 3.
7. The herbicide as claimed in claim 6, wherein the herbicidal preparation is in the form of liquid, emulsion, suspension, powder, granule, wettable powder or water dispersible granule.
8. The herbicide as claimed in claim 6, characterized in thatWhen the herbicide is powder, granules, wettable powder or water dispersible granules, the number of conidia in the herbicide preparation is 1 multiplied by 105～1×108Spores per gram.
9. The herbicide as claimed in claim 6, wherein when the herbicide is a liquid, an emulsion or a suspension, the content of spores in the spray of the herbicide is 1 x 104～1×106spores/mL.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810663498.8A CN108624514B (en) | 2018-06-25 | 2018-06-25 | M5-2 helminthosporium Bipolaris peregianensis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810663498.8A CN108624514B (en) | 2018-06-25 | 2018-06-25 | M5-2 helminthosporium Bipolaris peregianensis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108624514A CN108624514A (en) | 2018-10-09 |
| CN108624514B true CN108624514B (en) | 2020-06-05 |
Family
ID=63688298
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810663498.8A Active CN108624514B (en) | 2018-06-25 | 2018-06-25 | M5-2 helminthosporium Bipolaris peregianensis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108624514B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111518702B (en) * | 2020-04-17 | 2022-04-12 | 南京农业大学 | Helminthosporium umbilicalis strain, screening and identifying method and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1994092A (en) * | 2006-12-26 | 2007-07-11 | 浙江省农业科学院 | A biological weed killer and preparation process thereof |
| CN101586083A (en) * | 2009-06-09 | 2009-11-25 | 中国农业科学院农业资源与农业区划研究所 | Setaria bipolaris strain and use for preventing and killing off weed |
| CN101712933A (en) * | 2010-01-18 | 2010-05-26 | 中国农业科学院农业资源与农业区划研究所 | Curvularia bacterial strain and application thereof in preventing and weeding weeds |
| CN101735956A (en) * | 2010-01-05 | 2010-06-16 | 中国农业科学院农业资源与农业区划研究所 | Fungal metabolite and application of fungal metabolite serving as herbicide |
| CN107418900A (en) * | 2017-05-25 | 2017-12-01 | 南京农业大学 | A kind of millet Bipolaris bacteria strain, its screening technique and application thereof |
-
2018
- 2018-06-25 CN CN201810663498.8A patent/CN108624514B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1994092A (en) * | 2006-12-26 | 2007-07-11 | 浙江省农业科学院 | A biological weed killer and preparation process thereof |
| CN101586083A (en) * | 2009-06-09 | 2009-11-25 | 中国农业科学院农业资源与农业区划研究所 | Setaria bipolaris strain and use for preventing and killing off weed |
| CN101735956A (en) * | 2010-01-05 | 2010-06-16 | 中国农业科学院农业资源与农业区划研究所 | Fungal metabolite and application of fungal metabolite serving as herbicide |
| CN101712933A (en) * | 2010-01-18 | 2010-05-26 | 中国农业科学院农业资源与农业区划研究所 | Curvularia bacterial strain and application thereof in preventing and weeding weeds |
| CN107418900A (en) * | 2017-05-25 | 2017-12-01 | 南京农业大学 | A kind of millet Bipolaris bacteria strain, its screening technique and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108624514A (en) | 2018-10-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101822272B (en) | Streptomyces griseoflavus and application thereof in biological prevention and control of plant diseases | |
| CN101851597B (en) | Streptomyces griseoflavus for resisting alfalfa diseases and screening method thereof | |
| CN108034601B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN110292051B (en) | Fruit and vegetable disease inhibitor and application thereof | |
| CN111040976B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN115369062B (en) | Tomato bacterial wilt antagonistic bacterium WJB0802 and application thereof | |
| WO2021073142A1 (en) | Strain of fluorescent pseudomonas 22g5 and application thereof in preventative treatment of verticillium wilt in crops | |
| CN111925963A (en) | Application of Siamese bacillus B11 in prevention and/or treatment of cotton bamboo blast tip disease | |
| CN113061554A (en) | Bacillus belgii for preventing and treating banana wilt and application thereof | |
| CN110643551B (en) | Stenotrophomonas rhizophila S11 for preventing and treating rice blast and application thereof | |
| CN108624514B (en) | M5-2 helminthosporium Bipolaris peregianensis and application thereof | |
| CN117106639A (en) | Streptomyces nojirimensis strain and application of fermentation liquor thereof in preventing and controlling pepper anthracnose | |
| CN111778174A (en) | Bacillus subtilis with inhibiting effect on citrus sand skin disease and screening method thereof | |
| CN108102992B (en) | Microbacterium aurantiacus and application thereof in prevention and treatment of tomato root-knot nematodes | |
| CA2003461C (en) | Weed control compositions containing drechslera - spp. or metabolite thereof and weed control methods using drechslera spp. or metabolite thereof | |
| CN114032182B (en) | Fungus with functions of antagonizing pathogenic bacteria of garlic root rot and promoting growth | |
| CN112322561B (en) | Klebsiella and application thereof in prevention and treatment of pear fire blight of fruit trees | |
| AU2018267591A1 (en) | An Herbicidal Composition for Controlling Parthenium Weed and Strain Thereof | |
| CN116121105A (en) | Saline-alkali tolerant bacillus bailii YS-AT-DS1 with biocontrol and growth promoting functions and application thereof | |
| CN113652374B (en) | Application of 7-hydroxy tropolone in preventing and treating crop verticillium wilt | |
| CN110885769B (en) | Streptomyces, bacteriostatic drug and application thereof | |
| KR100403896B1 (en) | Antagonistic bacillus ehimensis against vegetables damping-off | |
| CN112646733B (en) | Tamarix chinensis endophytic antagonistic fungus as well as separation method and application thereof | |
| CN115433682B (en) | Barnyard grass biocontrol bacterium B-48 and application method thereof | |
| CN114672424B (en) | Tea tree endophyte and application thereof in plant disease control |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |