CN114634992B - Indel mark of fritillaria unibracteata and application thereof - Google Patents
Indel mark of fritillaria unibracteata and application thereof Download PDFInfo
- Publication number
- CN114634992B CN114634992B CN202210306494.0A CN202210306494A CN114634992B CN 114634992 B CN114634992 B CN 114634992B CN 202210306494 A CN202210306494 A CN 202210306494A CN 114634992 B CN114634992 B CN 114634992B
- Authority
- CN
- China
- Prior art keywords
- fritillaria
- unibracteata
- fritillaria unibracteata
- application
- qpcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The qPCR method using the Indel marked primer and the probe as the core can specifically identify the fritillaria unibracteata, only the fritillaria unibracteata shows positive results when an amplification curve appears, and other fritillaria unibracteata varieties show negative results. Can be used for specific molecular identification of fritillaria unibracteata base plant and medicinal material. The application has the following advantages: the specificity is good, and only the fritillaria unibracteata has amplification curves and positive results; the sensitivity is high, and the lowest detection concentration (DNA) of qPCR is 0.1543 ng/. Mu.L; the steps are few, and the detection period is short: the operation time is only 1.5-2.5 hours; the repeatability is good: more than 10 biological replicates have been performed with reproducibility up to 100%.
Description
Technical Field
The application belongs to the technical field of identification of traditional Chinese medicine source varieties, and discloses an Indel mark of fritillaria unibracteata and a qPCR method established by using the mark, which can accurately distinguish fritillaria unibracteata from other fritillaria unibracteata varieties and effectively ensure the accuracy and quality safety of a medicinal material primitive.
Background
The biological species of the Chinese medicinal materials of plant and animal sources are determined, and the Chinese medicinal materials are called primordium. If two or more basic sources are collected under the standard source item of the traditional Chinese medicine, the condition is called multi-basic traditional Chinese medicine. Although the multi-primordium relieves the market vacancy of the traditional Chinese medicinal materials, the mixed use of the multi-primordium seriously affects the effectiveness, safety and quality controllability of the clinical curative effect of the traditional Chinese medicinal materials. For this reason, the national food and drug administration issued "methods of administration of Chinese medicinal formulation particles (manuscripts of opinion)" in 2016: "the medicinal animal and plant collected by cultivation, breeding or wild plant should be accurately identified, its species including subspecies, varieties or breeds, and the Chinese medicinal materials of different species can not be mixed with each other.
Fritillary bulb is a typical multi-base crude drug, is bulb of multiple plants of the genus fritillary (fritillary l.) of the family Liliaceae, and is extremely confusing and doping. The fritillary bulb for carrying medicine in the Chinese pharmacopoeia of 2020 edition comprises fritillary bulb (Fritilaria cirrhosa D. Don), fritillary bulb (Fritillariae pallidiflorae), fritillary bulb (Fritillaria thunbergii), fritillary bulb (Fritillaria ussuriensis), fritillary bulb of Hubei province (Fritillaria hupehensis) and the like. Wherein, the fritillaria cirrhosa medicinal materials have 6 primordia and comprise fritillaria cirrhosa (F.unibracteata P.K.Hsiao & K.C.Hsia), fritillaria cirrhosa (Fritillaria cirrhosa), fritillaria cirrhosa (F.przewalsky), fritillaria fusiformis (F.delavayi), fritillaria taipaiensis (F.taipaiensis P.Y.Li) and fritillaria cirrhosa (F.unibracteata Hsiao et K.C.Hsia var. The Chinese plant Saint is characterized in that the fritillaria unibracteata is mainly distributed in the northwest of Sichuan China (Aba, ganzi) and in the border between Qinghai and Sichuan provinces, and grows on grasslands with the altitude of 3200-4500 m. Although the use of multiple primordia partially meets the market demands, as the number of primordia is large, once different varieties or different primordia fritillary bulbs are mixed, the clinical curative effect and safety can be seriously affected, and the benefits of consumers and patients are greatly endangered, so that an accurate and efficient identification method suitable for the different primordia fritillary bulbs is urgently needed to be established. At present, a PCR-RFLP molecular identification method is adopted under the item of 'fritillaria cirrhosa' in the 'Chinese pharmacopoeia' of 2020 edition, but a specific molecular identification method for fritillaria unibracteata is lacked. Based on the purpose, the application establishes a molecular biological method capable of accurately identifying the fritillaria unibracteata, and can effectively distinguish the fritillaria unibracteata from the fritillaria unibracteata (comprising other 5 fritillaria cirrhosa primordia, non-fritillaria cirrhosa and some fritillaria cirrhosa near-edge easy mixed seeds).
The identification of fritillaria unibracteata is mainly dependent on the traditional character identification method, and the method mainly carries out observation and comparison on the characteristics of bulb color, navel point shape, leaf number, cohesion tightness, top opening and closing, length, smell and the like of a sample, so that abundant identification experience is required, and the morphological standard of the cultivated product is poor. In addition, the similarity of different fritillary bulbs is continuously increased due to artificial intervention cultivation, and the identification difficulty is continuously increased, so that the identification is generally required to be carried out by combining other analysis and identification technologies. Chemical methods such as high performance liquid chromatography and liquid chromatography-mass spectrometry are complex in materials, large-scale instrument support is needed, and popularization difficulty is high, so that development of a more convenient and rapid detection method for meeting the monitoring requirements of medicinal material markets is unprecedented.
Disclosure of Invention
Based on sequence information of chloroplast genomes of 12 different fritillaria cirrhosa (6 primordia), fritillaria cirrhosa (2 primordia respectively) of fritillaria cirrhosa and fritillaria thunbergii, fritillaria unibracteata, fritillaria hubei and fritillaria cirrhosa, the application discovers that the fritillaria unibracteata has an insertion sequence with the length of 47bp in the trnG-GCC-trnR-UCU gene interval through a large amount of analysis and comparison. The sequence can be used as Indel mark for identifying fritillaria unibracteata. The application designs a pair of specific upstream and downstream primers and TaqMan-MGB probes for specifically identifying fritillaria unibracteata. At least the following applications are provided: (1) identifying a fritillaria unibracteata original plant; (2) and (5) identifying medicinal materials.
The first aim of the application is to provide Indel marks for molecular identification of fritillaria unibracteata, and the second aim is to provide a detection method capable of rapidly identifying fritillaria unibracteata; thirdly, the mark and the method are applied to solve the technical defect of fast identifying the fritillaria unibracteata at present.
The technical measures for achieving the purpose of the application are as follows: indel marked primer and probe of fritillaria unibracteata, wherein the nucleotide sequence of the specific Indel marked primer is shown in SEQ ID NO:1 and SEQ ID NO:2, the nucleotide sequence of the Taqman-MGB probe is shown as SEQ ID NO: 3.
The Indel marking primer is designed according to the Indel marking of fritillaria unibracteata. The Indel marker is obtained by comparing chloroplast genome sequences of 12 different fritillaria plants, and the trnG-GCC-trnR-UCU gene interval of fritillaria unibracteata is found to have an insertion sequence with the length of 47 bp.
A qPCR detection method for identifying fritillaria unibracteata includes the following steps:
1) Extracting genome DNA of a sample to be detected;
2) Taking genomic DNA of a sample to be detected as a template, and carrying out real-time fluorescence PCR amplification by utilizing the pair of specific primers and the TaqMan-MGB probe;
3) Judging whether the sample is fritillaria unibracteata according to whether a positive amplification curve appears.
Furthermore, the Indel mark of the fritillaria unibracteata and the application thereof are used for rapid molecular identification of fritillaria unibracteata primordium plants.
Furthermore, the Indel mark of the fritillaria unibracteata and the application thereof are used for rapid molecular identification of fritillaria unibracteata medicinal materials.
Compared with the prior art aiming at identifying fritillaria unibracteata, the application has the following advantages and positive effects:
1. the qPCR method taking the Indel mark as a core can be used for specifically identifying the fritillaria unibracteata, only the fritillaria unibracteata has a positive amplification curve, other fritillaria unibracteata varieties are negative results, and the application is used for detecting and identifying specific molecules of fritillaria unibracteata-based raw plants and medicinal materials; has high feasibility and application prospect, and has important significance for the healthy and stable development of the Chinese herbal medicine fritillary bulb market.
2. Said application has the following advantages:
(1) the method has the advantages of few operation steps, low cost and short detection period, and the operation steps comprise: DNA extraction, qPCR amplification and data analysis, wherein the operation time is only 1.5-2.5 hours;
(2) the specificity is good, and only the fritillaria unibracteata shows a positive amplification curve after qPCR;
(3) the repeatability is good: we have performed more than 10 biological replicates, with reproducibility up to 100%;
(4) the sensitivity is high: the lowest Detection (DNA) concentration of the method is 0.1543 ng/. Mu.L.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present application and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a schematic diagram of a test and detection process according to an embodiment of the present application.
FIG. 2 shows a schematic diagram of the optimal Tm detection results of PCR used in the present application, and examples of the detection results of fritillaria unibracteata plants and other fritillaria thunbergii samples.
FIG. 3 is a schematic diagram of the reaction sensitivity test results of qPCR used in the present application.
FIG. 4 shows an example of the detection results of the present application on fritillaria unibracteata medicinal material, other fritillaria cirrhosa and non-fritillaria cirrhosa samples.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present application more clear, the technical solutions of the embodiments of the present application will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
It should be noted that, without conflict, the embodiments of the present application and features of the embodiments may be combined with each other. The present application will be described in detail with reference to specific examples.
The application will be further described with reference to examples and figures:
as can be seen from FIG. 1, the whole steps of the application take 1.5-2.5 hours after the extraction of the fritillaria unibracteata based raw plant, medicinal material and genomic DNA, qPCR and data analysis.
The technical measures for achieving the purpose of the application are as follows: indel-labeled primers and probes of fritillaria unibracteata, wherein the nucleotide sequence of the specific Indel-labeled primers is SEQ ID NO:1 and SEQ ID NO:1, as follows:
SEQ ID NO:1, nucleotide sequence of seq id no: 5'-GCTACCCGCTTAATACATAC-3'
SEQ ID NO:2, nucleotide sequence: 5'-CCGGAACAGATCGAACAG-3'.
The nucleotide sequence SEQ ID NO of the Taqman-MGB probe: 3, as follows:
SEQ ID NO:3, nucleotide sequence: 5'-FAM-CCATTGTCTAATGGAAAAGA-MGB-3'
The Indel marking primer is designed according to the Indel marking of fritillaria unibracteata. The Indel mark is obtained by comparing chloroplast genome sequences of 12 different fritillary plants such as fritillaria cirrhosa (6 primordia), fritillaria cirrhosa (2 primordia, i.e. fritillary bulb and fritillaria thunbergii respectively), fritillary bulb, fritillaria thunbergii, fritillaria hupehensis, fritillaria cirrhosa and fritillaria cirrhosa, and the like, and a 47bp insertion sequence is found in the trnG-GCC-trnR-UCU gene interval of fritillaria unibracteatum. According to the application, indel marked primers and probes and corresponding qPCR detection technology are designed, so that fritillaria unibracteata and fritillaria unibracteata of other types can be rapidly and accurately distinguished.
A qPCR detection method for identifying fritillaria unibracteata includes the following steps:
1) Extracting genome DNA of a sample to be detected;
2) Taking genomic DNA of a sample to be detected as a template, and carrying out real-time fluorescence PCR amplification by utilizing the pair of specific primers and the TaqMan-MGB probe;
3) Judging whether the sample is fritillaria unibracteata according to whether an amplification curve appears or not.
Wherein, the extracting of the genome DNA of the sample to be detected in the step 1) comprises the following steps: collecting dried bulb sample of fritillaria unibracteata, or medicinal material decoction pieces (50-60 mg), wiping with 75% alcohol and sterile ultrapure water, adding liquid nitrogen, grinding into superfine powder, and extracting sample genome DNA with plant genome DNA extraction kit of Beijing Tiangen Biochemical Co.
Step 2) the qPCR reaction system: the 2×T5 Fast qPCR Mix (Probe) (Beijing engine biosciences Co., ltd.) was 10. Mu.L, 1.0. Mu.L each of the specifically amplified upstream and downstream primers and TaqMan-MGB Probe (concentration: 10. Mu.M) of step 2, 2.0. Mu.L of the DNA template, and the volume was made up to a total volume of 20. Mu.L with sterilized ultra-pure water.
qPCR reaction condition parameters in step 2): pre-denaturation at 95℃for 2min,1 cycle, denaturation at 95℃for 10S,40 cycles, annealing at 60℃for 1min,40 cycles.
The qPCR reaction described in step 3) was performed by a LightCycler 96 real-time fluorescent quantitative PCR instrument (Roche).
FIG. 2 shows the optimal Tm detection results of qPCR used in the present application, showing that the identification method has a good amplification effect at Tm value of 54-61℃and preferably 60 ℃. The experimental samples used in fig. 2 include fritillaria unibracteata and 12 other fritillaria varieties, which are basic plant leaves except for fritillaria Hubei as medicinal material powder. A is an amplification curve result graph when Tm is equal to 54 ℃; b is an amplification curve result graph when Tm is equal to 56 ℃; c is a graph of amplification curve results at Tm equal to 58 ℃; d is an amplification curve result graph when Tm is equal to 59 ℃; e is a graph of amplification curve results at Tm equal to 60 ℃; f is a graph showing the result of amplification curve at Tm equal to 61 ℃.
FIG. 3 shows the reaction sensitivity detection results of qPCR used in the present application, showing that the identification method has higher reaction sensitivity, and the lowest detection concentration can reach 0.1543 ng/. Mu.L (see Table 3 for specific results). FIG. 3 is a graph showing the results of amplification curves using different DNA template concentrations (ng/. Mu.L) of 154.250, 15.425, 1.543, 0.1543, 0.0154, 0.0015, 0.0002 and 0.00002 ng/. Mu.L.
Fig. 4 shows an example of the detection results of the present application on fritillaria unibracteata medicinal material, other fritillaria cirrhosa and non-fritillaria cirrhosa samples. The experimental samples used in fig. 4 include dried bulb of fritillaria unibracteata, other fritillaria cirrhosa and non-fritillaria cirrhosa varieties, including dried bulb of fritillaria cirrhosa; drying bulb medicinal material of Bolbostemma Pentaphyllum; drying bulb medicinal material of fritillaria thunbergii; dried bulb medicinal material of fritillaria taipaiensis; drying bulb medicinal material of fritillaria cirrhosa; dried bulb medicinal material of fritillaria cirrhosa; dried bulb medicinal material of corning fritillary bulb; dried bulb medicinal material of fritillary bulb; drying bulb medicinal material of dense honey fritillary bulb; dried bulb medicinal material of fritillary bulb; dried bulb medicinal material of fritillary bulb; dried bulb medicinal material of Sinkiang fritillary bulb; dried bulb powder medicinal material of fritillaria hupehensis.
Fig. 2 and fig. 4 show the detection results of qPCR used in the present application on different kinds of fritillary samples, which are fritillaria unibracteata (including primitive plants, medicinal materials, see table 1) and other fritillary varieties (table 2). The application discloses the application of Indel marked primer and probe in PCR detection for identifying fritillaria unibracteata and fritillaria thunbergii varieties.
Example 1
Experiments and results using fritillaria unibracteata-base plants and herbs (table 1) as samples:
(1) DNA extraction of fritillaria unibracteata samples
Taking 1 part of a fritillaria unibracteata (Fritillaria unibracteata Hsiao et K.C.Hsia) sample, taking about 50-60 mg of each of a fritillaria unibracteata dry bulb sample and medicinal materials, cleaning with 75% alcohol and sterile ultrapure water, airing, adding liquid nitrogen, grinding into superfine powder, and extracting the genomic DNA of the sample according to specifications by adopting a plant genomic DNA extraction kit (DP 305) of Beijing Tiangen biochemical limited company. The extracted DNA was detected using a Bio-Tek microplate reader, and the concentration of the DNA was detected using sterilized ultrapure water as a blank.
(2) Reaction system and reaction parameters of qPCR
The PCR reaction system is as follows: the 2×T5 Fast qPCR Mix (Probe) (Beijing engine biosciences Co., ltd.) was 10. Mu.L, 1.0. Mu.L each of the specifically amplified upstream and downstream primers and TaqMan-MGB Probe (concentration: 10. Mu.M) of step 2, 2.0. Mu.L of the DNA template, and the volume was made up to a total volume of 20. Mu.L with sterilized ultra-pure water.
qPCR reaction condition parameters: pre-denaturation at 95℃for 2min,1 cycle, denaturation at 95℃for 10s,40 cycles, annealing at 60℃for 1min,40 cycles.
(3) qPCR amplification data analysis and result judgment.
And (5) deriving qPCR amplification data, and performing data processing analysis.
Table 1 basic plant and medicinal material information of fritillaria unibracteata
| Basic original name | Latin name | Acquisition (purchase) land | Morphology of the product |
| Fritillaria unibracteata (L.) Roxb | F.unibracteata | Xining City, Qinghai Province | Primitive plant |
| Fritillaria unibracteata (L.) Roxb | F.unibracteata | Xining City, Qinghai Province | Dry bulb (medicinal material) |
Example 2
(1) Genomic DNA extraction of other types of fritillary samples
Basically, the same as in example 1, except that the present example collects a total of 13 26 samples of different fritillary source varieties (table 2), comprising: the genome DNA extraction is carried out by 13 kinds of Fritillaria taipaiensis (Fritillaria taipaiensis), fritillaria cirrhosa (Fritillaria cirrhosa), fritillaria fusiformis (Fritillaria delavayi), fritillaria unibracteata (Fritillaria wabuensis), fritillaria thunbergii (Fritillaria przewalskii), fritillaria convalescens (fritillary cirrhosa Franch), fritillaria cirrhosa (Fritillaria mellea), fritillaria cirrhosa (Fritillaria sinica), fritillaria thunbergii (Fritillaria thunbergii), fritillaria unibracteata (Fritillaria ussuriensis), fritillaria hubei hupehensis (Fritillaria hupehensis Hsiao et K.C.Hsia), fritillaria unibracteata (Fritillaria pallidiflora Schrenk) and Fritillaria xinjiangensis (Fritillaria walujewii Regel). The extracted genomic DNA was used directly in subsequent qPCR experiments.
(2) qPCR reaction
Substantially the same as in example 1.
3) Reaction specificity of qPCR
From the graph of FIG. 2 (the abscissa indicates the cycle number, the ordinate indicates the fluorescence value, A:54 ℃, B:56 ℃, C:58 ℃, D:59 ℃, E:60 ℃, F:61 ℃, the fritillaria unibracteata material is the leaf of the basic plant, each group has three repetitions, an amplification curve appears, other fritillaria unibracteata and non-fritillaria unibracteata varieties including fritillaria unibracteata base leaves, fritillaria thunbergii base leaves, fritillaria convalvulos base leaves, fritillaria unibracteata base leaves, fritillaria thunbergii base leaves, ping Beimu base raw plant leaves, fritillaria unibracteata base raw plant leaves and fritillary bulb powder show no amplification curve, and negative reactions appear), only the fritillaria unibracteata shows the amplification curve, and a positive reaction appears. 13 other fritillary varieties including fritillaria taipaiensis, fritillaria pallidum, fritillaria fusiformis, fritillaria pallidum, fritillaria chamomile, fritillaria kansui, fritillaria cirrhosa, fritillaria thunbergii, fritillaria pallidum and Ping Beimu-based raw plants have no amplification curves and show negative reactions. Meanwhile, the optimum Tm value of the present application was studied, and a gradient experiment at 54 to 61℃was set, preferably at 60 ℃. The identification method has strong specificity, and can effectively identify fritillaria unibracteata and common and easily-mixed products thereof.
4) Response sensitivity of qPCR
The genomic DNA of fritillaria unibracteata was diluted 10-fold with sterilized ultrapure water to 8 gradients, each concentration gradient was taken 2. Mu.L as a template, and the sensitivity of the qPCR reaction was detected.
The detection result shows that when a LightCycler 96 real-time fluorescence quantitative PCR instrument (Roche) is adopted, good qPCR amplification effects can be generated when the template DNA mass concentration is 154.250-0.1543 ng/. Mu.L, amplification curves are generated, cq values are all 12-16 (Table 3, figure 3 (experimental materials are unibracken-based plant leaves, the abscissa in the figure is the cycle number, the ordinate is the fluorescence value, and the amplification curves sequentially correspond to DNA templates of various gradients from top to bottom, namely 154.250, 15.425, 1.543, 0.1543, 0.0154, 0.0015, 0.0002 and 0.00002 ng/. Mu.L)). In conclusion, the identification method has high sensitivity.
5) Identification of medicinal materials
The TaqMan-MGB real-time fluorescence PCR method is used for identifying the total of 13 purchased medicinal materials (3 times of repetition of fritillaria unibracteata, fritillaria pallidum, fritillaria thunbergii, fritillaria fusiformis, fritillaria pallidum, fritillaria thunbergii, fritillaria unibracteata, fritillaria thunbergii, fritillaria mellea and fritillaria sinensis) and the results are shown in fig. 4 (the abscissa is the cycle number and the ordinate is the fluorescence value; setting the dry bulb of fritillaria unibracteata as 3 times of repetition, generating an amplification curve, and giving a positive result; other Bulbus Fritillariae Cirrhosae and non-Bulbus Fritillariae Cirrhosae varieties including Bulbus Fritillariae Cirrhosae dry bulb, bulbus Fritillariae Thunbergii dry bulb, bulbus Fritillariae Gansuensis dry bulb, bulbus Fritillariae Thunbergii dry bulb, herba Apii Graveolentis dry bulb, bulbus Fritillariae Cirrhosae dry bulb, bulbus Fritillariae Ussuriensis dry bulb, bulbus Fritillariae Thunbergii dry bulb, bulbus Fritillariae Ussuriensis dry bulb, and Bulbus Fritillariae Hubeiae dry bulb powder have no amplification curve, negative reaction) only the fritillaria unibracteata medicinal material generates a specific fluorescence curve, cq values are 15.09, 15.14 and 15.38, and the other medicinal materials do not generate specific fluorescence curves, so that the negative reaction is shown.
TABLE 2 other types of fritillary samples
TABLE 3 detection sensitivity results of different concentrations of fritillaria unibracteata DNA
Table 4 sequence listing
| Sequence numbering | Sequence name | Sequence(s) |
| SEQ ID NO.1 | Upstream primer | GCTACCCGCTTAATACATAC |
| SEQ ID NO.2 | Downstream primer | CCGGAACAGATCGAACAG |
| SEQ ID NO.3 | Taqman-MGB probe | FAM-CCATTGTCTAATGGAAAAGA-MGB |
To sum up:
1. the qPCR method taking the Indel mark as a core can be used for specifically identifying the fritillaria unibracteata, only the fritillaria unibracteata has a positive amplification curve, other fritillaria unibracteata varieties are negative results, and the application is used for detecting and identifying specific molecules of fritillaria unibracteata-based raw plants and medicinal materials; has high feasibility and application prospect, and has important significance for the healthy and stable development of the Chinese herbal medicine fritillary bulb market.
2. Said application has the following advantages:
(1) the method has the advantages of few operation steps, low cost and short detection period, and the operation steps comprise: DNA extraction, qPCR amplification and data analysis, wherein the operation time is only 1.5-2.5 hours;
(2) the specificity is good, and only the fritillaria unibracteata shows a positive amplification curve after qPCR;
(3) the repeatability is good: we have performed more than 10 biological replicates, with reproducibility up to 100%;
(4) the sensitivity is high: the lowest Detection (DNA) concentration of the method is 0.1543 ng/. Mu.L.
The embodiments described above are some, but not all embodiments of the application. The detailed description of the embodiments of the application is not intended to limit the scope of the application, as claimed, but is merely representative of selected embodiments of the application. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.
Claims (4)
1. For authenticationtrnG-GCC-trnR-UCUIndel marked primer and probe of fritillaria unibracteata with 47bp insertion sequence length in gene interval, characterized in that the nucleotide sequence of the designed primer is shown as SEQ ID NO:1 and SEQ ID NO:2, the designed Taqman-MGB probe has a nucleotide sequence shown as SEQ ID NO: 3.
2. The primers and probes of claim 1 for identificationtrnG-GCC-trnR-UCUThe PCR detection method of fritillaria unibracteata with 47bp insertion sequence length in gene interval comprises the following steps: 1) Extracting genome DNA of a sample to be detected; 2) Taking genomic DNA of a sample to be detected as a template, and carrying out qPCR amplification by using the Indel labeled primer and the probe; 3) Judging whether the sample is a sample according to whether an amplification curve appears or not according to the gel electrophoresis resulttrnG-GCC-trnR-UCUFritillaria unibracteata with 47bp insertion sequence length in gene interval.
3. The use of the primers and probes according to claim 1 or the PCR detection method according to claim 2 for rapid molecular identification of fritillary bulb-based plants.
4. The use of the primers and probes according to claim 1 or the PCR detection method according to claim 2, for rapid molecular identification of fritillaria unibracteata.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210306494.0A CN114634992B (en) | 2022-03-25 | 2022-03-25 | Indel mark of fritillaria unibracteata and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210306494.0A CN114634992B (en) | 2022-03-25 | 2022-03-25 | Indel mark of fritillaria unibracteata and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114634992A CN114634992A (en) | 2022-06-17 |
| CN114634992B true CN114634992B (en) | 2023-10-13 |
Family
ID=81950183
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210306494.0A Active CN114634992B (en) | 2022-03-25 | 2022-03-25 | Indel mark of fritillaria unibracteata and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114634992B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164556A (en) * | 2017-07-20 | 2017-09-15 | 山东省农业科学院生物技术研究中心 | It is a kind of to be used to identify bulbus fritillariae cirrhosae and fluorescent PCR detecting primer, probe compositions, kit and the detection method of adulterant and application |
| CN112359135A (en) * | 2020-12-14 | 2021-02-12 | 西南交通大学 | Indel labeled primer of fritillaria taipaiensis and application thereof |
| WO2021088923A1 (en) * | 2019-11-06 | 2021-05-14 | 青岛清原化合物有限公司 | Method for creating new gene in organism and use thereof |
-
2022
- 2022-03-25 CN CN202210306494.0A patent/CN114634992B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164556A (en) * | 2017-07-20 | 2017-09-15 | 山东省农业科学院生物技术研究中心 | It is a kind of to be used to identify bulbus fritillariae cirrhosae and fluorescent PCR detecting primer, probe compositions, kit and the detection method of adulterant and application |
| WO2021088923A1 (en) * | 2019-11-06 | 2021-05-14 | 青岛清原化合物有限公司 | Method for creating new gene in organism and use thereof |
| CN112359135A (en) * | 2020-12-14 | 2021-02-12 | 西南交通大学 | Indel labeled primer of fritillaria taipaiensis and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114634992A (en) | 2022-06-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108728573B (en) | Fluorescent PCR detection kit for identifying dendrobium officinale and application thereof | |
| CN108977571B (en) | Fluorescent PCR detection kit for identifying four medicinal plants in Araceae and application thereof | |
| CN112029891A (en) | Specific nucleic acid probe for rapidly identifying Fritillaria pallidiflora, method and application | |
| CN111826460A (en) | Specific PCR (polymerase chain reaction) identification primer for identifying fritillaria ussuriensis and application thereof | |
| CN105002272B (en) | Method for identifying varieties of RAPD (random amplified polymorphic DNA) marked panax japonicus and kindred plants thereof | |
| CN104404629B (en) | DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara | |
| CN101974635B (en) | Composition, kit and method for identifying authenticity of hide glue and application thereof | |
| CN106811514B (en) | Specific real-time fluorescence detection method for biological components in Amydae and kit thereof | |
| CN103215373B (en) | Honey detection composition, kit, detection method and application | |
| CN116287149B (en) | Method, primer and probe for identifying panax angustifolius and application of method and primer and probe | |
| CN116334188B (en) | Method for identifying radix notoginseng, primer, probe and application thereof | |
| CN116287412B (en) | Primer, probe and detection method for pseudo-ginseng medicinal material authenticity detection and identification based on second-generation sequencing development | |
| WO2023231532A1 (en) | Snp site combination for identifying variety of lonicera japonica thunb., primer combination, and method for identifying variety of lonicera japonica thunb. | |
| CN114634992B (en) | Indel mark of fritillaria unibracteata and application thereof | |
| CN112359135B (en) | Indel labeled primer of fritillaria taipaiensis and application thereof | |
| CN105483223B (en) | Molecular identification method of purple kidney tea | |
| CN108998554B (en) | Fluorescent PCR detection kit for identifying 3 medicinal dendrobe in pharmacopoeia and application | |
| CN106834480A (en) | A kind of KASP marks of a large amount of colony's onion cytoplasm fertilities of Rapid identification and its application | |
| CN106399557A (en) | Physalis pubescens molecule-specific marker primers and identification method using primers | |
| CN116287424B (en) | Primer, probe and detection method for detecting rhizoma zingiberis pseudo-ginseng | |
| CN117230247B (en) | Method, reagent and application for identifying ginseng genus-class plant | |
| CN114317799B (en) | Specific primer pair for identifying angelica and common angelica mixed and counterfeited products and application thereof | |
| CN116287148B (en) | Method for identifying Panax schinseng, primer, probe and application thereof | |
| CN110317883B (en) | SNP markers for identifying tortoise, pond turtle and hybrid species thereof | |
| CN116103426A (en) | Polygonatum sibiricum adulteration identification method based on fluorescent quantitative PCR technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |