CN108486130A - Upland cotton gst gene cluster and its application in improving plant verticillium wilt resistance - Google Patents
Upland cotton gst gene cluster and its application in improving plant verticillium wilt resistance Download PDFInfo
- Publication number
- CN108486130A CN108486130A CN201810501829.8A CN201810501829A CN108486130A CN 108486130 A CN108486130 A CN 108486130A CN 201810501829 A CN201810501829 A CN 201810501829A CN 108486130 A CN108486130 A CN 108486130A
- Authority
- CN
- China
- Prior art keywords
- gene
- verticillium wilt
- cotton
- plant
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Application the invention discloses upland cotton gst gene cluster and its in improving plant verticillium wilt resistance.Present invention firstly discloses upland cotton gst gene clusters, it includes resistance gene of Verticillium wilt in cotton GhAt09g1508, GhAt09g1509 and GhAt09g1510, and its biological function is disclosed, the plant containing the gene cluster or the resistant gene shows verticillium wilt disease resistance.
Description
Technical field
The present invention relates to field of plant genetic, specifically, being related to upland cotton gst gene cluster and its improving
Application in plant verticillium wilt resistance.
Background technology
Cotton verticillium wilt (Verticillium wilt) is a kind of soil-borne vascular bundle disease, and pathogen is mainly big beautiful
Verticillium dahliae (Verticillium dahliae) and verticilliumalbo-atrum (Verticillium albo-atrum), in nineteen thirty-five by
Introduce incoming China when this word cotton 4B kind in the U.S..Verticillium wilt has expanded to China's three cotton regions at present, seriously threatens China
Cotton Industry safety.2009, China had more than the 50% different degrees of generation verticillium wilt in cotton field.Investigation discovery, big beautiful wheel
Branch bacterium is the main pathogenic bacteria of the major cotton region cotton verticillium wilt in China.Cotton verticillium wilt can cause onset area not once occurring
Disconnected to expand, occurring degree is constantly deepened, and the duration constantly extends, and ultimately causes the underproduction year after year and fiber quality declines.Cotton
Verticillium wilt difficulty of prevention and cure is larger, and chemical prevention often results in Heavy environmental pollution, and there are no effective chemical agent or hands so far
Section controls the generation of the disease.It was verified that cultivation disease-resistant variety is more environmentally-friendly compared with measures such as crop rotation, chemical controls, effective,
Increasingly paid attention to by breeder.Conventional breeding methods have played important function in cultivating cotton disease resistance kind, but due to
The reasons such as breeding method is single, upland cotton hereditary basis is narrow, Gossypium interspecific hybridization difficulty, cause Advances in Breeding slow,
Production requirement cannot be met.And animal nutrition is utilized to excavate resistance gene of Verticillium wilt in cotton, it explores, cotton is anti-yellowing withers for parsing
Interpretation of the cause, onset and process of an illness system has extremely important theory value and application prospect for cultivating disease-resistant variety.
Gst gene family is a kind of ancient, diversity gene family for being made of multiple subclass, is distributed widely in dynamic
In object, plant, bacterium and fungi.Plant gst gene family Type division be initially according to the conservatives of GST protein structures,
Substrate specificity and immunological characteristic etc. are divided into Type I (Phi), Type II (Zeta), Type III (Tau), Type IV
(Theta) four type.As that studies GST deepens continuously, scientist is found that hydroascorbic acid again in plant
The GST subclass of reductase (Dehydroascorbate reductase, DHAR) and two new types of Lambda.Then,
Oakely etc. is again by tetrachloro cyanogen quinone dehalogenase (Tetrachlorohdroquinone dehalogenase, TCHQD), eukaryon
γ-subunit (the γ-subunit of the eukaryotic translation of translation elongation factor 1B
Elongation factor1 γ, EF1B γ) it is included into plant gst gene family.Finally, research finds a kind of microsomal protein
MAPEG classes (Membrane Associated Protein in Eicosanoid and Glutathione metabolism,
MAPEG gst gene family) is also belonged to, with embrane-associated protein characteristic.So far, the GST in plant include Tau, Phi,
Nine Zeta, Theta, Lambda, DHAR, TCHQD, Ef1b γ and MAPEG subclass.Wherein, Tau classes and Phi classes are in plant
Distinctive GST, while being also content classification the abundantest, have the function of antiweed, it is activity that this two class, which is with serine,
Site carries out catalytic action, and the GST of function of detoxification is uniquely exercised with homologous subunit dimerization.Wherein Tau classes usually have 1
A introne；Generally there are two intrones for Phi classes.In actual production, biology and abiotic stress often result in the cotton underproduction, fiber
Quality decline, and GST often plays a significant role during plant resistant biology and abiotic stress.
Invention content
Application the object of the present invention is to provide upland cotton gst gene cluster and its in improving plant verticillium wilt resistance.
In order to realize the object of the invention, upland cotton gst gene cluster provided by the invention, the gene cluster includes gene
GhAt09g1508, GhAt09g1509 and GhAt09g1510, their nucleotide sequence are respectively：
i)SEQ ID NO:Nucleotide sequence shown in 1-3；Or
ii)SEQ ID NO:Nucleotide sequence shown in 1-3 is substituted, lacks and/or increases one or more nucleotide
And express the nucleotide sequence of identical function protein；Or
Iii) under strict conditions with SEQ ID NO:Sequence shown in 1-3 hybridizes and expresses the nucleosides of identical function protein
Acid sequence, the stringent condition are in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1%SDS, 65
Hybridize at DEG C, the solution is used in combination to wash film；Or
Iv) and i), ii) or nucleotide sequence iii) there is 90% or more homology and express identical function protein
Nucleotide sequence.
Wherein, the major gene resistance in the gene cluster is GhAt09g1509.
The present invention also provides provide resistance gene of Verticillium wilt in cotton, the gene be selected from GhAt09g1508,
At least one of GhAt09g1509 or GhAt09g1510.The gene is cloned from Disease-resistant Upland Cotton kind agricultural university 601
It obtains.
The present invention also provides the biomaterial containing the gene cluster or the resistant gene, the biomaterial is expression
Box, expression vector, cloning vector, engineering bacteria or transgenic cell line.
The present invention also provides the gene cluster, the resistance gene of Verticillium wilt in cotton or contain the gene cluster or described anti-
Application of the biomaterial of property gene in improving plant verticillium wilt resistance.
The application includes：
1) it includes the gene cluster or the resistance gene of Verticillium wilt in cotton to make plant；Or
2) make plant expressing said gene cluster or the resistance gene of Verticillium wilt in cotton.
Carrying the expression vector of the target gene can be turned by using Ti-plasmids, plant viral vector, direct DNA
The standard biologics technical method such as change, microinjection, electroporation imports (Weissbach, 1998, Method in plant cell
Plant Molecular Biology VIII, Academy Press, New York, the 411-463 pages；Geiserson and
Corey, 1998, Plant Molecular Biology, 2nd Edition)。
Plant of the present invention includes but not limited to cotton, tobacco.The verticillium wilt is by verticillium dahliae
Caused by (Verticillium dahliae) and/or verticilliumalbo-atrum (Verticillium albo-atrum).
The present invention also provides the gene cluster, the resistance gene of Verticillium wilt in cotton or contain the gene cluster or described anti-
Application of the biomaterial of property gene in prepare transgenosis plant.
The present invention also provides the gene cluster, the resistance gene of Verticillium wilt in cotton or contain the gene cluster or described anti-
Application of the biomaterial of property gene in plant breeding.Wherein, the purpose of the breeding is to improve plant verticillium wilt resistance.
By above-mentioned technical proposal, the present invention at least has following advantages and advantageous effect：
Present invention firstly discloses upland cotton gst gene clusters comprising resistance gene of Verticillium wilt in cotton GhAt09g1508,
GhAt09g1509 and GhAt09g1510, and disclose its biological function, containing the gene cluster or the resistant gene
Plant shows verticillium wilt disease resistance.
Present invention firstly discovers that in tetraploid cotton forming process, a tau class on 09 chromosome of upland cotton A subgroups
Gst gene cluster (being related to tri- genes of GhAt09g1508, GhAt09g1509 and GhAt09g1510) is lost derived from unbalanced gene
It loses, and experienced positive selection effect.Transgenic Tobacco and GhAt09g1508 based on major gene resistance GhAt09g1509,
The cotton VIGS experiments of tri- genes of GhAt09g1509 and GhAt09g1510, prove that the gene cluster is anti-in cotton verticillium wilt for the first time
Property reaction in have critical function.
Description of the drawings
Fig. 1 is the different resistant cotton kind GST difference expression genes heat that verticillium wilt pathogen induces in the embodiment of the present invention 1
Figure.
Fig. 2 is that GhGST genes upland cotton under verticillium wilt pathogen stress resists, in sense kind root in the embodiment of the present invention 3
QRT-PCR is analyzed.
Fig. 3 is the lower plant resistance to verticillium wilt qualification result of verticillium wilt pathogen stress in the embodiment of the present invention 3；Wherein, A：Turn base
Because of tobacco resistance to verticillium wilt qualification result；B：Plant part stem tissue verticillium wilt pathogen recovery cultivation results；C：Verticillium wilt pathogen is coerced
Lower plant disease grade statistical result.WT：Wild-type tobacco；OE：Transfer-gen plant.
Fig. 4 is 3 transgenic of the embodiment of the present invention and WT lines H2O2The Activity determination result of content and CAT, POD；
Wherein, Mock：Water process；Vd：Verticillium wilt pathogen Stress treatment.
Fig. 5 is the Disease Resistance Identification result of GhGST-VIGS plant in the embodiment of the present invention 3；Wherein, A：Verticillium wilt pathogen is coerced
Compel lower plant phenotype；B：The lower plant disease grade statistical result of verticillium wilt pathogen stress；C：The lower root phenotype of verticillium wilt pathogen stress；D：Verticillium wilt
The lower plants stems tissue yellow phenotype of bacterium stress；E：Plant part stem tissue verticillium wilt pathogen recovery cultivation results.WT：Wild type is planted
Strain；VIGS：Interfere plant.
Fig. 6 is the H of verticillium wilt pathogen stress lower silence and WT lines in the embodiment of the present invention 32O2Content and CAT, POD
Activity determination result.
Specific implementation mode
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment
According to conventional laboratory conditions, as Sambrook equimoleculars Cloning: A Laboratory Manual (Sambrook J＆Russell DW,
Molecular Cloning:A Laboratory Manual, 2001), or according to the condition of manufacturer's specification suggestion.
The functional analysis of 1 upland cotton gst gene cluster of embodiment
Find that upland cotton forms latter two homologous tau for the first time by carrying out the analysis of gst gene family to upland cotton genome
Class cluster (including Gh_A09G1508, Gh_A09G1509 and Gh_A09G1510；Gh_D09G1520 and Gh_D09G1521)
Heredity innovation is occurring in genome and gene rebalancing, the two homologous cluster are located in upland cotton A, D subgroup
On No. 9 chromosomes.By transcript profile, VIGS (virus induced gene silencing) and overexpression experiment prove in A subgroups
Cluster has played critical function in cotton verticillium wilt Resistant reaction, and is occurring positioned at homologous cluster in D subgroups
Degenerating, (one of gene has been lost after entailing upland cotton from Lei Mengdeshi cottons, and a gene is lost half, a base
Because not expressing).This result is effectively demonstrated may experienced higher selection pressure, and the work(positioned at the cluster of A subgroups
Energy cluster disclosure satisfy that upland cotton normally grows demand.It, should by being found to the nearly source species cocoa genome analysis of Gossypium
Homologous cluster has existed, and illustrates that the cluster was formed before 6,000 ten thousand years.
Further pair and evolution node natural selection analysis finds that comprising target cluster include Gh_A09G1508, Gh_
A09G1509 and Gh_A09G1510；Gh_D09G1520 and Gh_D09G1521) clade and node experienced positive selection, this
One result demonstrates aforementioned conclusion, that is, the cluster for being located at A subgroups experienced positive selection effect.
In the transcript profile library built under verticillium wilt pathogen stress, detect that 11 A subgroups and 6 D subgroup gst genes are deposited
In differential expression.Wherein No. 9 chromosome Tau genoids GhAt09g1508, GhAt09g1509 and GhAt09g1510 of A subgroups are equal
Expression is had differences, and GhAt09g1509 genes only detect specifically expressing (Fig. 1) in resistant variety agricultural university 601.
The acquisition of embodiment 2 resistance gene of Verticillium wilt in cotton GhAt09g1508, GhAt09g1509 and GhAt09g1510
According to upland cotton TM-1 gene order-checkings result (Li et al., 2015；Zhang et al., 2015), design is such as
Lower primer：
GhAt09g1508:F:TTGATATCATGGGCGAAGAAGTGCAGGTTTTTGGC and R:
TTGGATCCTCATTGGGAAAGACTAGCTTTGAC GCGhAt09g1509:F:
GCTGAGCTCTTAGGCCTTAGCATTATCTT and R:AGAGGATCCATGGGTGAAGAAGTGAAGGhAt09g1510:F:
CCGAATTCATGGGTGAAGAGGTGAAGG and R:TTCCCGGGTCATTTGGAAAGATGAGC
From cotton variety agricultural university 601 respectively clone obtain gene GhAt09g1508, GhAt09g1509 and
GhAt09g1510。
The nucleotide sequence of gene GhAt09g1508, GhAt09g1509 and GhAt09g1510 are respectively such as SEQ ID NO:
Shown in 1-3.
The functional analysis of embodiment 3 gene GhAt09g1508, GhAt09g1509 and GhAt09g1510
1. the functional analysis of the core gene Gh_A09G1509 of upland cotton gst gene cluster
1.1.qRT-PCR analysis shows, the lower Gh_A09G1509 of verticillium wilt pathogen induction is in disease-resistant variety agricultural university 601
Expression is higher than susceptible variety CCRI8, and is meeting bacterium (verticillium dahliae) 12h expression quantity highest (Fig. 2) afterwards, illustrates that the gene is joined
With the interaction of cotton and verticillium wilt pathogen.
1.1.1 the plantation culture of sterile cotton seedling
Agricultural university 601 and CCRI8 seeds concentrated sulfuric acid lint are handled, dried after being rinsed well with clear water.It is soaked in clear water
Vernalization 12h is steeped, during which changes water 2-3 times, impregnates the seed 1min to show money or valuables one carries unintentionally with 0.1% mercury chloride in superclean bench, then use
After 30s is impregnated in absolute ethyl alcohol disinfection, with the ultrapure water 5 times of sterilizing.Seed is put into equipped with MS after removing kind of skin with tweezers
In the glass culture bottle of culture medium, light intensity be 3500Lux, photoperiod 14h, 28 DEG C of daytime, in 23 DEG C of culturing room of night
Culture.
1.1.2 the activation and culture of verticillium wilt pathogen
Highly pathogenicity defoliation verticillium wilt bacterial strain Linxi 2-1 is taken out from 4 DEG C of refrigerators, preparation is seeded in aseptic inoculation ring
On good PDA plate, it is put in light culture in 25 DEG C of constant incubators, until germ covers with entire tablet.Then it is inoculated in
In Czapek fluid nutrient mediums, it is placed in 25 DEG C of shaking tables, 150rpm shake cultures 10d.Using preceding that verticillium wilt pathogen Linxi 2-1 is (big
Beautiful Verticillium dahliae) concentration of spore suspension is adjusted to 1 × 107cfu/mL。
1.1.3 bacterium processing and sampling are connect
Neat, healthy and strong cotton seedling is uprooped from the triangular flask equipped with MS, in the verticillium wilt pathogen spore for having debugged concentration
Root dipping 30s in sub- suspension is transferred again into MS culture mediums, is cultivated in 25 DEG C of culturing room.Take 0h, 6h after connecing bacterium, 12h, for 24 hours,
The root tissue of 36h and 48h, each time point take 3 plants, with liquid nitrogen flash freezer after aseptic water washing, are stored in -80 DEG C, the above processing
It is handled as a contrast with water receiving, and separately sampled preservation, while each time point takes three biology to repeat.
1.1.4 the extraction of total serum IgE
Carry out EASYspin RNA rapid extraction kits with reference to Beijing Ai De and extract RNA, specific steps are said with reference to kit
Bright book.
1.1.5RNA purifying
(1) according to following reaction system purifying RNA:20 μ g of total serum IgE；RNase inhibitor (40U/ μ L) 0.24 μ L；DNase
Ⅰ(RNase-free 5U/μL)0.8μL；10 × DNase, I Buffer, 2 μ L, with Nuclease-free H2O complements to 20 μ L.
(2) after prepared system being reacted 30min at ambient temperature, with the RNase-free H of 80 μ L2O is complemented to
Phenol/chloroform/isoamyl alcohol (volume ratio 25 of same volume is added in 100 μ L:24:1), up and down slightly reverse mixing to not having
Layering.
(3) mixed liquor is immediately placed in 4 DEG C of refrigerated centrifuges, 13000rpm centrifuges 10min, and gently taking out centrifuge tube will
Upper solution is transferred in a new 1.5mL centrifuge tube, and isometric chloroform/isoamyl alcohol is added according to the volume for drawing supernatant
(volume ratio 24:1), up and down slightly reverse mixing to not being layered.
(4) refrigerated centrifuge 10min again, takes in upper layer (water layer) to new centrifuge tube, and the 3M tri- of supernatant volume 1/5 is added
The frost absolute ethyl alcohol of 5 times of volumes of water sodium acetate and supernatant, the freezing precipitation 90min in -20 DEG C of refrigerators.
(5) supernatant is abandoned after 12000rpm refrigerated centrifuges 10min, uses the alcohol washes of 1mL 70% to precipitate again, repeats cold
Freeze centrifugation.After cold air drying under super-clean bench, with suitable Nuclease-free H2O dissolves, and -75 DEG C save backup.
1.1.6 the purity and Concentration Testing of total serum IgE
The Ago-Gel (utensil used in electrophoresis is impregnated with DEPC water disinfects) for preparing 1.5%, takes the RNA of 1 μ L, adds
Enter the 10 × Loading Buffer and 2 μ L RNase-free H of 3 μ L2O mixing point samples, under the conditions of 150V, 300mA, 80W
The quality of electrophoresis detection RNA.The RNA for drawing 1 μ L measures the concentration of RNA with K5500 ultramicro-spectrophotometers.
1.1.7cDNA synthesis
The ReverTra of biotechnology company is spun using Shanghai JapanqPCR RT Master Mix with
GDNA Remover kits, operating procedure are as follows：
(1) denaturation of RNA：The RNA that purifying is taken out from -75 DEG C of refrigerators is immediately placed on and melts on ice, take 1 μ g in it is micro from
In heart pipe, at 65 DEG C after thermal denaturation 5min, it is immediately placed on cooled on ice.
(2) genomic DNA is removed, is formulated as follows reaction solution on ice：4 × DN Master are added in the RNA of denaturation
4 μ L Nuclease-free H of Mix2O complements to 16 μ L.After reaction solution gently mixing centrifugation, 37 DEG C of warm bath 5min removals
gDNA。
(3) reverse transcription reaction is prepared on ice：5 × RT Master Mix, 4 μ are added in the 16 μ L of reaction solution of step (2)
After L pipettors blow and beat mixing brief centrifugation, 37 DEG C of heat preservations 15min, 50 DEG C of heating 5min complete reverse transcription reaction in PCR instrument,
98 DEG C of high temperature enzymes inactivate 5min, finally in 4 DEG C of preservations.
(4) after reaction, take the cDNA of 2 μ L that 10 × Loading Buffer electrophoresis detections of 3 μ L are added.
1.1.8 quantitative fluorescent PCR
Section is guarded to GhGST genes using Premier 5.0 and carries out the design of real-time quantitative (Real-time) PCR primer,
Using GhUBQ14 genes as internal reference (table 1).Dyestuff used is that company is spun by JapanGreen Realtime PCR
Master Mix, reaction condition are 95 DEG C of 2min；95 DEG C of 20s, 56 DEG C of 20s, 72 DEG C of 15s, 40 cycles；10 DEG C of heat preservations.Each
Reaction is arranged 3 technologies and repeats, under the conditions of analysis connects bacterium, water receiving, relative expression of the GhGST genes in agricultural university 601 and CCRI8
Amount.Significance analysis is carried out using GraphPad Prism6.
1 real-time fluorescence quantitative PCR primer of table
1.2. tobacco is overexpressed experiment：Verticillium wilt pathogen stress under, turn the disease-resistant phenotype of Gh_A09G1509 genetic tobacco plant compared with
Control resistance is remarkably reinforced；By germ separation test, verticillium wilt pathogen in plant body is detached, overexpresses germ intrusion in plant body
Amount is considerably less than wild type (Fig. 3)；Turn in Gh_A09G1509 genetic tobacco vivo oxidation antioxidant systems with active oxygen micro-balance
Related H2O2Content, CAT and POD activity are higher than wild type (Fig. 4), illustrate expression enhancings of the Gh_A09G1509 in tobacco body
The micro-balance of plant ROS substances in body when resisting verticillium wilt, to improve the disease resistance of plant.
Overexpression used carrier is pBI121, and Gh_A09G1509 genes are inserted into the restriction enzyme site BamHI of plasmid pBI121
Between SacI, recombinant plasmid is obtained, converts Agrobacterium, prepares to make leaf disk method turn when culture grows true leaf to tobacco aseptic seedling
Change.
1.3.VIGS (virus induced gene silencing) is tested
Construct GhGST silent carriers GhGST-pTRV2.Construction method is as follows：
(1) the VIGS design of primers of GhGST
The polyclone enzyme enzyme site of pYL156 carriers application is found in GhGST genes using Premier 5.0, design is special
Specific primer is shown in Table 2.
Table 2GhGST gene VIGS primers
The above primer is using Gh_A09G1509 genes as drone design.
(2) acquisition and digestion of target fragment
Target fragment is obtained through PCR amplification on GhGST overexpression vector plasmids, by agarose gel electrophoresis, gel
Obtain target fragment after recycling, connection carrier T pMD19-T structures complete intermediate carrier, after sequencing is correct by pYL156 empty carriers,
GhGST-pMD19 intermediate carriers carry out double digestion, and upstream restriction enzyme site is BamH I, and downstream is Sac I.Digestion in 37 DEG C of incubators
20min.Digestion products are recycled with 1% agarose gel electrophoresis, measured concentration.
(3) connection and conversion of target fragment and pYL156
The target gene fragment of recycling is connected on pYL156 carriers.Connection product is transformed into bacillus coli DH 5 alpha,
Positive colony is detected by PCR, correct expression vector GhGST-pTRV2 will be sequenced adds 50% glycerine of 1/2 volume, -20 DEG C
It preserves.
Using Gh_A09G1509 genes in blade injector method silence disease-resistant variety agricultural university 601.Under verticillium wilt pathogen stress
GhGST-pTRV2 transfer-gen plant resistance to verticillium wilt is remarkably decreased compared with empty vector control；Plant root under verticillium wilt pathogen stress
Analysis finds that empty vector control plant root is obviously more flourishing than GhGST-pTRV2 transfer-gen plants root system；Germ separation test
It was found that GhGST-pTRV2 transfer-gen plants isolate a large amount of verticillium dahliae mycelia, and control group only has seldom big beautiful wheel
Branch bacterium mycelia is separated, while GhGST-pTRV2 transfer-gen plants stem vascular bundle browning degree is also obviously compared with adjoining tree
Seriously (Fig. 5)；Internal H2O2Content and CAT and POD activity, which are substantially less than, compares (Fig. 6), illustrates the table of Gh_A09G1509 genes
Up to adjusting ROS balance key substances H2O2The raising of content, CAT and POD expression quantity has facilitation, and then enhances cotton
The resistance to verticillium wilt of strain.
Real-time PCR analysis shows that, Gh_A09G1508 in VIGS (GhGST-pTRV2 transfer-gen plants) seedling,
The silence efficiency of Gh_A09G1509, Gh_A09G1510 are respectively 86%, 97% and 60%.In conclusion upland cotton A subgroups 9
Number chromosome Tau genoids cluster (GhAt09g1508, GhAt09g1509 and GhAt09g1510) is in cotton verticillium wilt Resistant reaction
In played critical function.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be modified or is improved, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>Agricultural University Of Hebei
<120>Upland cotton gst gene cluster and its application in improving plant verticillium wilt resistance
<130> KHP181110931.5
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 654
<212> DNA
<213>Upland cotton (Gossypium hirsutum)
<400> 1
atgggcgaag aagtgcaggt ttttggattc tgggcaagcc cttacagcca cagggtagag 60
ctggctttga gcttgaaagg tgttccatat gaatatatag aagaggacat cttaaagaac 120
aagagtgatt tactcttgaa atataatccc attcataaaa aagtcccagt ttttctccac 180
aaagggaaac caattgtaga gtctattgtt atacttgaat atatcgagga aacttggaaa 240
gtcaatccca ttttaccaca aagtccttat gacaaagcca tcgatcggtt ttggatcaag 300
ttcatcgatg acaagtgctt gcctgcggtt aggaaagcta catttagccc tgagaatgag 360
cgagaaacgg cggtggaaga agcttgtgag tgtctaaaaa tgcttgaaag tgcactgaat 420
ggaaagagat tctttggtgg ggatgcgatc ggaatggtag acattgctgc caactttctt 480
accatttggc ttaggaccat tcaagaagct acgggattgg aggtgttgtc agtggagaaa 540
ttccccgact tgtttaaatg gactgacgac ttcataagtt gcagtgttgt taaagaaagt 600
ttgccttcta cagacaaact attatccttt gtcaaagcta gtctttccca atga 654
<210> 2
<211> 678
<212> DNA
<213>Upland cotton (Gossypium hirsutum)
<400> 2
atgggtgaag aagtgaaggt ttttggatat tgggcaagcc cttacagcta cagggcagag 60
cttgctttga agttgaaagg tgtttcttat gagtacataa atgaggatat ctttggcaac 120
aagagcgatt tacttttgaa atacaatccg gttcataaga aagtcccagt tcttcttcac 180
aacggaaaat caattgtaga gtctgttgtt attcttgaat acattgagga aacttggaag 240
cataatcttt atttgccaca agatccttat gacaaagcta ccgctcgatt ctggatcaag 300
ttcatcgacg aaaagtgctt tcctaccctt tggctagctg catggagccc cgagaatgag 360
cgagaaaaag tgacgaacga agcttgcgag tatatgaaaa cgcttgaaag tgcgcttaat 420
ggaaagaaat tctttggtgg agaaaccatt ggaatggtag atattgttgc tagctctgtt 480
gggtatttca ttagggtcac tcaagaaatt atggggctaa atctgctgtc agctgacaaa 540
tttccccaat tattccaatg gtctgaagat ttcgcaaatt gcagcattgt taaggaaagt 600
ttacctccaa gagacaaact acttcccttt gtcaaaggtc tcattgccaa atatcagcaa 660
gataatgcta aggcctaa 678
<210> 3
<211> 651
<212> DNA
<213>Upland cotton (Gossypium hirsutum)
<400> 3
atgggtgaag aggtgaaggt ttttggagca tgggcaagcc cttttagccg taaggtagag 60
ctggctttgc ggttgaaagg tgttccatat gactacatag aagaagactt gaataacaag 120
agctctttgc ttttgcaata caactcggtt cataagaaag tcccagttct tcttcacaac 180
gggaaatcaa ttgcagagtc gattgttata cttgaataca ttgaggaaac ttggaaaacc 240
tatcccatct tgccacaaga tcctaacgac aaagccatgg ctcgattctg gatcaatttc 300
attgatggca agtgctcgtc tgccattagg aaagttgcat ttagccctga ggaggagaga 360
gagaaggcag tggaagaagc ttgtgagtgt ctgaaaacac ttgaaagtgc actgaatgga 420
aagaaattct ttggtgggga tacaattgga atggtagaca ttgttgccct ttttattgcc 480
ttttggctta gaccctttca agaaattatg gggttggagc tgttgtcatc tgagaaattc 540
cccaacttat tcaaatggac tgacgacttt gttagttgca gcattgttaa ggaacttttg 600
cctcctagag acaaattagt agcccatatc aaagctcatc tttccaaatg a 651
Claims (10)
1. upland cotton gst gene cluster, which is characterized in that the gene cluster include gene GhAt09g1508, GhAt09g1509 and
GhAt09g1510, their nucleotide sequence are respectively：
i)SEQ ID NO:Nucleotide sequence shown in 1-3；Or
ii)SEQ ID NO:Nucleotide sequence shown in 1-3 is substituted, lacks and/or increases one or more nucleotide and table
Up to the nucleotide sequence of identical function protein；Or
Iii) under strict conditions with SEQ ID NO:Sequence shown in 1-3 hybridizes and expresses the nucleotides sequence of identical function protein
Row, the stringent condition are in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1%SDS, at 65 DEG C
Hybridization, is used in combination the solution to wash film；Or iv) with i), ii) or nucleotide sequence iii) there is 90% or more homology and expression phase
The nucleotide sequence of congenerous protein.
2. resistance gene of Verticillium wilt in cotton, which is characterized in that the gene be selected from GhAt09g1508, GhAt09g1509 or
At least one of GhAt09g1510；
Wherein, the definition of gene GhAt09g1508, GhAt09g1509, GhAt09g1510 is the same as described in claim 1.
3. the biomaterial containing gene described in gene cluster described in claim 1 or claim 2, the biomaterial is expression
Box, expression vector, cloning vector or engineering bacteria.
4. biomaterial described in gene or claim 3 described in gene cluster, claim 2 described in claim 1 is improving plant
Application in resistance to verticillium wilt.
5. application according to claim 4, which is characterized in that the application includes：
1) it includes the gene cluster or the resistance gene of Verticillium wilt in cotton to make plant；Or
2) make plant expressing said gene cluster or the resistance gene of Verticillium wilt in cotton.
6. biomaterial turns base in preparation described in gene or claim 3 described in gene cluster, claim 2 described in claim 1
Because of the application in plant.
7. biomaterial is in plant breeding described in gene or claim 3 described in gene cluster, claim 2 described in claim 1
In application.
8. application according to claim 7, which is characterized in that the purpose of the wherein described breeding is to improve plant verticillium wilt to resist
Property.
9. application according to claim 8, which is characterized in that the plant is cotton, tobacco.
10. according to the application described in claim 4,5,8 or 9, which is characterized in that the verticillium wilt is by verticillium dahliae
Caused by (Verticillium dahliae) and/or verticilliumalbo-atrum (Verticillium albo-atrum).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810501829.8A CN108486130A (en) | 2018-05-23 | 2018-05-23 | Upland cotton gst gene cluster and its application in improving plant verticillium wilt resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810501829.8A CN108486130A (en) | 2018-05-23 | 2018-05-23 | Upland cotton gst gene cluster and its application in improving plant verticillium wilt resistance |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108486130A true CN108486130A (en) | 2018-09-04 |
Family
ID=63351949
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810501829.8A Pending CN108486130A (en) | 2018-05-23 | 2018-05-23 | Upland cotton gst gene cluster and its application in improving plant verticillium wilt resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108486130A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820686A (en) * | 2022-08-22 | 2023-03-21 | 西南大学 | Citrus CsGSTU18 gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009034395A1 (en) * | 2007-09-14 | 2009-03-19 | University Of Durham | Method and means relating to multiple herbicide resistance in transgenic plants |
| CN101792488A (en) * | 2009-11-18 | 2010-08-04 | 中国农业科学院棉花研究所 | Cotton disease resistance related transcription factor MEREB2, and protein encoding gene and application thereof |
| CN106011098A (en) * | 2016-05-24 | 2016-10-12 | 中国农业科学院棉花研究所 | Resistance-related cotton protein GaGSTF2, as well as coding gene and application thereof |
-
2018
- 2018-05-23 CN CN201810501829.8A patent/CN108486130A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009034395A1 (en) * | 2007-09-14 | 2009-03-19 | University Of Durham | Method and means relating to multiple herbicide resistance in transgenic plants |
| CN101792488A (en) * | 2009-11-18 | 2010-08-04 | 中国农业科学院棉花研究所 | Cotton disease resistance related transcription factor MEREB2, and protein encoding gene and application thereof |
| CN106011098A (en) * | 2016-05-24 | 2016-10-12 | 中国农业科学院棉花研究所 | Resistance-related cotton protein GaGSTF2, as well as coding gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| LI F等: "Gossypium hirsutum cultivar TM-1 chromosome 13，ASM98774v1，whole genome shotgun sequence，ACCESSION NO：NC_030086", 《GENBANK》 * |
| ZHIKUN LI等: "Cloning and characterization of a tau glutathione S-transferase subunit encoding gene in Gossypium hirsutum", 《GENES GENET SYST》 * |
| 陈斌等: "转GhGST基因的棉花植株的获得", 《河北农业大学学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820686A (en) * | 2022-08-22 | 2023-03-21 | 西南大学 | Citrus CsGSTU18 gene and application thereof |
| CN115820686B (en) * | 2022-08-22 | 2023-09-12 | 西南大学 | Citrus CsGSTU18 gene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107338266A (en) | A kind of VIGS silencing systems for identifying mulberry tree MmPDS genes and its construction method and application | |
| CN102634522A (en) | Gene for controlling rice fertility, encoded protein and application thereof | |
| CN115820685B (en) | Citrus CsGSTF1 gene and application thereof | |
| CN101589147A (en) | The maize ERECTA genes for improving plant growth, transpiration efficiency and drought tolerance in crop plants | |
| CN106754926A (en) | MiRNA and its application for regulating apple spot defoliation resistance | |
| CN105695461B (en) | A kind of specifically expressed promoter of wheat flag leaf and its application | |
| CN108486130A (en) | Upland cotton gst gene cluster and its application in improving plant verticillium wilt resistance | |
| CN115820686B (en) | Citrus CsGSTU18 gene and application thereof | |
| CN108795944B (en) | Cotton long-chain non-coding RNA-lnc973 and application thereof in plant salt tolerance | |
| CN110055260A (en) | A kind of rice BURP protein coding gene OsBURP16 and its application | |
| CN109706154B (en) | CsPR3 gene and application thereof in cucumber fusarium wilt resistance | |
| CN114015716B (en) | Virus-induced gene silencing mediated quinoa gene function verification method | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene | |
| CN107287169A (en) | A kind of eggplant cytochrome P450 gene StCYP84A and its preparation method and application | |
| CN110283238A (en) | Paddy disease-resistant albumen RWR1 and its application | |
| CN103243110B (en) | Anti-magnaporthe oryzae paddy gene OsWRKY19 and application thereof | |
| CN107723293A (en) | A kind of cotton fiber development related gene GbWRKY32 and its expression vector and application | |
| CN108949769B (en) | Cotton bollworm ecdysone regulatory factor E78-C gene cDNA and application thereof | |
| CN104561040B (en) | Genes For Plant Tolerance hot radical is because of HTT3 and its application | |
| CN106434689A (en) | Plant disease-resistant essential gene ShORR-1 and application thereof | |
| CN105132428A (en) | ZmLRT gene related to plant root system characters as well as relevant biological material and application thereof | |
| CN117025834B (en) | Flanking sequence of exogenous insert fragment of transgenic corn VB15 and application thereof | |
| CN105505985B (en) | Expression vector and its application with cucumber CsMADS07 gene | |
| CN117363629B (en) | Citrus CsGATA gene and method for enhancing citrus canker resistance by using same | |
| CN110734911B (en) | Application of miR159b in regulation and control of rice bacterial leaf blight resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |