CN108517370B - Method for identifying semen allii tuberosi and semen allii fistulosi - Google Patents
Method for identifying semen allii tuberosi and semen allii fistulosi Download PDFInfo
- Publication number
- CN108517370B CN108517370B CN201810288633.5A CN201810288633A CN108517370B CN 108517370 B CN108517370 B CN 108517370B CN 201810288633 A CN201810288633 A CN 201810288633A CN 108517370 B CN108517370 B CN 108517370B
- Authority
- CN
- China
- Prior art keywords
- semen allii
- enzyme digestion
- sequence
- product
- allii tuberosi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for identifying semen allii tuberosi and semen allii fistulosi, belongs to the technical field of DNA identification, and solves the problem that whether semen allii fistulosi is adopted as a best product or is doped with semen allii fistulosi in the prior art. After DNA extraction, PCR amplification, enzyme digestion of a PCR product and agarose gel electrophoresis of a sample to be identified, the electrophoresis identification result of the semen allii tuberosi sample after enzyme digestion is that two band positions appear between 200-300 bp; the electrophoretic identification result of the scallion sample is that a band position appears at about 500bp, and the method has the advantages of accuracy, rapidness, low price, good reproducibility and the like.
Description
Technical Field
The invention belongs to the technical field of DNA identification, and particularly relates to a method for identifying semen allii tuberosi and semen allii fistulosi.
Background
Leek seeds come from Ming Yi Bie Lu, are dry mature seeds of Allium tuberosum Rottler of Liliaceae, can regulate deficiency of liver and kidney of human body, and have functions of nourishing liver and kidney, warming waist and knee, and invigorating kidney yang. The Allium fistulosum L is seed of Allium fistulosum L belonging to Allium of Liliaceae. Is a perennial herb, mainly used for tonifying kidney and improving eyesight, and is commonly used for kidney deficiency, impotence and dizziness. The two characters are similar, usually the characters are difficult to distinguish by naked eyes and are easy to be confused, and the two characters are confusing products of each other, although the functions are similar, the functions are not completely the same after all, and the two characters cannot be applied identically and must be distinguished; moreover, because the market price of the scallion seeds is far lower than that of the scallion seeds, the phenomenon that the scallion seeds are used as the scallion seeds frequently appears in the market recently, and therefore a method for distinguishing the scallion seeds from the scallion seeds is urgently needed.
The traditional identification mode of traditional Chinese medicinal materials is always based on character identification and guided by experience identification. However, the traditional Chinese medicine industry with rich experience is the phoenix-hair unicorn, and the fact that the rich traditional Chinese medicine identification experience cannot be widely inherited becomes the bottleneck of the development of the field of traditional Chinese medicine identification. In recent years, with the gradual and deep application of molecular biology technology in the field of traditional Chinese medicinal material identification, the identification according to the DNA of the medicinal materials provides a new technology and method for the traditional Chinese medicinal material identification industry, and the rapid identification of the components and the authenticity of the traditional Chinese medicinal materials is realized. Compared with the traditional identification method, the DNA sequence of each species is unique, the DNA fragment is used as the species for identification, the method is not influenced by characteristics and integrality such as individual shape, size and the like, can directly provide rich identification bases on the gene level, can realize accurate identification of material sources such as crude plants, decoction pieces, powder, cells, tissues and the like of the traditional Chinese medicine, and has objectivity and authority.
The DNA barcode technology is a technology for rapidly and accurately identifying species by analyzing a short DNA fragment of a standard target gene. The concept of DNA barcodes was first proposed in 2003 by the Canadian zoologist Paul Hebert to establish a new biological identification system in the intraspecies specificity and interspecies diversity using relatively short standard DNA fragments that are sufficiently variable and easily amplified to allow for rapid and accurate identification and characterization of species. The DNA bar code is not influenced by growth and development stages, test parts and environmental conditions, the species identification is carried out by directly utilizing the DNA sequence, the method has unique accuracy and repeatability, the used primers are few, the stability and the universality are high, the experimental process is standardized, the sharing can be realized through a database, and the DNA sequence can be converted into a two-dimensional bar code image to be applied to practice. According to the method, plant DNA is firstly extracted, then PCR amplification is carried out, the type of the plant can be judged only by sequencing and comparing amplification products, and the method is not suitable for rapid identification. The PCR-RFLP technology can obtain an identification result by extracting DNA of a sample to be identified, carrying out PCR amplification, carrying out enzyme digestion on a PCR product, carrying out agarose gel electrophoresis, and has the advantages of accuracy, rapidness, low price, good reproducibility and the like. Therefore, the PCR-RFLP technology has incomparable advantages for species genetic identification.
At present, the common method for distinguishing the semen allii tuberosi and the semen allii fistulosi is microscopic identification, and the microscopic characteristic is observed for distinguishing. The method for rapidly identifying the semen allii tuberosi and the scallion seeds is disclosed in protein electrophoresis analysis of the semen allii tuberosi and the scallion seeds in Wangzhintang and Wangwang, and the semen allii tuberosi and the scallion seeds can be identified by performing protein electrophoresis analysis on the semen allii tuberosi and the scallion seeds by using a cellulose acetate film electrophoresis technology, but the protein electrophoresis has high cost, high difficulty and long time and is not beneficial to wide popularization. The method for identifying the semen allii tuberosi and the semen allii fistulosi provided by the invention can make up the defects of the existing detection means, and the PCR-RFLP technology is mainly utilized to quickly obtain the identification result through DNA extraction, PCR amplification, enzyme digestion of a PCR product and agarose gel electrophoresis of a sample to be identified. PCR-RFLP has been used in some successful cases for identification of closely related species, but the identification is different for different species, and the primers, PCR amplification conditions, restriction enzyme species and identification method are different. At present, no report of molecular identification of the semen allii tuberosi by applying a PCR-RFLP technology exists.
If the DNA detection can be applied to the detection of traditional Chinese medicines, the accuracy rate is greatly increased, but the prior art can only be applied to the detection of a small part of traditional Chinese medicines, most of the traditional Chinese medicines are identified in a DNA detection mode and are far from the detailed way, particularly, true and false leek seeds are identified, and relevant literature introduction is not provided, and through various search, the searchable literature is that the sequence characteristics of leek seeds ITS2 provided in Chinese pharmacopoeia Chinese medicinal material DNA barcode standard sequence of old vaseline are combined with sequences in GenBank (leek seeds AJ2500293, AJ411914, GQ 412256-57; onion seeds FJ664288, JF990845, AY 427535-36, AJ411918, AM 418371-72 and GU 568), but through the information, the detection function cannot be realized, and the test is carried out through different specific cutting sites of restriction endonucleases, such as Sma I, Alu I and AlI; if Sma I is used as a restriction endonuclease, when the semen allii tuberosi and the semen allii fistulosi are tested, the electrophoretic identification result of the product after enzyme digestion is difficult to distinguish; through analysis and a large number of experiments, the following results are found: enzyme cutting sites Sma I exist in ITS sequences of only a part of allium fistulosum species, and cannot be used for distinguishing; when the test is carried out on the allium tuberosum seeds and the allium fistulosum by using Acc I and Alu I as restriction endonucleases, the Acc I and Alu I can cut the internal transcribed spacer sequence of the allium fistulosum and cannot cut the internal transcribed spacer sequence of the allium fistulosum, the allium fistulosum can be marked by the method, but the fact that the sample is the allium fistulosum is difficult to prove; therefore, a restriction enzyme site which can perform enzyme digestion on the characteristic sequence in the allium tuberosum gene fragment and has an enzyme digestion effect different from that of the allium fistulosum needs to be found; aiming at the semen allii tuberosi and the semen allii fistulosi in different main producing areas, a large number of experiments are carried out, and finally, an enzyme cutting site Rsa I is found, which can fully meet the requirements.
Disclosure of Invention
1. Problems to be solved
Aiming at the problem that the semen allii tuberosi and the scallion are difficult to identify and whether the semen allii tuberosi is doped in the semen allii tuberosi or not in the prior art, the invention provides a kit and a method for identifying the semen allii tuberosi and the scallion, which can quickly and effectively realize the authenticity identification of the semen allii tuberosi and have the advantages of low price, good reproducibility and the like.
2. Technical scheme
In order to solve the problems, the technical scheme adopted by the invention is as follows:
a method for identifying semen Allii Tuberosi and semen Allii Fistulosi comprises respectively performing enzyme digestion on internal transcription spacer sequence of ribosome DNA of a sample to be detected by using restriction enzyme Rsa I, wherein the length of the internal transcription spacer sequence before and after enzyme digestion is basically unchanged to that of semen Allii Fistulosi; the Chinese chive seed is obtained by cutting the internal transcription spacer sequence before and after enzyme digestion.
Preferably, the internal transcribed spacer sequence of the ribosomal DNA is the ITS2 sequence.
Preferably, the authentication method comprises the steps of:
(1) extracting DNA of a sample to be detected;
(2) carrying out amplification reaction on the extracted DNA to obtain an amplification product;
(3) carrying out enzyme digestion reaction on the amplification product by using restriction enzyme Rsa I to obtain an enzyme digestion product;
(4) detecting the sequence lengths of the amplification product and the enzyme digestion product, wherein if the enzyme digestion product and the amplification product have the same or basically the same detection result, the sample to be detected is scallion; if the sequence length of the enzyme digestion product is obviously shorter than that of the amplification product, the sample to be detected is semen allii tuberosi.
Preferably, the method for extracting the DNA of the test sample in step (1) specifically comprises:
a. pulverizing a sample to be detected into powder in a pulverizer, taking 20mg of the powder, adding 400 mu L of Buffer BP1 and 10 mu L of RNaseA with the density of 10mg/mL, carrying out vortex oscillation for 1-2 min, and standing at room temperature for 10min to allow the mixture to react fully;
b. adding 130 μ L Buffer BP2, mixing well, vortex oscillating for 30sec, centrifuging at 12,000rpm for 5min, and transferring the supernatant to a new centrifuge tube;
c. adding 1 volume of Buffer BP3 added with absolute ethyl alcohol, immediately and fully oscillating and uniformly mixing for 15 sec;
d. adding the solution and flocculent precipitate obtained in the last step into an adsorption column, centrifuging at 12,000rpm for 30 sec-1 min, and pouring off waste liquid.
e. The column was returned to the collection tube, centrifuged at 12,000rpm for 2min and the waste liquid was decanted. Adding 600 mu L of Buffer PW added with absolute ethyl alcohol into an adsorption column, centrifuging at 12,000rpm for 30 sec-1 min, pouring waste liquid, placing the adsorption column into a collecting pipe, and repeating the operation steps once;
f. placing the adsorption column in a collecting pipe for several minutes at room temperature to thoroughly dry the residual rinsing liquid in the adsorption material;
g. transferring the adsorption column into a clean centrifugal tube, suspending and dropwise adding 80 mu L of buffer TE to the middle part of the adsorption membrane, standing at room temperature for 5-8 min, centrifuging at 12,000rpm for 2min, and collecting the solution into the centrifugal tube.
Preferably, in the step (2), the corresponding reagents are sequentially added into a centrifuge tube with the volume of 0.2mL according to the sequence in the table 1, uniformly mixed and centrifuged for a short time; the amplification reaction was performed in a PCR instrument (BIO-RAD). The reaction conditions are as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 45s, and 40 cycles; finally, extension is carried out for 10min at 72 ℃.
TABLE 1PCR amplification reaction System
Preferably, the primer sequence of the amplification reaction in step (2) is:
the sequence of the upstream primer ATGCGATACTTGGTGTGAAT is shown,
the downstream primer sequence GACGCTTCTCCAGACTACAAT.
Preferably, in the step (3), the corresponding reagents are sequentially added into a 0.2mL centrifuge tube according to the sequence shown in table 2, mixed uniformly and centrifuged briefly. The conditions of the enzyme digestion reaction are as follows: the reaction was carried out in a water bath at 37 ℃ for 50min and stopped at 10 Xloading Buffer 2. mu.L.
TABLE 2RFLP reaction System
Preferably, in the step (4): the sequence length of the allium tuberosum amplification product is about 500bp, and the sequence length of the enzyme digestion product is between 200 and 300 bp; the sequence lengths of the scallion seed enzyme digestion product and the amplification product are both about 500 bp.
Preferably, in the step (4), agarose gel electrophoresis is adopted to detect the sequence lengths of the amplification product and the enzyme digestion product. The method comprises the following steps:
Weighing 2.0g of agarose in a triangular flask, adding 100mL of 1 XTAE buffer solution, heating in a microwave oven with low fire until the agarose is completely dissolved, cooling to 65 ℃, adding 10 mu L of nucleic acid dye GeneRed (Tiangen Biochemical), fully mixing, pouring into a gel tank, inserting a comb, and taking care that no bubbles exist. Standing and cooling for 30min at room temperature.
And carefully pulling out the comb, taking out the sample subjected to PCR amplification, adding 2 mu L of 10 × Loading Buffer into each 6 mu L of sample, uniformly mixing, adding the mixture into a sample well, and performing 140V constant-voltage electrophoresis for 50 min.
A kit for identifying semen Allii Tuberosi and semen Allii Fistulosi comprises DNA extraction reagent, PCR amplification upstream primer sequence ATGCGATACTTGGTGTGAAT, downstream primer sequence GACGCTTCTCCAGACTACAAT and restriction endonuclease Rsa I.
3. Advantageous effects
Compared with the prior art, the invention has the beneficial effects that:
(1) the method provided by the invention can quickly and effectively realize the authenticity identification of the semen allii tuberosi, and has the advantages of low price, good reproducibility and the like;
(2) the method provided by the invention can quickly and effectively realize the authenticity identification of the semen allii tuberosi, and different from the traditional microscopic identification method, the method can shorten the identification time of the semen allii tuberosi, increase the resolution of similar species and greatly increase the accuracy and authority of identification;
(3) According to the invention, scallion seeds and Chinese chive seeds are identified according to different changes of sequence lengths of internal transcribed spacers before and after enzyme digestion after DNA extraction, PCR amplification, enzyme digestion of PCR products and agarose gel electrophoresis of samples to be identified;
(4) the invention tests the semen allii tuberosi and the semen allii fistulosi in different producing areas, the selected ribonic acid amplification sequence is a characteristic sequence of an ITS2 area, and the adopted restriction enzyme Rsa I carries out enzyme digestion reaction on the amplification product, so that the influence caused by different areas and types can be eliminated, and the method has universality; in addition, the sequence length of the semen allii tuberosi amplification product is about 500bp, and the sequence length of the enzyme digestion product is 200-300 bp; the sequence lengths of the scallion seed enzyme digestion product and the amplification product are about 500bp, and the comparison result is easy to observe, free from interference and not easy to make mistakes;
(5) the method provided by the invention realizes the control of the quality of the semen allii tuberosi, can ensure the stable and controllable quality of subsequent products, and prevents pseudo-mixture doped with the semen allii fistulosi from entering the production link.
Drawings
FIG. 1 is a comparison graph of the results of the restriction enzyme Alu I of the present invention for the respective restriction enzyme digestion of Allium tuberosum and Allium fistulosum;
FIG. 2 is a comparison graph of the results of the restriction enzyme Acc I of the present invention for the respective enzyme digestion of semen Allii Tuberosi and semen Allii Fistulosi;
FIG. 3 is a comparison graph of the results of the restriction enzyme Sma I of the present invention for the respective restriction of leek seeds and scallion seeds;
FIG. 4 is a comparison of DNA identification results before and after digestion of semen Allii Tuberosi and semen Allii Fistulosi in the same region;
FIG. 5 is a comparison of DNA identification results before and after digestion of semen Allii Tuberosi and semen Allii Fistulosi in different regions;
FIG. 6 is a comparison of DNA identification results before and after enzyme digestion of the chive seed and the scallion seed;
FIG. 7 is a comparison of DNA identification results before and after digestion of semen Allii Tuberosi, semen Allii Fistulosi and Bulbus Allii Cepae;
FIG. 8 is a graph comparing the results of the identification of the seeds of Allium tuberosum, Allium fistulosum and blends of Allium tuberosum and Allium fistulosum of the present invention.
Detailed Description
The invention is further described with reference to specific examples.
Because the characters of the scallion and the leek seeds are extremely similar, the scallion and the leek seeds are difficult to distinguish by naked eyes and easy to confuse, the functions of the scallion and the leek seeds are similar, but the scallion and the leek seeds are not completely the same after all and cannot be applied equally, and the scallion and the leek seeds are required to be distinguished; to date, there is no effective, inexpensive, rapid, and objective means of detection. The kit and the method for identifying the semen allii tuberosi and the semen allii fistulosi provided by the invention can make up for the defects of the current detection means.
Because the ribosomal DNA fragments of Allium fistulosum and Allium tuberosum are related to the origin, growth environment and species, we have conducted a number of experiments to this end, and have found that the following are tested by different restriction enzyme-specific cleavage sites: such as Sma I, Acc I and Alu I; when leek seeds and scallion seeds were tested using Sma I as a restriction enzyme, as shown in FIG. 3: the electrophoresis identification result of the product after enzyme digestion is sometimes difficult to distinguish; through analysis, the following results are found: enzyme cutting sites Sma I exist in ITS sequences of only a part of allium fistulosum, and cannot be used for distinguishing the enzyme cutting sites Sma I; when the test is carried out on the semen allii tuberosi and the semen allii fistulosi by using Acc I and Alu I as restriction enzymes, as shown in figures 1-2: acc I and Alu I can cut the internal transcribed spacer sequence of the allium fistulosum, and cannot cut the internal transcribed spacer sequence of the allium tuberosum, and the method can mark the allium fistulosum, but the sample is difficult to prove to be allium tuberosum; therefore, a restriction enzyme site which can perform restriction enzyme on the characteristic sequence in the allium tuberosum gene fragment and has a restriction enzyme effect different from that of the allium fistulosum needs to be found; aiming at the semen allii tuberosi and the semen allii fistulosi of different main producing areas and types, a large number of experiments are carried out, and finally, a restriction enzyme site Rsa I is found, which can fully meet the requirements; wherein, the producing area of the Chinese chive seeds in the test is as follows: gansu, Shanxi, Hebei and Jilin, the production area of scallion is: shanxi and Xinjiang.
Example 1
A kit for identifying semen Allii Tuberosi and semen Allii Fistulosi comprises DNA extraction reagent, PCR amplification upstream primer sequence ATGCGATACTTGGTGTGAAT, downstream primer sequence GACGCTTCTCCAGACTACAAT and restriction endonuclease Rsa I.
The method for identifying the semen allii tuberosi and the semen allii fistulosi adopts restriction enzyme Rsa I to respectively perform enzyme digestion on the internal transcribed spacer sequence of the ribosome DNA of a sample to be detected, and the semen allii fistulosi is obtained after the internal transcribed spacer sequence length is basically kept unchanged before and after the enzyme digestion; the Chinese chive seed is obtained by cutting the internal transcription spacer sequence before and after enzyme digestion.
The internal transcribed spacer sequence of the ribosomal DNA is the ITS2 sequence.
The identification method comprises the following steps:
(1) extracting DNA of a sample to be detected;
(2) carrying out amplification reaction on the extracted DNA to obtain an amplification product;
(3) carrying out enzyme digestion reaction on the amplification product by using restriction enzyme Rsa I to obtain an enzyme digestion product;
(4) detecting the sequence lengths of the amplification product and the enzyme digestion product, wherein if the detection results of the enzyme digestion product and the amplification product are the same or basically the same, the sample to be detected is scallion; if the sequence length of the enzyme digestion product is obviously shorter than that of the amplification product, the sample to be detected is semen allii tuberosi.
The method for extracting the DNA of the detection sample in the step (1) specifically comprises the following steps:
a. Pulverizing a sample to be detected into powder in a pulverizer, taking 20mg of the powder, adding 400 mu L of Buffer BP1 and 10 mu L of RNaseA with the density of 10mg/mL, carrying out vortex oscillation for 1-2 min, and standing at room temperature for 10min to allow the mixture to react fully;
b. adding 130 mu LBuffer BP2, mixing well, vortex shaking for 30sec, centrifuging at 12,000rpm for 5min, and transferring the supernatant to a new centrifuge tube;
c. adding 1 volume of Buffer BP3 added with absolute ethyl alcohol, immediately and fully shaking and mixing for 15 sec;
d. adding the solution and the flocculent precipitate obtained in the last step into an adsorption column, centrifuging at 12,000rpm for 30 sec-1 min, and pouring off the waste liquid.
e. The adsorption column was returned to the collection tube, centrifuged at 12,000rpm for 2min, and the waste liquid was decanted. Adding 600 mu L of Buffer PW added with absolute ethyl alcohol into the adsorption column, centrifuging at 12,000rpm for 30 sec-1 min, pouring waste liquid, placing the adsorption column into a collecting pipe, and repeating the operation steps once;
f. placing the adsorption column in a collecting pipe for several minutes at room temperature to thoroughly dry the residual rinsing liquid in the adsorption material;
g. transferring the adsorption column into a clean centrifuge tube, suspending and dropwise adding 80 mu LBuffer TE to the middle part of the adsorption membrane, standing at room temperature for 5-8 min, centrifuging at 12,000rpm for 2min, and collecting the solution into the centrifuge tube.
In the step (2), corresponding reagents are sequentially added into a centrifuge tube of 0.2mL according to the sequence in the table 1, uniformly mixed and centrifuged for a short time; the amplification reaction was performed in a PCR apparatus (BIO-RAD). The reaction conditions are as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 45s, and 40 cycles; finally, extension is carried out for 10min at 72 ℃.
TABLE 1PCR amplification reaction System
The primer sequence of the amplification reaction in the step (2) is as follows: an upstream primer sequence ATGCGATACTTGGTGTGAAT, a downstream primer sequence GACGCTTCTCCAGACTACAAT.
In the step (3), corresponding reagents are sequentially added into a centrifuge tube of 0.2mL according to the sequence shown in the table 2, uniformly mixed and centrifuged for a short time. The conditions of the enzyme digestion reaction are as follows: the reaction was carried out in a water bath at 37 ℃ for 50min and stopped at 10 Xloading Buffer 2. mu.L.
TABLE 2RFLP reaction System
In the step (4): the sequence length of the allium tuberosum amplification product is about 500bp, and the sequence length of the enzyme digestion product is between 200 and 300 bp; the sequence lengths of the scallion seed enzyme digestion product and the amplification product are both about 500 bp.
The agarose gel electrophoresis is adopted in the step (4) to detect the sequence lengths of the amplification product and the enzyme digestion product, and the steps are as follows:
weighing 2.0g of agarose in a triangular flask, adding 100mL of 1 XTAE buffer solution, heating in a microwave oven with low fire until the agarose is completely dissolved, cooling to 65 ℃, adding 10 mu L of nucleic acid dye GeneRed (Tiangen Biochemical), fully mixing, pouring into a gel tank, inserting a comb, and taking care that no bubbles exist. Standing at room temperature and cooling for 30 min.
And carefully pulling out the comb, taking out the sample subjected to PCR amplification, adding 2 mu L of 10 × Loading Buffer into each 6 mu L of sample, uniformly mixing, adding the mixture into a sample well, and performing 140V constant-voltage electrophoresis for 50 min.
The method comprises the following steps of testing the semen allii tuberosi and the semen allii fistulosi in the same production place, randomly sampling 20mg, carrying out DNA extraction and PCR-RFLP identification, wherein the experimental result is shown in figure 4, and after PCR amplification, the semen allii tuberosi and the semen allii fistulosi have a strip of about 500 bp; after RFLP reaction, the Chinese chive seeds have two bands at 200-300 bp, the scallion seeds have a unique band at 500bp, and the negative control has no band.
Example 2
Example 1 is based on the fact that in the case of the semen allii tuberosi and the semen allii fistulosi which are built in the same producing area, because the ribosome DNA fragments of the semen allii fistulosi and the semen allii tuberosi are related to the producing area and the growing environment, in the actual operation, the identification result may be inaccurate because the DNA fragments of the semen allii tuberosi in different producing areas are not completely the same or the semen allii fistulosi in different producing areas is mixed in the semen allii tuberosi; therefore, the semen allii tuberosi and the scallion in different producing areas are adopted for testing, and the producing areas of the semen allii tuberosi are respectively as follows: gansu, Shanxi, Hebei, Jilin; the production place of the scallion seeds is as follows: shanxi, Xinjiang; randomly sampling twice in each batch, performing 20mg each time, performing DNA extraction and PCR-RFLP identification, wherein the experimental result is shown in figure 5, and after PCR amplification, the semen allii tuberosi and the semen allii fistulosi have a strip of about 500 bp; after RFLP reaction, the Chinese chive seeds have two bands at 200-300 bp, the scallion seeds have a unique band at 500bp, and the negative control has no band.
Example 3
The difference from example 1 is: adopting original plants of the Chinese chives and the scallion, such as the Chinese chives, the scallion, the chives and the similar blanched garlic leaves, randomly sampling for four times, performing DNA extraction and PCR-RFLP identification each time by 30mg, wherein the experimental result is shown in figure 6, and after PCR amplification, the Chinese chives, the scallion, the blanched garlic leaves all have a strip about 500 bp; after RFLP reaction, the Chinese chives have two strips at 200-300 bp, which are consistent with the medicinal materials, while the green onions and the chives have unique strips at 500bp, which are consistent with the medicinal materials, and the results of the garlic yellow suggest that only the Chinese chives can be cut by restriction enzymes, and then two strips are present at 200-300 bp, and no strip is present in negative control.
Example 4
As the ribosome DNA fragments and the types of the allium fistulosum and the allium tuberosum are also related, in the actual production, the allium fistulosum and the allium cepa can be mixed in the allium fistulosum, therefore, the allium fistulosum and the allium cepa are respectively used for testing, 20mg is randomly sampled twice in each batch, DNA extraction and PCR-RFLP identification are carried out, the experimental result is shown in figure 7, and after PCR amplification, the allium fistulosum and the allium cepa have a strip at about 500 bp; after RFLP reaction, the Chinese chive seeds have two bands at 200-300 bp, the scallion seeds and the onion seeds have unique bands at 500bp, and the negative control has no band.
Example 5
The above examples are based on the ideal situation, that is, all the scallion is used to simulate the leek seeds, in the actual operation, more scallion seeds are mixed in the leek seeds, in order to detect whether the method can detect the scallion seeds mixed in the leek seeds, the mixture with 15% of the leek seeds, the scallion seeds and the scallion seeds is used for testing, 20mg of random sampling is carried out, DNA extraction and PCR-RFLP identification are carried out, the experimental result is shown in FIG. 8, and after PCR amplification, the leek seeds, the mixture and the scallion seeds have a strip at about 500 bp; after RFLP reaction, the Chinese chive seeds have two strips at 200-300 bp, three strips at 200-500 bp after mixing, and the scallion seeds have a unique strip at 500bp, so that the Chinese chive seeds and the scallion seeds are easy to detect after mixing; the defects in the beauty are as follows: this method is temporarily unable to determine how many onions are present.
Claims (7)
1. A method for identifying semen allii tuberosi and semen allii fistulosi is characterized by comprising the following steps: respectively carrying out enzyme digestion on internal transcribed spacer sequences of ribosome DNA of a sample to be detected by adopting restriction enzyme Rsa I, wherein the scallion is used for keeping the length of the internal transcribed spacer sequences before and after enzyme digestion basically unchanged; the Chinese chive seeds are obtained after the cleavage of the internal transcription spacer sequence before and after the enzyme digestion;
The identification method comprises the following steps:
(1) extracting DNA of a sample to be detected;
(2) carrying out amplification reaction on the extracted DNA to obtain an amplification product;
the primer sequences of the amplification reaction are: an upstream primer sequence ATGCGATACTTGGTGTGAAT and a downstream primer sequence GACGCTTCTCCAGACTACAAT;
(3) carrying out enzyme digestion reaction on the amplification product by using restriction enzyme Rsa I to obtain an enzyme digestion product;
(4) detecting the sequence lengths of the amplification product and the enzyme digestion product, wherein if the detection results of the enzyme digestion product and the amplification product are the same or basically the same, the sample to be detected is scallion; if the sequence length of the enzyme digestion product is obviously shorter than that of the amplification product, the sample to be detected is semen allii tuberosi.
2. The method for identifying semen allii tuberosi and semen allii fistulosi as claimed in claim 1, wherein: the internal transcribed spacer sequence of the ribosomal DNA is the ITS2 sequence.
3. The method for identifying semen allii tuberosi and semen allii fistulosi as claimed in claim 1, wherein: the amplification reaction conditions in the step (2) are as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 45s, and 40 cycles; finally, extension is carried out for 10min at 72 ℃.
4. The method for identifying semen allii tuberosi and semen allii fistulosi as claimed in claim 1, wherein: the conditions of the enzyme digestion reaction in the step (3) are as follows: the reaction was carried out in a water bath at 37 ℃ for 50min, and the reaction was stopped at 10X Loading Buffer 2. mu.L.
5. The method for identifying semen allii tuberosi and semen allii fistulosi according to any one of claims 1-4, wherein: and (4) detecting the sequence lengths of the amplification product and the enzyme digestion product by adopting agarose gel electrophoresis.
6. The method for identifying semen Allii Tuberosi and semen Allii Fistulosi according to claim 5, wherein: in the step (4): the sequence length of the allium tuberosum amplification product is about 500bp, and the sequence length of the enzyme digestion product is between 200 and 300 bp; the sequence lengths of the scallion seed enzyme digestion product and the amplification product are both about 500 bp.
7. The kit for identifying the semen allii tuberosi and the semen allii fistulosi is characterized in that: comprises a DNA extraction reagent, a PCR amplification upstream primer sequence ATGCGATACTTGGTGTGAAT, a downstream primer sequence GACGCTTCTCCAGACTACAAT and a restriction endonuclease Rsa I.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810288633.5A CN108517370B (en) | 2018-04-03 | 2018-04-03 | Method for identifying semen allii tuberosi and semen allii fistulosi |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810288633.5A CN108517370B (en) | 2018-04-03 | 2018-04-03 | Method for identifying semen allii tuberosi and semen allii fistulosi |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108517370A CN108517370A (en) | 2018-09-11 |
| CN108517370B true CN108517370B (en) | 2022-06-14 |
Family
ID=63431723
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810288633.5A Active CN108517370B (en) | 2018-04-03 | 2018-04-03 | Method for identifying semen allii tuberosi and semen allii fistulosi |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108517370B (en) |
-
2018
- 2018-04-03 CN CN201810288633.5A patent/CN108517370B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species;Shilin Chen等;《PLoS ONE》;20100131;第5卷(第1期);摘要，第6页材料和方法部分，表S1和S5 * |
| 韭菜子与葱子的鉴别;刘知远;《海峡药学》;20061231;第18卷(第1期);全文 * |
| 韭菜子及其两种混淆品的鉴别;朱婕妤等;《中国药业》;20120120;第21卷(第2期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108517370A (en) | 2018-09-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sgamma et al. | DNA barcoding for industrial quality assurance | |
| CN111424110B (en) | Kit for identifying gleditsia sinensis and identification and quantification method | |
| CN109136389A (en) | A kind of DNA bar code standard detection segment CO II, kit and its application method identifying American cockroach | |
| CN106811514B (en) | Specific real-time fluorescence detection method for biological components in Amydae and kit thereof | |
| CN105002272A (en) | Method for identifying varieties of RAPD (random amplified polymorphic DNA) marked panax japonicus and kindred plants thereof | |
| CN106834480B (en) | KASP marker for rapidly identifying cytoplasm fertility of large-population welsh onion and application thereof | |
| CN108517370B (en) | Method for identifying semen allii tuberosi and semen allii fistulosi | |
| CN109762919B (en) | Method for rapidly identifying raspberry and various confuses thereof | |
| CN105483223B (en) | Molecular identification method of purple kidney tea | |
| CN109666758A (en) | Genuine rhizome of chuanxiong identification primer and identification method based on InDel label | |
| KR101948389B1 (en) | Discriminating method of Codonopsis lanceolata and Adenophora triphylla using SSR marker | |
| CN110923331B (en) | Primer pair and application thereof in identification of limnodrilus | |
| CN111235303B (en) | Method for identifying cord-grass and spartina alterniflora | |
| CN107881244B (en) | Probe primer for fluorescence quantitative PCR detection for authenticity identification of bezoar and detection method and application | |
| CN114317799A (en) | Specific primer pair for identifying angelica and common angelica mixed counterfeit and application thereof | |
| CN107881243B (en) | Fluorescent quantitative PCR detection method for authenticity identification of bezoar and application thereof | |
| CN109385487B (en) | Recombinase-mediated amplification isothermal detection method and kit for American ginseng as Chinese medicinal herb | |
| CN105420359A (en) | LAMP primer group for Lectin detection and gene isothermal amplification method | |
| CN110904242A (en) | Primer composition and application thereof in identification of whitmania pigra | |
| CN107557489A (en) | A kind of identification ipomoea and the classification position of relative genus and the method for species and purposes | |
| CN104789671B (en) | The authentication method in source excellent 69 is handed over based on the Hybrid Rice Varieties that InDel is marked | |
| CN117385056A (en) | Specific primer pair and method for identifying Hirudo japonica | |
| CN114634992B (en) | Indel mark of fritillaria unibracteata and application thereof | |
| KR102163234B1 (en) | Molecular marker based on chloroplast sequence for discriminating Angelica dahurica from Angelica species and uses thereof | |
| KR102163238B1 (en) | Molecular marker based on chloroplast sequence for discriminating Angelica acutiloba from Angelica species and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |