CN108486119A - A kind of aptamer RhB-F02 and its application with rhodamine B specific binding - Google Patents

A kind of aptamer RhB-F02 and its application with rhodamine B specific binding Download PDF

Info

Publication number
CN108486119A
CN108486119A CN201810178606.2A CN201810178606A CN108486119A CN 108486119 A CN108486119 A CN 108486119A CN 201810178606 A CN201810178606 A CN 201810178606A CN 108486119 A CN108486119 A CN 108486119A
Authority
CN
China
Prior art keywords
aptamer
rhodamine
rhb
hole
incubated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810178606.2A
Other languages
Chinese (zh)
Other versions
CN108486119B (en
Inventor
韩芹芹
靖乐
夏雪山
汪颖
宋玉竹
刘丽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kunming University of Science and Technology
Original Assignee
Kunming University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kunming University of Science and Technology filed Critical Kunming University of Science and Technology
Priority to CN201810178606.2A priority Critical patent/CN108486119B/en
Publication of CN108486119A publication Critical patent/CN108486119A/en
Application granted granted Critical
Publication of CN108486119B publication Critical patent/CN108486119B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2430/00—Assays, e.g. immunoassays or enzyme assays, involving synthetic organic compounds as analytes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Plant Pathology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of aptamer RhB F02 for obtaining specifically binding with rhodamine B using SELEX technology screenings, and the aptamer is single stranded DNA, is made of 82 nucleotide, nucleotide sequence such as SEQ ID NO：Shown in 1；Its secondary structure contains ring and stem outstanding, and there are tetra- stranded structures of G, wherein RhB F02 Gibbs free energies DG=10.97.The a series of properties assessment such as aptamer specificity, affinity and sensitivity is carried out based on enzyme-linked oligonucleotides adsorption measurement, shows RhB F02 dissociation constantsK d =20.89 ± 2.37 nM, and specific can be combined with rhodamine B, therefore the aptamer has the characteristics that high specific, high-affinity, can enzyme rapidly and sensitively be used for the detection of rhodamine B.

Description

A kind of aptamer RhB-F02 and its application with rhodamine B specific binding
Technical field
The present invention relates to a kind of aptamer with rhodamine B specific binding and its applications, belong to biomedical skill Art field.
Background technology
Aptamer is by index concentration Fas lignand system evolution technology (SyStematic evolution of LigandS by exponential enrichment, SELEX) screening obtains can be with metal ion, small molecule, big point of biology Son, or even entire cell high specific and the ssDNA or RNA of high-affinity combination.Aptamer not only has antibody molecule Specific recognition, every diagnostic field for being related to antibody can nearly all replace with aptamer, and be also equipped with from The unique excellent properties of body, with target molecule range is wide, molecular mass is small, immunogenicity is low, be easy to chemical synthesis, transformation and The advantages that label.In recent years, aptamer is in treatment new drug, medicament transport, cancer cell detection, bio-imaging, biological marker There is application in the biomedical sectors such as the discovery of object, illicit drugs inspection, antiviral.
Rhodamine B (Rhodamine B) is also known as rose red b or basic rhodamine, and it is red to be commonly called as pollen, is a kind of to have fresh peach Red artificial synthesized dyestuff.Rhodamine B has strong fluorescence in the solution, is typically used as the cell fluorescence in laboratory and contaminates The industries such as toner, coloured glass, characteristic fireworks and firecrackers.But since rhodamine B has cheap, the red gorgeous, stability of color and luster The features such as strong, many illegal businessmans are in order to seek exorbitant profit, by the colorant in its substitute food product additive, addition in chilli powder and In the foods such as chilli oil, the purpose is to keep food beautiful, but largely addition rhodamine B can bring pole to the safe diet of people Big hidden danger.According to investigations, rhodamine B can make intake, sucking and skin contact person generate a series of malaise symptoms, such as dizzy, Vomiting, abdominal pain, leucocyte such as increase at the symptoms, in turn result in acute or chronic middle toxicity damage.Related data shows, rhodamine B Protein staining can be also destroyed, many experiments have also further demonstrated that rhodamine B can cause mouse subcutaneous tissue to generate sarcoma, and With potential carcinogenic and teratogenesis.
Currently, the method for detection rhodamine B mainly has two kinds of high performance liquid chromatography and efficient liquid phase tandem mass spectrometry.But It is that both detection methods are required for specific instrument and equipment, preferable professional knowledge and certain operative skill, it can not be extensive Using.In order to ensure the health of broad masses of the people, illegal retailer is hit, is established a kind of accurate and reliable, sensitive quick, wide The method of general applicable detection rhodamine B is particularly important in food security work.
Invention content
The object of the present invention is to provide a kind of aptamer RhB-F02 with rhodamine B specific binding, nucleotide Sequence such as SEQ ID NO:Shown in 1；The aptamer is single stranded DNA, is made of 82 nucleotide, topology is straight chain Shape；The secondary structure of prediction has ring outstanding and stem, and there are tetra- stranded structures of G-, Gibbs free energy DG=- 10.97.
The present invention is making another object is that the above-mentioned aptamer RhB-F02 with rhodamine B specific binding is applied It is standby to detect the reagent of rhodamine B in food or detected in food in the kit of rhodamine B preparing.
It is a series of with specificity, affinity and the sensitivity of aptamer RhB-F02 of rhodamine B specific binding etc. Property assessment is based primarily upon enzyme-linked oligonucleotides adsorption measurement（ELONA）.
The present invention is achieved by the following scheme goal of the invention：
1, the screening of rhodamine B specific nucleic acid aptamers, clone, separation and sequencing
Go out the aptamer group that can be specifically bound with rhodamine B using SELEX technology screenings, design primer carries out PCR amplification, clone, separation and sequencing；Utilize enzyme-linked oligonucleotides adsorption experiment（ELONA）It is verified, obtains aptamers RhB-F02, it is capable of the combination rhodamine B of high-affinity high specific；Ligand adapter-primer sequence is：Aptamer Fw： GACATATTCAGTCTGACAGC；Reverse complementary sequence：CGCTGTCAGACTGAATATGTC；Aptamer Rv： GCTAGACGATATTCGTCCATC, reverse complementary sequence：GATGGACGAATATCGTCTAGC；Obtained positive monoclonal carries out core Nucleotide sequence measures, and sequencing result shows that the aptamer specifically bound with rhodamine B is made of 82 nucleotide, sequence Row（5 ' ends to 3 ' ends）For：
GCTAGACGATATTCGTCCATCTCCCGTGCATCCGAGACCGTGAGTTGGACTGACCCGCTTCCGCTGTCAGACT GAATATGTC。
2, aptamer single stranded DNA secondary structure characterizes
Use MFOLD softwares（http://mfold.rna.albany.edu/q=mfold/DNA-Folding-Form）Pair and sieve The aptamer RhB-F02 single strand dnas of red bright B specific bindings carry out secondary structure prediction.The result shows that two level Structure has ring outstanding and stem, and there are tetra- stranded structures of G-, it is higher that Gibbs free energy DG=- 10.97 shows that the structure has Stability；Its secondary structure is shown in Fig. 1.
3, the specificity, affinity of aptamer and its sensitivity to rhodamine B
According to the sequence of aptamer RhB-F02, the aptamer marked with in-vitro transcription method synthesizing biotinylated（Nucleic acid The nucleotide sequence 5 ' of aptamers RhB-F02 is held by biotin labeling）, establish a kind of novel enzyme-linked oligonucleotides detection side Method to the specificity of aptamer, affinity and its is detected the sensitivity of rhodamine B by the method；As a result it shows Show, RhB-F02 dissociation constantsKd=20.89 ± 2.37 nM, and RhB-F02 has very high specificity, can detect sieve The minimum concentration of red bright B Wei not 10 ng/mL；
The specific method is as follows：
（1）0.05 M pH, 9.6 carbonate buffer solutions are 1 with rhodamine B volume ratio:1 mixing, final concentration of the 50 of rhodamine B ng/μL.It is added in ELISA Plate per 100 μ L of hole, is sealed with adhesive sticker, in being incubated 2h on 37 DEG C, 100 rpm/min shaking tables. Then the liquid in hole is discarded, 200 μ L PBST cleaning solutions are added per hole, in oscillation washing 3 times on horizontal constant-temperature table, every time It is patted dry on clean blotting paper after washing 2 min.
（2）100 μ L, 5% defatted milks are added per hole to be closed, is sealed with adhesive sticker, is shaken in 37 DEG C, 100 rpm/min It is incubated 2h on bed.Liquid in hole is discarded, is then repeated（1）In washing step.
（3）It is molten that the aptamer RhB-F02 for indicating biotin is dissolved into a concentration of 100 μM of storage with aqua sterilisa Liquid, then it is diluted to 1 × PBS the working concentration of 100 nM.Per hole be added 100 μ L, sealed with adhesive sticker, in 37 DEG C, 100 2 h are incubated on rpm/min shaking tables.Liquid in hole is discarded, is then repeated（1）In washing step.
（4）The horseradish peroxidase conjugate that 100 μ L indicate Streptavidin is added per hole（Stretavidin- HRP）, sealed with adhesive sticker, in being incubated 2 h on 37 DEG C, 100 rpm/min shaking tables.Liquid in hole is discarded, is then repeated（1）In Washing step.
（5）100 μ L TMB chromogenic reagent solutions are added per hole, are sealed with adhesive sticker, 20 min of colour developing are protected from light at 37 DEG C.
（6）50 μ L terminate liquids are added per hole（2 M sulfuric acid）, and within 10 min of reaction terminating, use microplate reader Absorbance value of each hole at 450 nm is detected, OD450 is obtained.
4, the truncation experimental analysis of aptamer
Aptamer RhB-F02 is truncated by ELONA methods to determine best combination site.Based on aptamer The secondary structure of RhB-F02 predictions（Fig. 1）, aptamers RhB-F02 is truncated, the following table of sequence, secondary structure after truncation As shown in Figure 7；The results show that the segment after truncating cannot identify target molecule, therefore, aptamer RhB-F02 shows that its is complete Whole three-dimensional structure is capable of the identification target molecule of high-affinity.
；
5, the detection and analysis of food simulation addition rhodamine B
The rhodamine B standard items that four different levels are added in thick chilli sauce sample, are handled, and built with this using identical method Found the rate of recovery of this detection method；Aptamer RhB-F02 is 81.67% ~ 97.51% to the rhodamine B rate of recovery, therefore is utilized The ELONA methods that aptamers RhB-F02 is set up may be used as the actually detected of rhodamine B in food, can be used for subsequently examining The preparation of test agent box.
Meaning of the present invention is:
It is capable of the identification of high-affinity high specific using the aptamer RhB-F02 that SELEX technology screenings go out and combines sieve It is red bright；Detection of the discriminating of aptamer RhB-F02 for remaining rhodamine B in food, and then rhodamine B is reduced to people The infringement of body is of great significance.
Description of the drawings
Fig. 1 is the secondary structure schematic diagram of aptamer RhB-F02；
Fig. 2 is CD circular dichroism detectors in the present invention to K+The analysis result of concentration and the relationship of aptamer RhB-F02；
Fig. 3 is that ELONA methods analyze the specificity of aptamer RhB-F02 in the present invention, in figure：Blank control CK1:Degreasing Milk；Blank control CK2：Biotin；Negative control 1-6 is：Non-target substance（Tonyred, melamine, glyphosate, hydrochloric acid gram Lun Teluo, orthene, Furadan）；Positive group：Rhodamine B；
Fig. 4 is that ELONA methods analyze the optium concentration of aptamer RhB-F02 in the present invention, in figure：Blank control CK1：It is de- Fat milk；Blank control CK2：Biotin；Positive group：It is marked with the aptamers RhB-F02 of biotin；
Fig. 5 is ELONA methods in the present invention to the affinity analysis of aptamer RhB-F02, aptamer RhB-F02 and sieve The affinity of the combination of red bright B is usedK d Value indicates；
Fig. 6 is analysis of the ELONA methods to rhodamine sensitivity in the present invention, in figure：Blank control CK1：Defatted milk；Blank control CK2：Biotin；Positive group：It is marked with the aptamers RhB-F02 of biotin；
Fig. 7 is the secondary structure figure of the aptamer RhB-F02 after different loci truncates；
Fig. 8 is truncation experimental analysis of the ELONA methods to aptamer RhB-F02 in the present invention, in figure：Blank control CK1：It is de- Fat milk；Blank control CK2：Biotin；Positive group：It is marked with the aptamers RhB-F02 of biotin and is marked with cutting for biotin Short aptamers F1575, F2054, F3454.
Specific implementation mode
With reference to the accompanying drawings and examples come the essentiality content further illustrated the present invention, embodiment is only for more preferably managing The solution present invention but do not limit to and the scope of the invention, method is conventional method, the reagent used unless otherwise specified in embodiment The reagent for being conventional commercial reagent unless otherwise specified or preparing according to a conventional method.
Embodiment 1：The screening of rhodamine B aptamer
One, aglucon（Rhodamine B）With matrix（Ago-Gel 6B）Coupling
1, in sintered glass filter（More reciprocal of duty cycle G3）With the freeze-dried powder Ago-Gel 6B for 1 g that suspends in 3 mL distilled water；
2, immediately in sintered glass filter with the coupling buffer solution of 200 mL（The carbonate buffer solution of 0.05 M, pH 9.6） 1 h of washing matrix；
3, the aglucon that 6 g are dissolved with the coupling buffer solution of 6 mL, it is 1 mg/mL to make its ultimate density；
4, a concentration of 1 mg/mL in step 2 matrix and step 3 buffer solution of aglucon by volume 1 has been dissolved into:2 ratios Mixing handles 16 h, and 37 DEG C of incubator overnights under 35 DEG C -40 DEG C of water bath condition；
5, under conditions of 40 DEG C -50 DEG C, with the superfluous group of the ethylaminoethanol closing of 1M, at least 4 h or overnight；
6, surplus aglucon is washed with coupling buffer, 4000 rpm centrifuge 2 min, draw supernatant；Use ultra-pure water（Each 7-8 mL）Cleaning 3 times；And then it uses and contains 0.1 M NaHCO3, 0.5 M NaCl pH 8.0 solution clean 3-4 times；Then it uses Solution containing 0.1 M NaCl, the pH 4.0 of 0.1 M acetate cleans 3-4 times；It is 20% second finally to use mass percent concentration 6 mL of alcohol is preserved, and is positioned over 4 DEG C of refrigerators, and sealed membrane sealing is vertical to place.
Two, aptamer library（ssDNA）PCR
The ssDNA aptamers library synthesized using TaKaRa companies；
1,94 DEG C of preheating PCR instruments；
2, by 3 μ L ssDNA, 30.6 μ L deionized waters, 5 μ L10 × Buffer, 3 μ LMgCl2, 4 μ L dNTP mixtures （Each 2.5 μM）, 2 μ L forward directions amplimers, the reversed amplimers of 2 μ L and 0.4 μ L Taq enzyme centrifuge tubes reacted；Just It is 5 '-GACATATTCAGTCTGACAGC-3 ' to amplimer sequence, reversed amplimer sequence is 5 '- GCTAGACGATATTCGTCCATC-3’。
3, it is expanded by following procedure in PCR instrument
(1) pre-degeneration
94 ℃ 5 min；
(2) 40 cycles
94 ℃ 45 s
58 ℃ 45 s
72 ℃ 30 s；
(3) it expands afterwards
72 ℃ 7 min。
Three, the purifying in ligand library, loading and elution
1, the purifying in ligand library
(1) aptamer library PCR product directly with the solution in plastic recovery kit by volume 1:1 ratio mixes, into Row DNA fragmentation recycles；
(2) after DNA fragmentation recycling, 95 DEG C of 10 min of water-bath, 10 min of ice bath；By this denaturation treatment, double-stranded DNA is made to become Single stranded DNA.
2, affinity chromatography
(1) matrix being coupled is eluted with coupling buffer：Upper solution is drawn, adds coupling buffer to 6 mL, mixing, from The heart discards supernatant liquid, this step is repeated 3 times；
(2) single stranded DNA in step 1 is added in the matrix being coupled, is incubated in 37 DEG C and 40 rpm softly rotates 2 h；
(3) it is added in aforementioned sample to chromatographic column, with the ultrapure water pillar of 2-3 column volumes；
(4) and then with the elution buffers of 3-4 column volumes（0.1 M NaCl, 0.1 M acetate, pH 4.0）Carry out linear gradient Elution fraction is collected in elution；
(5) elution fraction mixes in equal volume with sol solution, is dissolved with TE solution after recycling, obtains Selex solution.
Four, PCR optimizations and large amplification aptamer
Using above-mentioned Selex solution as template, operate as follows：
1,94 DEG C of preheating PCR instruments；
2, by 5 μ L templates, 28.6 μ L deionized waters, 5 μ L10 × Buffer, 3 μ LMgCl2, 4 μ L dNTP mixtures（Respectively 2.5 μM）, 2 μ L forward directions amplimers, the reversed amplimers of 2 μ L, 0.4 μ LTaq enzymes, reacted in PCR centrifuge tubes. Positive amplimer sequence is 5 '-GACATATTCAGTCTGACAGC-3 ', and reversed amplimer sequence is 5 '- GCTAGACGATATTCGTCCATC-3’。
3, it is expanded by following procedure in PCR instrument：
(1) pre-degeneration
94 ℃ 5 min；
(2) 37 cycles：
94 ℃ 45 s
58 ℃ 45 s
72 ℃ 30 s；
(3) it expands afterwards
72 ℃ 7 min；
4, after circulation terminates, PCR products are stripped recycling, step with the DNA product purification kit of TIANGEN companies It is as follows：
(1) PCR product with isometric film is combined buffering overturn mixing, mixed liquor is then transferred to centrifugal purification column, room temperature 5 min are stood, DNA is made fully to be combined with pellosil, 12000 rpm centrifuge 1 min, outwell the waste liquid in collecting pipe；
(2) rinsing liquid of 700 μ L is added（Containing ethyl alcohol）In centrifugal purification column, 12000 rpm centrifuge 1 min, outwell collection Waste liquid in pipe；
(3) step is repeated（2）；
(4) 12000 rpm centrifuge 3 min；
(5) centrifugal purification column is placed in new centrifuge tube；
(6) 30 μ L ultra-pure waters are added, stand 5 min at room temperature；
(7) 12000 rpm centrifuge 1 min, and tube bottom solution is the PCR product of the aptamer purified.
Embodiment 2：The clone of aptamer, separation and sequencing and the prediction of single stranded DNA secondary structure
One, the preparation of bacillus coli DH 5 alpha competent cell
1, the single DH5 α bacterium colonies of picking are inoculated in LB culture mediums of 3 mL without ampicillin, and 37 DEG C of overnight incubations are secondary Day takes above-mentioned bacterium solution in proportion 1:100 are inoculated in 50 mL LB liquid mediums, 37 DEG C of 2 min of oscillation；When OD600 values reach When to 0.35, bacterial cultures is harvested；
2, bacterial cultures is transferred in the sterile polypropylene tube of 50 mL precoolings, places 10 min on ice, makes culture It is cooling；
3,4000 rpm centrifuge 10 min at 4 DEG C, discard culture solution, and pipe is inverted l min so that remaining culture liquid stream To the greatest extent；
4, respectively add 0.1 mM CaCl of 150 μ L ice precooling2Solution merges two pipes, 10 min of ice bath；
5,4000 rpm centrifuge 10 min at 4 DEG C, discard supernatant liquid, and pipe is inverted l min so that residual liquid stream To the greatest extent；
6,0.1 M CaCl of 800 μ L ice precooling are first added2Cell is resuspended in solution, adds 75% glycerine of 25 μ L precoolings, It is spare in -80 DEG C of storages later.
Two, connection and the conversion of connection product
1,0.5 μ L Takara pMD19-T Simple carriers, 4.5 μ L aptamers PCR are added in microcentrifugal tube The ligase buffer mixture of product and 5 μ L；
2,16 DEG C of 3 min of reaction；
3, full dose（10 μL）It is added into 100 μ L DH5 α competent cells, 30 min is placed in ice；
4, after 42 DEG C of 90 s of heating, then 1 min is placed in ice；
5, LB culture mediums 890 μ L, 37 DEG C of 60 min of slowly vibrating culture that 37 DEG C of warm bath are crossed is added；
6, take 200 μ L be coated on containing X-Gal, IPTG, ampicillin LB culture mediums on, 37 DEG C culture 16 min with shape At single bacterium colony.
Three, the colony screening of aptamer, separation and sequencing and single stranded DNA secondary structure prediction
The single bacterium of the above-mentioned white of picking is fallen in the LB culture mediums containing ampicillin, 37 DEG C of 4 min of slowly vibrating culture, into Row PCR amplification；The amplification condition of amplimer and amplification condition with aforementioned aptamer.The positive colony that will be confirmed through PCR After carrying out plasmid extraction, nucleotide is carried out with the full-automatic nucleotide sequencing instrument of U.S. Applied BioSyStemS3730A The measurement of sequence；Structure shows that its sequence of the aptamer specifically bound with rhodamine B is from 5 ' ends to 3 ' ends:
GCTAGACGATATTCGTCCATCTCCCGTGCATCCGAGACCGTGAGTTGGACTGACCCGCTTCCGCTGTCAGACT GAATATGTC；
With the sequence length of the aptamer RhB-F02 of rhodamine B specific binding：82 bases, sequence type：Nucleic acid, Chain number：It is single-stranded, topology：Straight-chain, sequence type：ssDNA.
It is 26 DEG C, Na that temperature, which is arranged, by MFOLD softwares+A concentration of 150 mM, Mg2+A concentration of 1 mM（http:// mfold.rna.albany.edu/q=mfold/DNA-Folding-Form）It is mapped with QGRS（http:// bioinformaticS.ramapo.edu/QGRS/analyze.php）Pair with rhodamine B specific binding aptamer RhB-F02 single strand dnas carry out secondary structure prediction.The result shows that aptamers contain ring and stem outstanding, RhB-F02 is lucky Buss free energy DG=- 10.97；Structure has higher stability（See Fig. 1）.
Embodiment 3：Circular dichroism detector is to K+Concentration is probed into the relationship of aptamer RhB-F02
1, after aptamers being diluted to 20 μM with aqua sterilisa, 0.5 min is denaturalized in 94 DEG C with the speed of 0.5 DEG C/min It is cooled to 25 DEG C；
2, aptamer RhB-F02 is diluted to the KCl solution of various concentration (0,10,20,40,60,80,100 mM) 2.5 μM；
3, it is detected with circular dichroism spectrometer at 25 DEG C, 220-340 nm wavelength（As a result see Fig. 2）.
The result shows that：Chromatography has negative peak between 240 ~ 250 nm, has posivtive spike between 275 ~ 285 nm.Because 240 ~ 250 peaks nm are the characteristic peaks of tetra- serobilas of G-, and 275 ~ 285 peaks nm are stem ring characteristic peaks, so aptamer RhB-F02 It can be stabilized in KCl solution and not interfere with its secondary structure.
Embodiment 4：Specificity, affinity and the sensitivity to rhodamine B of aptamer RhB-F02
One, aptamer RhB-F02 specific detections
1, ELONA methods
It is improved on the basis of traditional ELISA method, antibody is replaced with the aptamers screened, using biology Element-Avidin amplification system is detecting sample to be tested.
(1) coating of toxin
9.6 carbonate buffer solutions of 0.05M pH are 1 with rhodamine B volume ratio:1 mixing, the final concentration of 50 ng/ μ of rhodamine B L.It is added in ELISA Plate per 100 μ L of hole, is sealed with adhesive sticker, in being incubated 2 h on 37 DEG C, 100 rpm oscillators, be incubated The liquid in hole is discarded afterwards, 200 μ L PBST cleaning solutions are added per hole, in oscillation washing 3 times on horizontal constant-temperature table, is washed every time It is patted dry on clean blotting paper after washing 2 min.Set up blank control and negative control (blank control 1 simultaneously:Defatted milk；It is empty White control 2：Biotin；Negative control 1-6 is：Non-target substance（Tonyred, melamine, glyphosate, clenobuterol hydrochloride, Orthene, Furadan, concentration are consistent, and method is same as above).
(2) it closes
In the ELISA Plate for being coated with rhodamine B toxin, 5% defatted milk of 100 μ L is added in each hole, is sealed with adhesive sticker, it Afterwards, in being incubated 2 h on 37 DEG C, 100 rpm oscillators, after closing, liquid in hole is discarded, repeats step（1）In washing Step.
(3) plus the aptamer with biotin labeling is incubated
Screening obtains that the conjunction of Shanghai Sheng Gong biotech firms can be sent to the aptamer RhB-F02 that rhodamine B toxin is combined At biotin is used in combination（Biotin）Mark RhB-F02.In use, first carrying out of short duration centrifugation, make the nucleic acid of labeled biotin Aptamers are all gathered in test tube bottom.It is with aqua sterilisa that the aptamer of labeled biotin is fully molten according to explanation Solution is at a concentration of 10-4 The storing solution of M can be packed as aliquot in order to avoid freeze thawing repeatedly.
The aptamer RhB-F02 of labeled biotin is diluted to the working concentration of 100 nM with 1 × PBS, then, 100 μ L are added in each hole, after adhesive sticker or sealed membrane sealing, in being incubated 2 h on 37 DEG C, 100 rpm oscillators, are incubated it Afterwards, liquid in hole is discarded, step is repeated（1）In washing step.
(4) enzyme conjugate is incubated
It 100 μ L is added in each hole indicates the horseradish peroxidase conjugate of Streptavidin and then sealed with adhesive sticker, Later, in being incubated 1 h on 37 DEG C, 100 rpm oscillators, after incubation, liquid in hole is discarded, repeats step（1）In washing Step.
(5) it develops the color
100 μ L of color developing agent TMB solution are added in per hole, are protected from light 20 min of colour developing at 37 DEG C later.
(6) it terminates
Finally, the terminate liquid (2 M sulfuric acid) of 50 μ L is added into per hole, and to be used within 10 min of reaction terminating Microplate reader detects absorbance value of each hole at 450 nm, obtains OD450.
The results show that aptamers RhB-F02 can and rhodamine B specificity combination（As a result see Fig. 3）.
Two, the detection of aptamer RhB-F02 optimal uses concentration
1,9.6 carbonate buffer solutions of 0.05M pH and rhodamine B volume ratio are 1:1 mixing, final concentration of the 50 of rhodamine B ng/μL.It is added in ELISA Plate per 100 μ L of hole, is sealed with adhesive sticker, in being incubated 2 h on 37 DEG C, 150 rpm oscillators, incubated Liquid in hole is discarded after having educated, and adds 200 μ L of cleaning solution per hole, in oscillation washing 3 times on horizontal shaker, 2 min every time, equally To be patted dry on clean blotting paper every time；
2, in the ELISA Plate for being coated with rhodamine B toxin, 5% defatted milk of 100 μ L is added in each hole, is sealed with adhesive sticker, Later, in being incubated 2h on 37 DEG C, 100 rpm oscillators, after closing, liquid in hole is discarded, repeats the washing in step 1 Step；
3, by the aptamers of biotin labeling with 1 × PBS be diluted to 1 nM, 10 nM, 40 nM, 80 nM, 100 nM, 250 nM, 500 nM、1000 nM；Each hole adds 100 μ L, is sealed with adhesive sticker or sealed membrane, is incubated on 37 DEG C, 100 rpm oscillators 2 h are educated, liquid in hole is discarded after being incubated, repeat the washing step in step 1；
3,100 μ L horseradish peroxidase conjugates are added in every hole, are sealed with adhesive sticker, in 37 DEG C, 150 rpm oscillators 1 h of upper incubation discards liquid in hole, repeats the washing step in step 1；
4,100 μ L of TMB color developing agents are added per hole, 20 min of colour developing are protected from light in 37 DEG C；
5, add 50 μ L terminate liquids（2 M sulfuric acid）, and within 10 min of reaction terminating extinction at each 450 nm of hole is surveyed with microplate reader Angle value OD450；
The result shows that the optimal use concentration of aptamers RhB-F02 is 80 nM（Fig. 4）.
Three, the affinity of aptamer RhB-F02K d Value calculates
1,9.6 carbonate buffer solutions of 0.05M pH and rhodamine B volume ratio are 1:1 mixing, final concentration of the 50 of rhodamine B ng/μL.It is added in ELISA Plate per 100 μ L of hole, is sealed with adhesive sticker, in being incubated 2 h on 37 DEG C, 150 rpm oscillators, incubated Liquid in hole is discarded after having educated, and adds 200 μ L of cleaning solution per hole, in oscillation washing 3 times on horizontal shaker, 2 min every time, equally To be patted dry on clean blotting paper every time；
2, in the ELISA Plate for being coated with rhodamine B toxin, 5% defatted milk of 100 μ L is added in each hole, is sealed with adhesive sticker, Later, in being incubated 2h on 37 DEG C, 100 rpm oscillators, after closing, liquid in hole is discarded, repeats the washing in step 1 Step；
3, the aptamers of biotin labeling are diluted to 1 nM, 5nM, 10 nM, 20 nM, 40 nM, 80 nM, 100 with 1 × PBS NM, each hole add 100 μ L, are sealed with adhesive sticker or sealed membrane, in being incubated 2 h on 37 DEG C, 100 rpm oscillators, have been incubated After discard liquid in hole, repeat the washing step in step 1；
4,100 μ L horseradish peroxidase conjugates are added in every hole, are sealed with adhesive sticker, in 37 DEG C, 150 rpm oscillators 1 h of upper incubation discards liquid in hole, repeats the washing step in step 1；
5,100 μ L of TMB color developing agents are added per hole, 20 min of colour developing are protected from light in 37 DEG C；
6, add 50 μ L terminate liquids（2 M sulfuric acid）, and within 10 min of reaction terminating extinction at each 450 nm of hole is surveyed with microplate reader Angle value OD450；
The result shows that aptamer RhB-F02K d =20.89±2.37（Fig. 5）.
Four, detections of the aptamer RhB-F02 to rhodamine B sensitivity
1,9.6 carbonate buffer solutions of 0.05M pH and rhodamine B volume ratio are 1:1 mixing makes final concentration of the 0.1 of rhodamine B Ng/mL, 1 ng/mL, 10 ng/mL, 20 ng/mL, 40 ng/mL, 60 ng/mL.It is added in ELISA Plate, uses per 100 μ L of hole Adhesive sticker seals, and in being incubated 2h on 37 DEG C, 150 rpm oscillators, liquid in hole is discarded after being incubated, and adds cleaning solution 200 per hole μ L will similarly be patted dry on clean blotting paper every time in oscillation washing 3 times, each 2min on horizontal shaker；
2, in the ELISA Plate for being coated with rhodamine B toxin, 5% defatted milk of 100 μ L is added in each hole, is sealed with adhesive sticker, Later, in being incubated 2h on 37 DEG C, 100 rpm oscillators, after closing, liquid in hole is discarded, repeats the purge step in step 1 Suddenly；
3, the aptamers of biotin labeling are diluted to 80 nM with 1 × PBS, each hole adds 100 μ L, with adhesive sticker or sealed membrane Sealing discards liquid in hole in being incubated 2h on 37 DEG C, 100rpm oscillators after being incubated, repeat the washing step in step 1；
4,100 μ L horseradish peroxidase conjugates are added in every hole, are sealed with adhesive sticker, in 37 DEG C, 150 rpm oscillators 1 h of upper incubation discards liquid in hole, repeats the washing step in step 1；
5,100 μ L of TMB color developing agents are added per hole, 20 min of colour developing are protected from light in 37 DEG C；
6, add 50 μ L terminate liquids（2 M sulfuric acid）, and within 10 min of reaction terminating extinction at each 450 nm of hole is surveyed with microplate reader Angle value OD450；
The result shows that aptamer RhB-F02 detects that the minimum concentration of rhodamine B Wei not 10ng/mL（Fig. 6）.
Embodiment 5：The truncation experimental analysis of aptamer RhB-F02
In order to reduce the cost of nucleic acid aptamers, aptamer RhB-F02 is cut based on its secondary structural features Short experiment is groped.Sequence after aptamer truncates see the table below, and secondary structure is as shown in Figure 7.After being truncated respectively to three Aptamer segment and full length fragment carry out ELONA methods and are verified, remaining operation is same as above.
The result shows that：Segment after truncation cannot identify target molecule, and therefore, aptamer RhB-F02 is completely three-dimensional Structure can identify target molecule to high-affinity（Fig. 8）；
。
Embodiment 6：The detection and analysis of food simulation addition rhodamine B
According to the effect of the specific recognition rhodamine B of aptamer RhB-F02, establish a kind of based on aptamer The detection method of rhodamine B in actual sample.The thick chilli sauce of different supermarket's different brands is extracted as sample, prepares 4 groups of samples, The totally 3 parts of progress parallel laboratory tests of every group of sample, every part weighs 1 g of thick chilli sauce.4 groups of every gram of samples add 10 ng, 40 ng, 80 successively The rhodamine B of ng, 100 ng, then every part of sample 10 mL ultra-pure waters of addition, stir evenly, and 12000 rpm centrifuge 10 min, Supernatant is extracted after standing 5 min；It is dense that the aptamer RhB-F02 of biotin labeling is first diluted to 100 μM of storages with ultra-pure water Degree, then with 1 × PBS to be diluted to 100 nM working concentrations spare.
Four groups of supernatants carry out 1 with 9.6 carbonate buffer solutions of 0.05M pH respectively:1 volume ratio mixes, then per 100 μ of hole L is coated in 96 orifice plates, is sealed in 37 DEG C, 100 rpm incubations, 2 h.After being incubated, PBST is washed three times, every time 2 min, and In being patted dry on blotting paper.Secondly, 100 μ L, 5% defatted milks are added per hole, is sealed in 37 DEG C, 100 rpm, 2 h of incubation, has been incubated Afterwards, washing operation is same as above.Again, the aptamer RhB-F02 of the biotin labeling of 100 μ L is added per hole, is sealed in 37 DEG C, 100 rpm be incubated 2 h, after being incubated, washing operation is same as above.Then 100 μ L horseradish peroxidases are added per hole, are protected from light 37 DEG C, 100 rpm, 2 h of incubation are sealed in, after being incubated, washing operation is same as above.100 μ L TMB color developing agents are added per hole again, in 37 DEG C, be protected from light colour developing 20 min.Finally, 50 μ L terminate liquids are added per hole（The 2 M concentrated sulfuric acids）, and in 10 min of reaction terminating It is interior, using microplate reader in the light absorption value of 450 nm, measure OD450.
Meanwhile preparing to prepare the standard curve of rhodamine B.Rhodamine B standard items are diluted to 5 concentration, are followed successively by 1 Ng/mL, 4 ng/mL, 8 ng/mL, 10 ng/mL, 20 ng/mL, then carry out the measurement of ELONA methods, and operating procedure is same as above.It will The OD450 measured carries out the drafting of standard curve, and the thick chilli sauce containing various concentration rhodamine B is calculated by this curve In, the rate of recovery of the aptamer RhB-F02 to it.
Table 1 the result shows that：Aptamer RhB-F02 is 81.67% ~ 97.51% to the detection rate of recovery of rhodamine B.Text Display is offered, when the rate of recovery is between 80.00% to 120.00%, then it represents that used ELONA methods may be used as the inspection of sample It surveys.Therefore, aptamer RhB-F02 can be used for the actually detected of rhodamine B in food.
Recovery of standard addition of the 1 aptamer RhB-F02 of table in thick chilli sauce
。
Sequence table
<110>Kunming University of Science and Technology
<120>A kind of aptamer RhB-F02 and its application with rhodamine B specific binding
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 82
<212> DNA
<213>Artificial sequence (Artificial)
<400> 1
gctagacgat attcgtccat ctcccgtgca tccgagaccg tgagttggac tgacccgctt 60
ccgctgtcag actgaatatg tc 82
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial)
<400> 2
gacatattca gtctgacagc 20
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence (Artificial)
<400> 3
gctagacgat attcgtccat c 21
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (Artificial)
<400> 4
gacatattca gtctgacagc 20
<210> 5
<211> 21
<212> DNA
<213>Artificial sequence (Artificial)
<400> 5
cgctgtcaga ctgaatatgt c 21
<210> 6
<211> 21
<212> DNA
<213>Artificial sequence (Artificial)
<400> 6
gctagacgat attcgtccat c 21
<210> 7
<211> 21
<212> DNA
<213>Artificial sequence (Artificial)
<400> 7
gatggacgaa tatcgtctag c 21

Claims (3)

1. a kind of aptamer RhB-F02, nucleotide sequence such as SEQ ID NO with rhodamine B specific binding:1 institute Show.
2. the aptamer RhB-F02 according to claim 1 with rhodamine B specific binding, it is characterised in that：Two Level structure has ring outstanding and stem, and there are tetra- stranded structures of G-, and Gibbs free energy is DG=- 10.51.
3. the aptamer RhB-F02 described in claim 1 specifically bound with rhodamine B sieve in preparing detection food The reagent of red bright B is preparing the application detected in food in the kit of rhodamine B.
CN201810178606.2A 2018-03-05 2018-03-05 Aptamer RhB-F02 specifically bound with rhodamine B and application thereof Active CN108486119B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810178606.2A CN108486119B (en) 2018-03-05 2018-03-05 Aptamer RhB-F02 specifically bound with rhodamine B and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810178606.2A CN108486119B (en) 2018-03-05 2018-03-05 Aptamer RhB-F02 specifically bound with rhodamine B and application thereof

Publications (2)

Publication Number Publication Date
CN108486119A true CN108486119A (en) 2018-09-04
CN108486119B CN108486119B (en) 2020-10-27

Family

ID=63341608

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810178606.2A Active CN108486119B (en) 2018-03-05 2018-03-05 Aptamer RhB-F02 specifically bound with rhodamine B and application thereof

Country Status (1)

Country Link
CN (1) CN108486119B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110423754A (en) * 2019-05-06 2019-11-08 昆明理工大学 Aptamer and utilization SELEX screening technique and application with borax specific binding

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105177010A (en) * 2015-08-10 2015-12-23 昆明理工大学 Nucleic acid aptamer specifically combined with Sudan Red and application of nucleic acid aptamer
CN107505463A (en) * 2017-07-17 2017-12-22 昆明理工大学 With the aptamer Sf B09 of sodium formaldehyde sulfoxylate specific bond and its application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105177010A (en) * 2015-08-10 2015-12-23 昆明理工大学 Nucleic acid aptamer specifically combined with Sudan Red and application of nucleic acid aptamer
CN107505463A (en) * 2017-07-17 2017-12-22 昆明理工大学 With the aptamer Sf B09 of sodium formaldehyde sulfoxylate specific bond and its application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHARLES WILSON ET AL.: "Isolation of a fluorophore-specific DNA aptamer with weak redox activity", 《CHEMISTRY & BIOLOGY》 *
云雯等: "基于核酸适配体的生物传感技术在食品安全领域中的研究进展", 《食品工业科技》 *
徐敦明等: "核酸适体技术在食品安全分析中的应用", 《分析化学》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110423754A (en) * 2019-05-06 2019-11-08 昆明理工大学 Aptamer and utilization SELEX screening technique and application with borax specific binding

Also Published As

Publication number Publication date
CN108486119B (en) 2020-10-27

Similar Documents

Publication Publication Date Title
CN104745589B (en) A kind of screening technique of nucleic acid aptamer of specific recognition streptomysin and application
EP3018212B1 (en) Oligonucleotide aptamer specifically recognizing t-2 toxin
JP2008502332A5 (en)
CN104745588B (en) A kind of nucleic acid aptamer of specific recognition streptomysin and its application in streptomysin detection
CN108866065B (en) ssDNA aptamer for specifically recognizing gentamicin and application thereof
CN107505463B (en) With the aptamer Sf-B09 of sodium formaldehyde sulfoxylate specific bond and its application
CN108251429A (en) A kind of aptamer Met-G02 and its application with acephatemet specific binding
CN105039346B (en) A kind of aptamer and application with melamine specific bond
CN107462714B (en) With the aptamer Sf-A09 of sodium formaldehyde sulfoxylate specific bond and its application
CN106929510A (en) A kind of specific nucleic acid aptamers and application
CN108486119A (en) A kind of aptamer RhB-F02 and its application with rhodamine B specific binding
CN105177009B (en) A kind of aptamer and application with α-amanita hemolysin specific bond
CN105177011B (en) A kind of aptamer and application with clenbuterol hydrochloride specific bond
CN112029771B (en) Aptamer specifically binding to meperidine and application thereof
JP5835778B2 (en) PSA-binding aptamer and PSA detection kit
CN105039347B (en) A kind of aptamer and application with glyphosate specific bond
CN104862314B (en) A kind of and the aptamer of α amanita hemolysin specific bonds and application
CN108949765B (en) Aptamer specifically combined with nodulotoxin-R and application thereof
CN107505464A (en) With the aptamer Sf E07 of sodium formaldehyde sulfoxylate specific bond and its application
CN113549626B (en) Aptamer Pr-A08 specifically bound with procymidone and application thereof
CN105177010B (en) A kind of aptamer and application with tonyred specific bond
WO2018189639A1 (en) Escherichia coli o157:h7 aptamer and applications thereof
CN109517823A (en) A kind of aptamer of clostridium difficile binary toxin A chain
CN104561010B (en) Homocysteine aptamer HCy5 and preparation method thereof
CN110423754A (en) Aptamer and utilization SELEX screening technique and application with borax specific binding

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant