CN105177010B - A kind of aptamer and application with tonyred specific bond - Google Patents
A kind of aptamer and application with tonyred specific bond Download PDFInfo
- Publication number
- CN105177010B CN105177010B CN201510485745.6A CN201510485745A CN105177010B CN 105177010 B CN105177010 B CN 105177010B CN 201510485745 A CN201510485745 A CN 201510485745A CN 105177010 B CN105177010 B CN 105177010B
- Authority
- CN
- China
- Prior art keywords
- tonyred
- aptamer
- aptamers
- ligand
- biotin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a kind of aptamers for being capable of high-affinity high specific combination tonyred obtained using selex technologies, which is a kind of single stranded DNA, is made of 84 nucleotide, nucleotide sequence such as SEQ ID NO：Shown in 1；Its secondary structure contains prominent ring and stem, and there are tetra- stranded structures of G, Gibbs free energy DG=14.40；The aptamer passes through enzyme-linked oligonucleotides adsorption test energy specific detection to tonyred.
Description
Technical field
The present invention relates to a kind of aptamer with tonyred specific bond and applications, belong to biomedical technology neck
Domain.
Background technology
Tonyred is a kind of chemical staining agent, not food additives.Contain a kind of change for being naphthalene in its chemical analysis
Object is closed, which has azo structure, since the property of this chemical constitution determines that it has carcinogenicity, to the liver kidney of human body
Organ has apparent toxic action, forbids being used in food in China.But due to the food colour after the Sudan's red colouring
It is very bright-coloured and fugitive color, the appetite that people can be caused strong, some illegal food enterprises are not added to tonyred in food.
The food of common addition tonyred has chilli powder, chilli oil, red bean corruption, red heart birds, beasts and eggs etc..Therefore, how quickly, accurately, spirit
Detecting that tonyred prevents trouble before it happens quickly has become urgent problem to be solved.
Aptamer is by SELEX technologies, screens what is obtained from specific oligonucleotide library, can be special with target molecule
The opposite sex, a kind of oligonucleotide molecules combined high-affinity（DNA or RNA）.Since it is with target molecule scope is wide, molecule matter
Measure that small, immunogenicity is low, be easy to chemical synthesis, transformation and the advantages that mark, aptamer is in clinical diagnosis identification and disease
Important application value is shown in therapy field.
Inventor carries out the nucleotide sequence of the tonyred specific nucleic acid aptamers of the present invention and gene database
Search is compared, finds no any identical sequence information.
The content of the invention
The object of the present invention is to provide a kind of aptamers with tonyred specific binding, and nucleotide sequence is such as
SEQ ID NO：Shown in 1；The aptamer is single stranded DNA, is made of 84 nucleotide, topology is straight-chain；In advance
The secondary structure of survey has prominent ring and stem, and there are tetra- stranded structures of G-, Gibbs free energy DG=- 14.40.
The present invention another object is that by with the aptamer that tonyred is specifically bound apply identification tonyred or
In the kit for preparing detection tonyred.
Technical scheme is as follows：
1st, tonyred specific nucleic acid aptamers（C07）Screening, clone, separation and sequencing
Using SELEX technology screenings go out can with tonyred specifically bind aptamer group, design primer into
Row PCR amplification, clone, separation and sequencing.Utilize enzyme-linked oligonucleotides adsorption test（ELONA）It is verified, obtains aptamers
C07, it is capable of the combination tonyred of high-affinity high specific.Ligand adapter-primer sequence is：Aptamer Fw:
GACATATTCAGTCTGACAGC；Reverse complementary sequence：CGCTGTCAGACTGAATATGTC；Aptamer Rv:
GCTAGACGATATTCGTCCATC, reverse complementary sequence：GATGGACGAATATCGTCTAGC.Obtained positive monoclonal carries out core
Nucleotide sequence measures, and sequencing result shows to be made of 84 nucleotide with the aptamer (C07) of tonyred specific binding,
Its sequence（5 ' ends to 3 ' ends）For：
tgctagacga tattcgtcca tccggcggca tccgacgctg tgaccggggc tagacccttg
cccgctgtca gactgaatat gtca；
2nd, aptamer（C07）Single stranded DNA secondary structure characterizes
Use MFOLD softwares（http://mfold.rna.albany.edu/q=mfold/DNA-Folding-Form）
Pair with tonyred specific binding aptamer C07 single strand dnas carry out secondary structure prediction, the results showed that, secondly
Level structure has prominent ring and stem, and there are tetra- stranded structures of G-, Gibbs free energy DG=- 14.40 show that the structure has
There is higher stability；Its secondary structure is as follows：
3rd, aptamer（C07）Specificity and the sensibility to tonyred
According to the sequence of aptamer C07, the aptamer marked with in-vitro transcription method synthesizing biotinylated is established
A kind of new enzyme-linked oligonucleotide detection method, by the method to the specificity of C07 and its sensibility to tonyred
It is detected；The results show that C07 has very high specificity, the minimum concentration that can detect tonyred is 4 ng/ μ L.
Meaning of the present invention is:
The ligand C07 gone out using SELEX technology screenings is capable of the identification of high-affinity high specific and with reference to tonyred；Core
Detection of the discriminating of sour aptamers C07 for remaining tonyred in food, and then reduction tonyred has the infringement of human body
Significance.
Description of the drawings
Fig. 1 is CD circular dichroism detectors in the present invention to K+The analysis of concentration and the relation of aptamer C07；
Fig. 2 is that ELONA methods analyze the specificity of aptamer C07 in the present invention, in figure：Blank control 1 is the Sudan
Red+defatted milk；Blank control 2：Tonyred+the biotin without ligand；Negative control 1 is melamine+be marked with biotin
Ligand C07；Negative control 2 is marked with the ligand C07 of biotin for α-amanita hemolysin+；Negative control 3 is glyphosate+mark
There is the ligand C07 of biotin；Negative control 4 for clenbuterol hydrochloride+be marked with biotin ligand C07；Negative control 5 is encephalitis B
The ligand C07 of NS1 albumen+be marked with biotin；Negative control 6 for encephalitis B core albumen+be marked with biotin ligand
C07；Tonyred：The ligand C07 of 40 ng/ μ L of tonyred+be marked with biotin；
Fig. 3 is that Dot Blot methods analyze the specificity of aptamer C07 in the present invention, in figure：1：Blank control（Soviet Union
Red red+defatted milk）； 2：Blank control（Tonyred+the biotin without ligand）；3：Negative control（Melamine+be marked with
The ligand C07 of biotin）；4：Negative control（α-amanita hemolysin+is marked with the ligand C07 of biotin）；5：Negative control（Grass is sweet
The ligand C07 of phosphine+be marked with biotin）；6：Negative control（The ligand C07 of clenbuterol hydrochloride+be marked with biotin）；7：Negative control
（The ligand C07 of encephalitis B NS1 albumen+be marked with biotin）；8：Negative control（Encephalitis B core albumen+be marked with life
The ligand C07 of object element）；9：The ligand C07 of 40 ng/ μ L of tonyred+be marked with biotin；
Fig. 4 is analysis of the ELONA methods to the optium concentration of aptamer C07 in the present invention, in figure：Blank control 1：Soviet Union
Red red+defatted milk；Blank control 2：Tonyred+the biotin without ligand；Ligand C07：Tonyred+be marked with biotin
Ligand C07；
Fig. 5 is analysis of the ELONA methods to tonyred sensitivity in the present invention, in figure：Blank control：Tonyred+defatted milk；
Ligand C07：The ligand C07 of tonyred+be marked with biotin.
Specific embodiment
With reference to the accompanying drawings and examples come the essentiality content further illustrated the present invention, embodiment is only for more preferably managing
The solution present invention but do not limit to and the scope of the invention, method is conventional method unless otherwise specified in embodiment, the reagent used
It is conventional commercial reagent or the reagent prepared according to a conventional method unless otherwise specified.
Embodiment 1：Tonyred aptamer（C07）Screening
First, aglucon（Tonyred）With matrix（Ago-Gel 6B）Coupling
1st, suspend the freeze-dried powder Ago-Gel 6B of 1 g in 3 mL distilled water（The powder that 1 g is freezed can produce
The final matrix volume of about 3.0 mL）；
2nd, immediately in sintered glass filter（More reciprocal of duty cycle G3）It is small with the distilled water flushing 1 every about 200 mL of gram powder
When；
3rd, with the coupling buffer solution of 6 mL（The carbonate buffer solution of 0.05 M, pH 9.6）The aglucon of 6 g is dissolved, makes it
Ultimate density is transferred to for 1 mg/mL or with desalting column by the aglucon of dissolving in coupling buffer solution, adjusts the pH of water phase
Value；
4th, ratio of the concentration in matrix and above-mentioned steps 3 for the 1 mg/mL buffer solutions for having dissolved aglucon is adjusted to
Volume ratio 1:2, under 25 DEG C to 40 DEG C of water bath condition, mix 16 h, and 37 DEG C of incubator overnights；
5th, under conditions of 40 DEG C to 50 DEG C, with the superfluous group of the ethylaminoethanol closing of 1M, at least 4 h or overnight；
6th, surplus aglucon is washed with coupling buffer, 4000 rpm centrifuge 2 min, draw supernatant；Use ultra-pure water（Each 7-
8 mL）Cleaning 3 times；And then with 0.1 M NaHCO3, the solution cleaning of 0.5 M NaCl, pH 8.0 3-4 times；Then with 0.1
M NaCl, 0.1 M acetate, the solution of pH 4.0 clean 3-4 times；Finally protected with mass percent concentration for 20% ethyl alcohol, 6 mL
It deposits, is positioned over 4 DEG C of refrigerators, sealed membrane sealing is vertical to place.
2nd, aptamer library（ssDNA）PCR
The ssDNA aptamers library synthesized using TaKaRa companies；
1st, 94 DEG C of preheating PCR instruments；
2nd, by 3 μ L ssDNA, 30.6 μ L deionized waters, 5 10 × Buffer of μ L, 3 μ L MgCl2、4 μL dNTP
Mixture（Each 2.5 μM）, 2 μ L forward directions amplimers, the reversed amplimers of 2 μ L and 0.4 μ L Taq enzymes centrifuge tube carry out it is anti-
It should.Positive amplimer sequence is 5 '-GACATATTCAGTCTGACAGC-3 ', reversed amplimer sequence for 5 '-
GCTAGACGATATTCGTCCATC-3’。
3rd, expanded in PCR instrument by following procedure
(1) pre-degeneration
94 DEG C 5 minutes；
(2) 40 Xun Huans
94 DEG C 45 seconds
58 DEG C 45 seconds
72 DEG C 30 seconds；
(3) expand afterwards
72 DEG C 7 minutes.
3rd, the purifying in ligand storehouse, loading and elution
1st, the purifying in ligand storehouse
(1) aptamer library PCR product directly with the solution in plastic recovery kit by volume 1:1 ratio is mixed
It closes, carries out DNA fragmentation recycling；
(2) after DNA fragmentation recycling, 95 DEG C of water-bath 10min, ice bath 10min；By this denaturation treatment, become double-stranded DNA
Single stranded DNA.
2nd, affinity chromatography
(1) matrix being coupled with coupling buffer elution：Upper strata alcohol is first drawn, coupling buffer is added to be mixed to 6 mL
Even, centrifugation, abandoning supernatant, this step is repeated 3 times；
(2) single stranded DNA in above-mentioned 1st step is added in the matrix being coupled, is incubated in 37 DEG C and 40 rpm are soft
Rotate 2 h；
(3) aforementioned sample is added in into chromatographic column, with the ultrapure water pillar of 2-3 column volumes；
(4) and then the elution buffer with 3-4 column volumes（0.1 M NaCl, 0.1 M acetate, pH 4.0）It carries out linear
Gradient elution collects elution fraction；
(5) elution fraction mixes in equal volume with sol solution, is dissolved after recycling with TE solution, obtains selex solution.
4th, PCR optimizations and a large amount of amplification of nucleic acid aptamers
Using above-mentioned selex solution as template, operate as follows：
1st, 94 DEG C of preheating PCR instruments；
2nd, by 5 μ L templates, 28.6 μ L deionized waters, 5 10 × Buffer of μ L, 3 μ L MgCl2, 4 μ L dNTP mix
Close object（Each 2.5uM）, 2 μ L forward directions amplimers, the reversed amplimers of 2 μ L, 0.4 μ L Taq enzymes, in PCR centrifuge tubes
It is reacted.Positive amplimer sequence is 5 '-GACATATTCAGTCTGACAGC-3 ', reversed amplimer sequence for 5 '-
GCTAGACGATATTCGTCCATC-3’。
3rd, expanded in PCR instrument by following procedure：
(1) pre-degeneration
94 DEG C 5 minutes；
(2) 37 Xun Huans：
94 DEG C 45 seconds
58 DEG C 45 seconds
72 DEG C 30 seconds；
(3) expand afterwards
72 DEG C 7 minutes；
4th, after circulation terminates, PCR products are stripped recycling with the DNA product purification kit of TIANGEN companies,
Step is as follows：
(1) by PCR product and isometric reverse mixing of film combination buffering, mixed liquor is then transferred to centrifugal purification column,
It is stored at room temperature 5 minutes, DNA is made fully to be combined with pellosil, 12000 rpm are centrifuged 1 minute, outwell the waste liquid in collecting pipe；
(2) rinsing liquid of 700 μ L is added in（Containing ethyl alcohol）In centrifugal purification column, 12000 rpm are centrifuged 1 minute, are outwelled
Waste liquid in collecting pipe；
(3) step is repeated（2）；
(4) 12000 rpm are centrifuged 3 minutes；
(5) centrifugal purification column is placed in new centrifuge tube；
(6) 30 μ L ultra-pure waters are added in, stand 5 minutes at room temperature；
(7) 12000 rpm are centrifuged 1 minute, and tube bottom solution is the PCR product of the aptamer purified.
Embodiment 2：The clone of aptamer and sequencing and the prediction of single stranded DNA secondary structure
First, the preparation of bacillus coli DH 5 alpha competent cell
1st, the single DH5 α bacterium colonies of picking are inoculated in LB culture mediums of 3 mL without ampicillin, 37 DEG C of overnight incubations,
Next day takes above-mentioned bacterium solution in proportion 1:100 are inoculated in 50 mL LB liquid mediums, when 37 DEG C of vibrations 2 are small；When OD600 values
When reaching 0.35, bacterial cultures is harvested；
2nd, bacterial cultures is transferred in the sterile polypropylene tube of a 50 mL precoolings, places 10 min on ice, make training
Support object cooling；
3rd, 4000 rpm centrifuge 10 min at 4 DEG C, discard culture solution, and pipe is inverted l min so that remaining culture
Liquid stream is use up；
4th, 0.1 mM CaCl of 150 μ L ice precoolings are respectively added2Solution merges two pipes, 10 min of ice bath；
5th, 4000 rpm centrifuge 10 min, abandoning supernatant at 4 DEG C, and pipe is inverted l min so that residual liquid
It flows to end；
6th, 0.1 M CaCl of 800 μ L ice precoolings are first added in2Cell is resuspended in solution, adds the 75% of 25 μ L precoolings
Glycerine, it is spare after -80 DEG C of storages.
2nd, connection and the conversion of connection product
1st, 0.5 μ L Takara pMD19-T simple carriers, 4.5 μ L aptamers are added in microcentrifugal tube
The ligase buffer mixture of PCR product and 5 μ L；
2nd, when 16 DEG C of reactions 3 are small；
3rd, full dose（10 μL）It adds in into 100 μ L DH5 α competent cells, is placed 30 minutes in ice；
4th, after 42 DEG C of heating 90 seconds, then placed 1 minute in ice；
5th, the LB culture mediums 890 μ L for adding in that 37 DEG C of warm bath cross, 37 DEG C of slowly vibrating cultures 60 minutes；
6th, take 200 μ L be coated on containing X-Gal, IPTG, ampicillin LB culture mediums on, 37 DEG C culture 16 it is small when
To form single bacterium colony.
3rd, the colony screening of aptamer and sequencing and single stranded DNA secondary structure prediction
The single bacterium of the above-mentioned white of picking is fallen in the LB culture mediums containing ampicillin, when 37 DEG C of slowly vibrating cultures 4 are small,
Carry out PCR amplification；Amplimer and amplification condition are the same as the amplification condition of foregoing aptamer.Positive gram will confirmed through PCR
After grand carry out plasmid extraction, nucleosides is carried out with the full-automatic nucleotide sequencing instrument of U.S. Applied Biosystems 3730A
The measure of acid sequence；Structure shows the aptamer with tonyred specific binding（It is named as C07）Its sequence is held extremely from 5 '
3 ' ends are:
tgctagacga tattcgtcca tccggcggca tccgacgctg tgaccggggc tagacccttg
cccgctgtca gactgaatat gtca
With the sequence length of the aptamer C07 of tonyred specific binding：84 bases, sequence type：Nucleic acid, chain
Number：It is single-stranded, topology：Straight-chain, sequence species：ssDNA.
It is 26 DEG C, Na by MFOLD softwares set temperature+Concentration is 150 mM, Mg2+Concentration is 1 mM（http://
mfold.rna.albany.edu/q=mfold/DNA-Folding-Form）It is mapped with QGRS（http://
bioinformatics.ramapo.edu/QGRS/analyze.php）Pair with tonyred specific binding aptamer
C07 single strand dnas carry out secondary structure prediction.The result shows that aptamers contain prominent ring and stem, Gibbs free energy
DG=- 14.40, the structure have higher stability.
Embodiment 3：Circular dichroism detector is to K+Concentration is probed into the relation of aptamer C07
1. after aptamers are diluted to 20 μM with 20 mM Tris-HCl buffer solutions (pH 7.2), in 94 DEG C of denaturation
0.5 min is cooled to 25 DEG C with the speed of 0.5 DEG C/min.
2. with the 20 mM Tris-HCl buffer solutions (pH containing various concentration (0,5,10,20,50 mM) KCl
7.2) aptamer C07 is diluted to 2.5 μM.
3. it is detected at 25 °C, 220-340 nm wavelength with circular dichroism spectrometer（The result is shown in Figure 1）, the results show core
Sour aptamers C07 has the peak value at 275nm to occur in different solutions, illustrates that the aptamer has tetra- chain of stem ring and G-
Body structure.
Embodiment 4：Aptamer（C07）Specificity and the sensibility to tonyred
First, aptamer C07 specific detections
1st, ELONA methods
It is improved on the basis of traditional ELISA method, antibody is replaced with the aptamers screened, using life
Object element-Avidin amplification system is detecting a kind of method of sample to be tested.
(1) coating of aptamers-biotin
The aptamer of the specific recognition tonyred screened is sent to the synthesis of TaKaRa companies, obtains using biotin
The aptamers of mark.First of short duration centrifugation during use, makes the aptamers of biotin labeling be gathered in test tube bottom.According to specification,
Storing solution is fully dissolved into aqua sterilisa or TE buffer (pH7.5-8.0), general concentration is 10-4Or 10-5M is placed in -20
DEG C preserve.To avoid multigelation, aliquot can be distributed into.It is dense that the aptamers of biotin labeling with 1 × PBS are diluted to work
Degree, each hole add 100 μ L, are sealed with adhesive sticker or sealed membrane, in being incubated 1-2 h on 37 DEG C, 150 rpm oscillators, have been incubated
After discard liquid in hole, add 200 μ L of cleaning solution per hole, in vibration washing 3 times on horizontal shaker, 2 min, every time will every time
It is patted dry on clean blotting paper.
(2) plus tonyred is incubated
By aptamer combination buffer and tonyred volume ratio 1:1 ratio, which is added to, is coated with biotin labeling
In the ELISA Plate of aptamers, each hole adds 100 μ L, is sealed with adhesive sticker, on 37 DEG C, 150 rpm oscillators be incubated 1-2 h,
Liquid in hole is discarded after being incubated, adds 200 μ L of cleaning solution per hole, in vibration washing 3 times on horizontal shaker, 2 min every time, together
Sample will be to pat dry on net blotting paper every time.（Control group then changes tonyred into non-target albumen, and method is same as above）.
(3) enzyme conjugate is incubated
100 μ L horseradish peroxidase conjugates are added in into per hole, is sealed with adhesive sticker, shaken in 37 DEG C, 150 rpm
It swings and 1 h is incubated on device, wash 3 times, 2 min every time.
(4) develop the color
TMB100 μ L are added in per hole, colour developing l0 min, preservation of taking pictures are protected from light in 37 DEG C.
(5) terminate
Add 25 μ L terminate liquids（2 M sulfuric acid）, and surveyed at each 450 nm of hole and inhaled with microplate reader within 10 min of reaction terminating
Shading value OD450.
The results show that aptamers C07 can and tonyred specificity combination（The result is shown in Fig. 2）.
2nd, Dot Blot methods
(1) 5 microlitres of tonyred (40 ng/ μ L) point is treated that NC films are done to circular NC films (radius 0.25cm) center
After dry, the cryopreservation tube of 2mL is placed in, while sets up blank control and negative control.
(2) 100 microlitres of confining liquids are added in, with 37 DEG C of incubation 2h.Film is washed with the PBS solution containing 0.05%Tween-20 3 times,
Each 3min.
(3) ligand that the mark prepared has is denatured 5min in 95 DEG C, is rapidly decreased to 4 DEG C.By aptamers plus
Onto the NC films prepared, after 37 DEG C are incubated 2h, film is washed 3 times with the PBS solution containing 0.05%Tween-20, each 3min.
(4) horseradish peroxidase conjugate is added on NC films, after 37 DEG C are incubated 1h, with containing 0.05%Tween-20's
PBS solution washes film 3 times, each 3min.
(5) TMB to NC films are added in, colour developing l0 min are protected from light in 37 DEG C, observe the combination situation of aptamers and tonyred,
It takes pictures preservation（The result is shown in Fig. 3）, aptamers C07 can and tonyred specificity combination.
2nd, the detection of aptamer C07 optium concentrations
1st, the aptamers of biotin labeling are diluted to different working concentrations with 1 × PBS, each hole adds 100 μ L, uses
Adhesive sticker or sealed membrane sealing, in being incubated 1-2 h on 37 DEG C, 150 rpm oscillators, discard liquid in hole, per hole after being incubated
Add 200 μ L of cleaning solution, in vibration washing 3 times on horizontal shaker, 2 min, will clap on clean blotting paper every time every time
It is dry；
2nd, by the tonyred liquor capacity of aptamers combination buffer and 40 ng/ μ L than 1:1 ratio, which is added to, is coated with life
In the ELISA Plate of the aptamers of object element mark, each hole adds 100 μ L, is sealed with adhesive sticker, on 37 DEG C, 150 rpm oscillators
1-2 h are incubated, liquid in hole is discarded after being incubated, add 200 μ L of cleaning solution per hole, in vibrating washing 3 times on horizontal shaker, often
Secondary 2 min will similarly be to pat dry on net blotting paper every time；
3rd, 100 μ L horseradish peroxidase conjugates are added in into per hole, is sealed with adhesive sticker, in 37 DEG C, 150 rpm
It is incubated 1 h on oscillator, washs 3 times, every time 2 min；
4th, TMB100 μ L are added in per hole, colour developing l0 min are protected from light in 37 DEG C；
5th, 25 μ L terminate liquids are added（2 M sulfuric acid）, and surveyed within 10 min of reaction terminating with microplate reader at each 450 nm of hole
Absorbance OD450；
6th, the result shows that, the optium concentration of aptamers C07 is 100 nM（The result is shown in Fig. 4）.
3rd, detections of the aptamer C07 to the sensitivity of tonyred
1st, the aptamers of biotin labeling are diluted to working concentration with 1 × PBS, each hole adds 100 μ L, uses adhesive sticker
Or sealed membrane sealing, in being incubated 1-2 h on 37 DEG C, 150 rpm oscillators, liquid in hole is discarded after being incubated, adds washing per hole
200 μ L of liquid, in vibration washing 3 times on horizontal shaker, 2 min, will pat dry on clean blotting paper every time every time；
2nd, by the tonyred liquor capacity of aptamers combination buffer and various concentration than 1:1 ratio, which is added to, is coated with life
In the ELISA Plate of the aptamers of object element mark, each hole adds 100 μ L, is sealed with adhesive sticker, on 37 DEG C, 150 rpm oscillators
1-2 h are incubated, liquid in hole is discarded after being incubated, add 200 μ L of cleaning solution per hole, in vibrating washing 3 times on horizontal shaker, often
Secondary 2 min will similarly be to pat dry on net blotting paper every time；
3rd, 100 μ L horseradish peroxidase conjugates are added in into per hole, is sealed with adhesive sticker, in 37 DEG C, 150 rpm
It is incubated 1 h on oscillator, washs 3 times, every time 2 min；
4th, TMB100 μ L are added in per hole, colour developing l0 min are protected from light in 37 DEG C；
5th, 25 μ L terminate liquids are added（2 M sulfuric acid）, and surveyed within 10 min of reaction terminating with microplate reader at each 450 nm of hole
Absorbance OD450；
6th, the result shows that, aptamers C07 can detect that the minimum concentration of tonyred is 4 ng/ μ L（The result is shown in Fig. 5）.
Sequence table
<110>Kunming University of Science and Technology
<120>A kind of aptamer and application with tonyred specific bond
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 84
<212> DNA
<213>Artificial sequence
<400> 1
tgctagacga tattcgtcca tccggcggca tccgacgctg tgaccggggc tagacccttg 60
cccgctgtca gactgaatat gtca 84
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
gacatattca gtctgacagc 20
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<400> 3
gctagacgat attcgtccat c 21
Claims (3)
1. a kind of aptamer with tonyred specific binding, it is characterised in that：Its nucleotide sequence such as SEQ ID NO：1
It is shown.
2. aptamer according to claim 1, it is characterised in that：Its secondary structure has prominent ring and stem, and deposits
In tetra- stranded structures of G-, Gibbs free energy DG=- 14.40.
3. aptamer described in claim 1 is preparing the reagent of identification Detection of Magdala in Food Through or is reviving in detection food is prepared
Application in red red kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510485745.6A CN105177010B (en) | 2015-08-10 | 2015-08-10 | A kind of aptamer and application with tonyred specific bond |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510485745.6A CN105177010B (en) | 2015-08-10 | 2015-08-10 | A kind of aptamer and application with tonyred specific bond |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105177010A CN105177010A (en) | 2015-12-23 |
| CN105177010B true CN105177010B (en) | 2018-05-25 |
Family
ID=54899439
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510485745.6A Active CN105177010B (en) | 2015-08-10 | 2015-08-10 | A kind of aptamer and application with tonyred specific bond |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105177010B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486119B (en) * | 2018-03-05 | 2020-10-27 | 昆明理工大学 | Aptamer RhB-F02 specifically bound with rhodamine B and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102234648A (en) * | 2011-06-09 | 2011-11-09 | 中国人民解放军第三军医大学第一附属医院 | Toxoplasma gondii antibody aptamer with specificity to toxoplasma gondii bacteria and constructed biochip |
| CN103013999A (en) * | 2012-11-22 | 2013-04-03 | 江南大学 | Oligonucleotides aptamer special for distinguishing fumonisin B1 |
-
2015
- 2015-08-10 CN CN201510485745.6A patent/CN105177010B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102234648A (en) * | 2011-06-09 | 2011-11-09 | 中国人民解放军第三军医大学第一附属医院 | Toxoplasma gondii antibody aptamer with specificity to toxoplasma gondii bacteria and constructed biochip |
| CN103013999A (en) * | 2012-11-22 | 2013-04-03 | 江南大学 | Oligonucleotides aptamer special for distinguishing fumonisin B1 |
Non-Patent Citations (2)
| Title |
|---|
| 基于核酸适配体的生物传感技术在食品安全领域中的研究进展;云雯等;《食品工业科技》;20131231;第34卷(第14期);第397页第1.2节，图1 * |
| 食品中苏丹红的检测方法研究进展;勾华等;《江苏农业科学》;20121231;第40卷(第11期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105177010A (en) | 2015-12-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5166666B2 (en) | For detecting nucleic acid by type-specific hybrid capture method | |
| Kumar et al. | Evolution of selective-sequencing approaches for virus discovery and virome analysis | |
| CN107922971A (en) | Composition and method for enriched nucleic acid colony | |
| CN105039346B (en) | A kind of aptamer and application with melamine specific bond | |
| CN101878304A (en) | Method for isolation of genomic DNA, RNA and proteins from a single sample | |
| EP2935613A1 (en) | Target capture system | |
| CN104862314B (en) | A kind of and the aptamer of α amanita hemolysin specific bonds and application | |
| CN106191311B (en) | A kind of multiple liquid phase genetic chip method and reagent of quick detection cavy LCMV, SV, PVM, Reo-3 virus | |
| JP4972104B2 (en) | Oligonucleotide microarray for pathogen identification | |
| Gilbride | Molecular methods for the detection of waterborne pathogens | |
| CN105177011B (en) | A kind of aptamer and application with clenbuterol hydrochloride specific bond | |
| CN105177009B (en) | A kind of aptamer and application with α-amanita hemolysin specific bond | |
| CN109161547A (en) | A kind of aptamer and its application in the pathogenic vibrio alginolyticus of detection | |
| CN105177010B (en) | A kind of aptamer and application with tonyred specific bond | |
| CN105039347B (en) | A kind of aptamer and application with glyphosate specific bond | |
| CN107462714A (en) | With the aptamer Sf A09 of sodium formaldehyde sulfoxylate specific bond and its application | |
| CN107505463A (en) | With the aptamer Sf B09 of sodium formaldehyde sulfoxylate specific bond and its application | |
| CN107058484A (en) | It is a kind of to detect T cell and the primer combination in B cell immune group storehouse and kit simultaneously applied to high-flux sequence | |
| CN109517823A (en) | A kind of aptamer of clostridium difficile binary toxin A chain | |
| CN108486119B (en) | Aptamer RhB-F02 specifically bound with rhodamine B and application thereof | |
| CN113549626B (en) | Aptamer Pr-A08 specifically bound with procymidone and application thereof | |
| CN105256076B (en) | The discriminating detection method and kit of eight kinds of gene hypotypes of hepatitis type B virus | |
| CN111363749B (en) | Nucleic acid aptamer for detecting Chinese softshell turtle iridovirus as well as construction method and application thereof | |
| CN111363748B (en) | Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus | |
| CN104388434B (en) | A kind of nucleic acid aptamer of combination CT-HRP method and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Han Qinqin Inventor after: Wang Ying Inventor after: Liu Li Inventor after: Xia Xueshan Inventor after: Qiao Pu Inventor after: Song Yuzhu Inventor after: Zhang Jinyang Inventor after: Chen Qiang Inventor before: Han Qinqin Inventor before: Wang Ying Inventor before: Qiao Pu Inventor before: Song Yuzhu Inventor before: Zhang Jinyang Inventor before: Chen Qiang |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |