CN108444545A - The environment network of silver ion content is detected based on aldehyde radical chip and silver nano-grain - Google Patents
The environment network of silver ion content is detected based on aldehyde radical chip and silver nano-grain Download PDFInfo
- Publication number
- CN108444545A CN108444545A CN201810567754.3A CN201810567754A CN108444545A CN 108444545 A CN108444545 A CN 108444545A CN 201810567754 A CN201810567754 A CN 201810567754A CN 108444545 A CN108444545 A CN 108444545A
- Authority
- CN
- China
- Prior art keywords
- silver
- solution
- dna
- concentration
- sensor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01D—MEASURING NOT SPECIALLY ADAPTED FOR A SPECIFIC VARIABLE; ARRANGEMENTS FOR MEASURING TWO OR MORE VARIABLES NOT COVERED IN A SINGLE OTHER SUBCLASS; TARIFF METERING APPARATUS; MEASURING OR TESTING NOT OTHERWISE PROVIDED FOR
- G01D21/00—Measuring or testing not otherwise provided for
- G01D21/02—Measuring two or more variables by means not covered by a single other subclass
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/65—Raman scattering
- G01N21/658—Raman scattering enhancement Raman, e.g. surface plasmons
Landscapes
- Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- General Physics & Mathematics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
Abstract
The invention discloses the environment networks that silver ion content is detected based on aldehyde radical chip and silver nano-grain, including host node computer (10), it is connect for wireless signal between the host node computer (10) and multiple sensors of default type；Multiple sensors of the default type are mounted in the heat distribution pipeline (3) being laid in the underground space (100) and water supply line (6) and on the side wall of the underground space；Multiple sensors of the default type are used to acquire the detection data of the corresponding underground space.The environment network disclosed by the invention that silver ion content is detected based on aldehyde radical chip and silver nano-grain, its can the environment of safe and reliable ground-to-ground down tube net carry out comprehensive monitoring, the content of silver ion is effectively detected in the water that can be especially transmitted to underground pipe network, the security risk of underground pipe network can be reduced, ensure the safe handling of underground pipe network, be conducive to widely apply, be of great practical significance.
Description
Technical field
The present invention relates to Underground Space Environment monitoring technical fields, more particularly to based on aldehyde radical chip and silver nano-grain
Detect the environment network of silver ion content.
Background technology
Currently, underground pipe network is the most important thing in Chinese Urbanization construction process, it is to play city function, it is ensured that city
Economy, Community health, coordinated development important substance basis, be presented intricate, mutually overlapping stereoscopic features, city
Lower pipe network is the important component of urban infrastructure construction, be a city energy conveying, mass transfer, information transmit,
The important carrier that water drainage mitigation and waste dump.
Currently, when the environment water in underground pipe network is contaminated, it is easy to dramatically increase containing for the silver ion in water body
Amount.Silver ion is extremely toxic substance, and the toxic action having includes mainly：(1) make the protein of human body and various enzyme denaturations.
(2) the internal silver ion of entrance is more than 0.8g will cause the silver-colored spot of blue to precipitate on the skin.Since silver ion has very by force
Oxidisability, so can also cause the symptoms such as internal organs oedema into the silver ion in human body.Causing death when serious.Human body
Without effectively arranging silver-colored mechanism.So once intake silver ion is just mainly accumulated in bone and liver.And silver ion poisoning does not have
There is effective antidote.Thus, the silver ion content in natural water is the most important thing in environment measuring control, to ensure people
Class health, there is an urgent need to develop quick, sensitive, selected method to detect silver ion.
But China has quite a few city not carry out unified allocation plan and management, underground to underground pipe network
The management work of pipe network does things in his own way, lacks link up mutually, unordered controlled state is in, compared with urban construction speed.Pipe
Reason is serious to fall behind, and accident is frequent occurrence.Cut off the water caused by accident, have a power failure, stopping the supple of gas or steam, the consequences such as communicating interrupt, fire explosion, no
Only highly impact the quality of life and life security of the people, at the same also influence economic construction and national defense construction it is normal into
Row.
For current underground pipe network, the problem of being primarily present, is：It, can not since the space structure of underground pipe network is complicated
Comprehensive monitoring carried out to the environment of underground pipe network, in the water that can not be especially transmitted to underground pipe network the content of silver ion into
Row effectively detection ensures the safe handling of underground pipe network to reduce the security risk of underground pipe network.
Therefore, at present there is an urgent need to develop going out a kind of technology, can the environment of safe and reliable ground-to-ground down tube net carry out
Comprehensive monitoring especially can effectively detect the content of silver ion in the water of underground pipe network transmission, can be reduced
The security risk of underground pipe network ensures the safe handling of underground pipe network.
Invention content
In view of this, the object of the present invention is to provide the rings for detecting silver ion content based on aldehyde radical chip and silver nano-grain
Border network, can the environment of safe and reliable ground-to-ground down tube net carry out comprehensive monitoring, especially can be to underground pipe network
The content of silver ion is effectively detected in the water of transmission, can be reduced the security risk of underground pipe network, be ensured underground pipe network
Safe handling, is conducive to widely apply, be of great practical significance.
For this purpose, the present invention provides the environment network for detecting silver ion content based on aldehyde radical chip and silver nano-grain, packet
Host node computer is included, is connected for wireless signal between the host node computer and multiple sensors of default type；
Multiple sensors of the default type be mounted on the underground space in be laid with heat distribution pipeline and water supply line in
And on the side wall of the underground space；
Multiple sensors of the default type are used to acquire the detection data of the corresponding underground space.
Wherein, multiple sensors of the default type include：First temperature sensor, second flow sensor and surface
Enhance Raman SERS water quality sensors；
First temperature sensor, second flow sensor and surface-enhanced Raman SERS water quality sensors are mounted on institute
It states in water supply line, for detecting the temperature of water, flow and silver ion content in the water supply line, is then sent to main section
Point computer.
Wherein, multiple sensors of the default type further include：First pressure sensor, first flow sensor and
Two temperature sensors；
The first pressure sensor, first flow sensor and second temperature sensor are mounted on the heat distribution pipeline
In, pressure, flow and temperature for detecting institute's transmission medium in the heat distribution pipeline are then sent to host node computer.
Wherein, multiple sensors of the default type further include：Oxygen sensor, carbon monoxide transducer, hydrogen sulfide
Sensor, Temperature Humidity Sensor and NOx sensor；
The oxygen sensor, carbon monoxide transducer, hydrogen sulfide sensor, Temperature Humidity Sensor and nitrogen oxides sensing
Device is separately mounted on the side wall of the underground space, dense for collecting the oxygen gas concentration in the underground space, CO gas
Degree, sulfureted hydrogen gas concentration, temperature, humidity and nitrous oxides concentration are then sent to host node computer.
Wherein, further include：First monitoring camera and the second monitoring camera；
First monitoring camera is located at the upper right side of the second monitoring camera；
First monitoring camera and the second monitoring camera are mounted on the side wall of the underground space, are respectively used to acquire
The image of institute overlay area, is then sent to host node computer.
Wherein, the host node computer, including：Data memory module, data processing module and wireless data transmission mould
Block, wherein：
Data memory module, the detection data of the underground space for acquiring multiple sensors of the default type,
It is stored in real time；
Data processing module is connected with data memory module, for acquiring multiple sensors of the default type
The underground space detection data, be compared respectively with preset, corresponding normal value range, if positioned at it is preset,
Within corresponding normal value range, then corresponding data qualifier is judged, otherwise, then judge corresponding defect of data, meanwhile,
Comparable situation is sent to the computer of ground base station by wireless data transfer module in real time；
Data processing module is additionally operable to, by first monitoring camera and the second monitoring camera acquired image, lead to
Cross the computer that wireless data transfer module is sent to ground base station.
Wherein, further include：Crusing robot, the ground that the crusing robot is arranged between heat distribution pipeline and water supply line
On face.
Wherein, the surface-enhanced Raman SERS water quality sensors include kit and detection switch, wherein：
Detection switch is mounted on the water supply line；
The kit is located at the lower section of detection switch, and the top of the kit has multiple holes；
Inserted with surface-enhanced Raman SERS chips in the kit, the surface-enhanced Raman SERS chips include two
Silicon chip is aoxidized, multiple silver nano-grains modified by DNA and 2- thionaphthols are arranged at intervals in the silicon dioxide substrates
Distributed areas；
The surface spraying of the silicon dioxide substrates has silver nanoparticle film, and DNA is coated on the silver nanoparticle film；
Each silver nano-grain distributed areas by the modification of DNA and 2- thionaphthols are correspondingly arranged and are connected with a hole
It is logical；
The kit is arranged above a fibre-optical probe, the fibre-optical probe by an optical fiber and one just
The formula Raman detector of taking is connected；
It is provided with antenna in the portable Raman detector.
Wherein, prepare has the silica that DNA is also coated on silver nanoparticle film and silver nanoparticle film in surface spraying
Substrate, specific preparation process include the following steps：
First, it using the sheet glass of pre-set dimension as substrate, is impregnated 30 minutes in Piranha solution, makes its surface hydroxyl
Change.Volume ratio in Piranha solution between sulfuric acid and hydrogen peroxide is 7：3；
Then, by surface hydroxylation, substrate rich in hydroxyl immerse the 3- aminopropyl trimethoxies containing 5% mass solubility
In the methanol solution of radical siloxane APTMS, 12h is reacted at room temperature；
Then, continue to dip the substrate into the glutaraldehyde solution 4 hours that mass concentration is 2.5% so that glutaraldehyde solution with
Amino reaction occurs for the APTMS of substrate surface modification, generates aldehyde radical surface；
Then, it cleans the substrate of substrate with ultra-pure water and is dried with nitrogen stream.Then by the DNA of 5 terminal modified amino
(CCCCCACCTCCCACCCACC) it on the substrate surface after solution paint point to processing, reacts 4 hours at room temperature；
It is cleaned with the phosphate buffer solution solution of a concentration of 0.1M of molal volume and cleaning removing three times is carried out wherein to substrate
The DNA chain of non-specific binding；
Finally, the bovine serum albumin solution for being 2.5% with mass concentration wraps up on spot and blocking dna on DNA
Then active site is cleaned with ultra-pure water, drying box is used in combination to dry, and final acquisition surface spraying has silver nanoparticle film and silver is received
The silicon dioxide substrates of DNA are also coated on rice film.
Wherein, the preparation of the surface-enhanced Raman SERS chips includes the following steps：
The first step, by the citric acid three of the silver nitrate solution of a concentration of 1mM of molal volume and a concentration of 40nM of molal volume
Sodium solution mixing is put into container, and with vigorous stirring, the sodium borohydride solution of a concentration of 112mM of molal volume is added dropwise
Enter, mixed solution gradually becomes khaki from transparent, obtains silver colloidal solution, wherein silver nitrate solution, citric acid three sodium solution
Volume ratio is 50 between sodium borohydride solution:4:1；
Second step, the silver colloidal solution aging 24 hours by acquisition, make the sodium borohydride in silver colloidal solution decompose；
Third walks：The 2- thionaphthols of a concentration of 0.01mM of molal volume are added to silver colloidal solution and are mixed, wherein 2- naphthalenes
The volume ratio of thiophenol and silver colloidal solution is：1:100, it is then gently mixed 10 minutes, obtains the silver nanoparticle of 2- thionaphthols label
Particle separating liquid；
4th step：The Nano silver grain separating liquid that 2- thionaphthols are marked turns according to the speed centrifugation of 8000 rev/min
It is 10 minutes dynamic, supernatant is removed, then suspended with the phosphate buffer of a concentration of 10mM of molal volume, the elargol after being suspended
Liquid solution, wherein the volume ratio of phosphate buffer and gold and silver colloidal solution is 1：1；
Preset DNA solution is added in the silver colloidal solution after suspending 5th step, reacts 12 hours, is then added
The sodium chloride solution salinization of a concentration of 0.1M of molal volume 30 minutes, then be placed in 4 degrees Celsius of temperature and continue salinization 6 hours,
Obtain mixture, wherein the volume ratio of 2- thionaphthols and sodium chloride solution is 1:2；
6th step centrifuges mixture 30 minutes under 8000 rpms of rotating speed, removes supernatant, is subsequently placed in and rubs
It suspends in the phosphate buffer that your volumetric concentration is 10mM, the silver nano-grain obtained by the modification of DNA and 2- thionaphthols is molten
Liquid；
7th step will be coated in silicon dioxide substrates by the silver nano-grain of DNA and 2- thionaphthols modification, then be placed in
It is dried in drying box, finally forms the silver nano-grain point by the modification of DNA and 2- thionaphthols in silicon dioxide substrates
Cloth region prepares surface-enhanced Raman SERS chips；
Wherein, in the 5th step, the specific preparation process of the preset DNA solution is as follows：
By the 5 of a concentration of 100uM of molal volume terminal modified sulfydryl DNA (CCCCCACCTCCCTCCCACCT) solution with mole
Three (2- carboxyethyls) phosphonium salt acid salt solutions that volumetric concentration is 10mM mix, wherein DNA solution and three (2- carboxyethyls) phosphonium salts acid
The volume ratio of salting liquid is 20:3, and the volume ratio of DNA solution and the 2- thionaphthols in third step is 1:1, room temperature, which is stood, lives
Change 1 hour, obtains preset DNA solution.
By the above technical solution provided by the invention as it can be seen that compared with prior art, the present invention provides based on aldehyde radical
Chip and silver nano-grain detection silver ion content environment network, can safe and reliable ground-to-ground down tube net environment into
The comprehensive monitoring of row especially can effectively detect the content of silver ion in the water of underground pipe network transmission, can be subtracted
The security risk of few underground pipe network, ensures the safe handling of underground pipe network, is conducive to widely apply, and has great production real
Trample meaning.
Description of the drawings
Fig. 1 is the knot of the environment network provided by the invention that silver ion content is detected based on aldehyde radical chip and silver nano-grain
Structure schematic diagram；
Fig. 2 is that the environment network provided by the invention that silver ion content is detected based on aldehyde radical chip and silver nano-grain is based on
The data transmission schematic diagram that purple honeybee ZigBee wireless communication techniques are formed；
Fig. 3 is that silver-based provided by the invention is detected in aldehyde radical chip and silver nano-grain in the environment network of silver ion content
The cooperating state simplified schematic diagram of surface-enhanced Raman (SERS) water quality sensor and water supply line；
Fig. 4 is table in the environment network provided by the invention for detecting silver ion content based on aldehyde radical chip and silver nano-grain
Face enhances the structure schematic diagram of Raman (SERS) chip；
Fig. 5 is silver in the environment network provided by the invention for detecting silver ion content based on aldehyde radical chip and silver nano-grain
Attachment structure schematic diagram between nano particle and DNA chain；
Fig. 6 is table in the environment network provided by the invention for detecting silver ion content based on aldehyde radical chip and silver nano-grain
The Raman signal schematic diagram that face enhancing Raman (SERS) chip obtains when being detected to liquid；
In figure, 1 is the first monitoring camera；2 be the second monitoring camera；3 be heat distribution pipeline；4 sense for first pressure
Device；5 be the first temperature sensor；6 be water supply line；7 be crusing robot；8 be first flow sensor；9 be second flow
Sensor；10 be main node computer；11 be second temperature sensor；12 be surface-enhanced Raman (SERS) water quality sensor；
13 be oxygen sensor；14 be carbon monoxide transducer；15 be hydrogen sulfide sensor；16 be Temperature Humidity Sensor；17 be nitrogen oxygen
Compound sensor；
18 be detection switch；19 be surface-enhanced Raman (SERS) chip；20 be kit；21 be portable Raman detection
Instrument；22 be antenna；23 be fibre-optical probe；24 be the silver nano-grain distributed areas modified by DNA and 2- thionaphthols；25 be two
Aoxidize silicon chip；26 be silver nano-grain；27 be DNA chain.
Specific implementation mode
In order to make those skilled in the art understand the present invention program with replacing, below in conjunction with the accompanying drawings with embodiment to this
Invention is described in further detail.
Referring to Fig. 1 to Fig. 6, the present invention provides the environment that silver ion content is detected based on aldehyde radical chip and silver nano-grain
Network, including host node computer 10, the host node computer 10 and multiple sensors of default type (are used as partial node
Point) between for wireless signal (especially by purple honeybee ZigBee wireless communication techniques) connect；
Multiple sensors of the default type are mounted on the heating power being laid in the underground space 100 (i.e. underground pipe network space)
In pipeline 3 and water supply line 6 and on the side wall of the underground space；
Multiple sensors of the default type are used to acquire the detection data of the corresponding underground space, for example, temperature passes
Sensor is used to detect the temperature data of institute's installation site.
In the present invention, in specific implementation, multiple sensors of the default type include：First temperature sensor 5,
Two flow sensors 9 and surface-enhanced Raman SERS water quality sensors 12；
First temperature sensor 5, second flow sensor 9 and surface-enhanced Raman SERS water quality sensors 12 are installed
In the water supply line 6, for detecting the temperature of water, flow and silver ion content in the water supply line 6, then send
Give host node computer 10 (especially by purple honeybee ZigBee wireless communication techniques).
In the present invention, in specific implementation, multiple sensors of the default type further include：First pressure sensor 4,
First flow sensor 8 and second temperature sensor 11；
The first pressure sensor 4, first flow sensor 8 and second temperature sensor 11 are mounted on the thermal pipe
In road 3, pressure, flow and temperature for detecting institute's transmission medium (such as hot water or steam) in the heat distribution pipeline 3, so
After be sent to host node computer 10 (especially by purple honeybee ZigBee wireless communication techniques, such as ZigBee ad hoc network).
It should be noted that heat distribution pipeline is the transmission pipeline of high-temperature gas or high-temp liquid, for example, it is warm in city
Feed channel.
In the present invention, in specific implementation, multiple sensors of the default type further include：Oxygen sensor 13, one
Aoxidize carbon sensor 14, hydrogen sulfide sensor 15, Temperature Humidity Sensor 16 and NOx sensor 17；
The oxygen sensor 13, carbon monoxide transducer 14, hydrogen sulfide sensor 15, Temperature Humidity Sensor 16 and nitrogen oxygen
Compound sensor 17 is separately mounted on the side wall of the underground space, is collected for the integrated environment information to the underground space,
Specifically for collecting the oxygen gas concentration in the underground space, carbon monoxide gas concentration, sulfureted hydrogen gas concentration, temperature, wet
Degree and nitrous oxides concentration, are then sent to host node computer 10 (especially by purple honeybee ZigBee wireless communication techniques, such as
ZigBee ad hoc network).
In the present invention, in specific implementation, Underground Space Environment provided by the invention monitors network, further includes：First prison
Control camera 1 and the second monitoring camera 2；
First monitoring camera is located at the upper right side of the second monitoring camera 2；
First monitoring camera, 1 and second monitoring camera 2 is mounted on the side wall of the underground space, is respectively used to adopt
The image for collecting institute overlay area, is then sent to host node computer 10 (especially by purple honeybee ZigBee wireless communication techniques, such as
ZigBee ad hoc network), institute overlay area is monitored in real time to realize.
In specific implementation, first monitoring camera, 1 and second monitoring camera 2 can be monitoring gunlock.
It should be noted that specific implementation on, first monitoring camera 1 can be with 15 meters of pipe network entrance located underground at
Furred ceiling supports 360 degree of infrared real time monitoring.Side wall at 18 meters of second monitoring camera, 2 pipe network entrance located underground,
Institute overlay area can be monitored in real time.
It should be noted that for the present invention, in multiple sensors of the default type, each sensor includes
Power supply module, central control module, environment acquisition module and wireless communication module.
For the present invention, the host node computer 10, including：Data memory module, data processing module and without line number
According to transmission module, wherein：
Data memory module, the underground for acquiring multiple sensors (i.e. as minor node) of the default type are empty
Between detection data, stored in real time, to form database；
Data processing module is connected with data memory module, for (making multiple sensors of the default type
For minor node) detection data of the underground space of acquisition, it is (such as preset with preset, corresponding normal value range respectively
Temperature value range, preset humidity range) be compared, if positioned at preset, corresponding normal value range it
It is interior, then judge corresponding data qualifier, otherwise, then judges corresponding defect of data, meanwhile, comparable situation is passed through into nothing in real time
Line data transmission module is sent to the computer of ground base station so that the staff on ground is recognized that the underground space
Every environmental parameter situation, obtains the environmental information of the underground space, realizes the real time monitoring of underground pipe network.In addition, data processing
Module is additionally operable to, by 1 and second monitoring camera of the first monitoring camera, 2 acquired image, pass through wireless data transmission
Module is sent to the computer of ground base station.
For the present invention, in order to which more preferably ground-to-ground down space is monitored, Underground Space Environment network provided by the invention
Further include：Crusing robot 7, the crusing robot 7 are arranged on the ground between heat distribution pipeline 3 and water supply line 6.
It should be noted that the crusing robot 7 is mainly used for carrying out the security information monitoring of underground utilities, collect ground
The security information of underground pipelines.The bottom of the crusing robot has wheel, can be equipped with infrared thermography, visible thereon
Light video camera head and laser navigation module (existing laser navigation module)；
Wherein, by infrared thermography, temperature change can be detected, so as to monitor heat distribution pipeline 3 in real time and supply
The leakage problem of the underground utilities such as waterpipe 6；
Visible image capturing head monitors in real time for the image to the underground space, for ensureing that pipeline performance has safely
Important role.
Laser navigation module, the route planning for ensureing crusing robot 7 and intelligent detecting.
It should be noted that the crusing robot 7 is used to move and carry out the agent structure of environmental monitoring, it is existing
The structure of crusing robot is not unfolded to describe herein herein similarly to the prior art.
In specific implementation, the data memory module, data processing module and wireless data transfer module are located at host node
The lower part of computer 10.
It should be noted that for the present invention, the data of all minor nodes can be transmitted to master by zigbee network
In node computer, data are collected, handle, compare and are retrieved by each data module of host node computer, most
The environmental information that will be obtained afterwards can be transferred out by zigbee wireless communication modules.Acquired by the data of whole system,
Storage, processing and transmission, realize the comprehensive utilization of underground pipe gallery information, are carried for the overall planning and integrated dispatch of the underground space
For strong data supporting.
As shown in figure 3, for the present invention, surface-enhanced Raman (SERS) water quality sensor 12 includes 20 He of kit
Detection switch 18, wherein：
Detection switch 18 is mounted on the water supply line 6；It is specifically as follows an electromagnetic switch valve；
The kit 20 is located at the lower section of detection switch 18, and the top of the kit 20 has multiple holes；
Inserted with surface-enhanced Raman (SERS) chip 19, surface-enhanced Raman (SERS) core in the kit 20
Piece 19 includes silicon dioxide substrates 25, and multiple DNA and 2- thionaphthols that pass through are arranged at intervals in the silicon dioxide substrates 25 and are repaiied
The silver nano-grain distributed areas 24 of decorations；
The surface spraying of the silicon dioxide substrates 25 has silver nanoparticle film, is coated on the silver nanoparticle film (specific
For：Coated by point) DNA；
Each silver nano-grain distributed areas 24 by the modification of DNA and 2- thionaphthols are correspondingly arranged with a hole and phase
Connection, can be connected to the liquid flowed into from hole；
The kit 20 is arranged above a fibre-optical probe 23, the fibre-optical probe 23 by an optical fiber with
One portable Raman detector 21 is connected；
Antenna 22 (being specifically as follows purple honeybee ZigBee antennas) is provided in the portable Raman detector 21.
In specific implementation, the portable Raman detector 21 can be a kind of existing portable Raman detector.Example
Such as, may refer to it is application No. is CN201621206981.6, in the Chinese utility model patent Shen that on November 9th, 2016 announces
Please《A kind of portable multi-function Raman detector》The portable Raman detector that prospectus is recorded.
Therefore, for the present invention, due to installing detection switch 18 below water supply line 6, when starting detection, inspection is opened
Slowdown monitoring switch 18 will instill in the SERS detection chips 19 in kit 20 from the dropping liquid drop that water supply line 6 flows out, to occur
Reaction, different pollutant monitorings will be instilled in different holes and are detected.The laser that fibre-optical probe 23 can send out 532nm carries out
Raman detection is simultaneously handled in portable Raman detector 21, finally by 21 detected water of portable Raman detector
Middle silver ion content data radio to host node computer 10 by antenna 22.
For the present invention, it should be noted that surface-enhanced Raman (SERS) water quality sensor 12 is mainly used in water silver-colored
The detection of ion, the principle utilized, which is silver ion, to form " C-Ag with the C bases in DNA2+- C " structures, it is indirect by SERS
Detect the presence of silver ion.
(it is specially to prepare to have also to be coated on silver nanoparticle film and silver nanoparticle film in surface spraying：By spot printing
On) silicon dioxide substrates 25 of DNA, specific preparation process includes the following steps：
First, using the sheet glass of pre-set dimension as substrate, in the Piranha solution (body wherein between sulfuric acid and hydrogen peroxide
Product is than being 7：3) it is impregnated 30 minutes in, makes its surface hydroxylation；
Then, by surface hydroxylation, substrate rich in hydroxyl immerse the 3- aminopropyl trimethoxies containing 5% mass solubility
In the methanol solution of radical siloxane (APTMS), 12h is reacted at room temperature；
Then, continue to dip the substrate into the glutaraldehyde solution 4 hours that mass concentration is 2.5% so that glutaraldehyde solution with
Amino reaction occurs for the APTMS of substrate surface modification, generates aldehyde radical surface；
Then, it cleans the substrate of substrate with ultra-pure water and is dried with nitrogen stream.Then by the DNA (DNA of 5 terminal modified amino
Sequence is：CCCCCACCTCCCACCCACC it) on the substrate surface after solution paint point to processing, reacts 4 hours at room temperature；
It is cleaned with phosphate buffer solution (PBS) solution of a concentration of 0.1M of molal volume and cleaning removing three times is carried out to substrate
The wherein DNA chain of non-specific binding；
Finally, bovine serum albumin(BSA) (BSA) solution for being 2.5% with mass concentration wraps up spot and blocking dna on DNA
On active site, then clean with ultra-pure water (also known as UP water), drying box is used in combination to dry, final acquisition surface spraying has Yin Na
It is also coated on rice film and silver nanoparticle film and (is specially：Coated by point) silicon dioxide substrates 25 of DNA.At this time, may be used
To continue to preserve to spare in 4 degree of environment.
In order to form the silver nano-grain distributed areas by the modification of DNA and 2- thionaphthols in silicon dioxide substrates 25
24, surface-enhanced Raman (SERS) chip 19 is prepared, the modified by silver nanoparticles process specifically carried out includes the following steps：
The first step, by the citric acid three of the silver nitrate solution of a concentration of 1mM of molal volume and a concentration of 40nM of molal volume
Sodium solution mixing is put into container, and with vigorous stirring, the sodium borohydride solution of a concentration of 112mM of molal volume is added dropwise
Enter, mixed solution gradually becomes khaki from transparent, illustrates to generate Nano silver grain, obtains silver colloidal solution, wherein nitric acid
Volume ratio is 50 between silver-colored solution, citric acid three sodium solution and sodium borohydride solution:4:1；
Before the first step, it may be implemented to needing container to be used to handle, specially：Take the conical flask of 100mL
It is first washed with water totally, is dried for standby with being cleaned after chloroazotic acid soaked overnight.
In specific implementation, when silver nitrate solution is 20mL, corresponding citric acid three sodium solution is 1.6mL, corresponding boron
Sodium hydride solution is 0.4mL, and the diameter of the corresponding silver colloidal solution obtained can be 30nm.
Second step, the silver colloidal solution aging 24 hours by acquisition, make the sodium borohydride in silver colloidal solution decompose；At this moment
It waits, can also be placed under 4 degrees Celsius of environment and save backup.
Third walks：The 2- thionaphthols (2NT) of a concentration of 0.01mM of molal volume are added to silver colloidal solution and are mixed,
In, 2- thionaphthols (2NT) and the volume ratio of silver colloidal solution are：1:100, it is then gently mixed 10 minutes, obtains 2- thionaphthols
The Nano silver grain separating liquid of label；
In specific implementation, when 2- thionaphthols (2NT) are 10uL, corresponding silver colloidal solution is 1mL.
4th step：The Nano silver grain separating liquid that 2- thionaphthols are marked turns according to the speed centrifugation of 8000 rev/min
It is 10 minutes dynamic, supernatant is removed, then suspended with the phosphate buffer (i.e. PBS, pH value 7) of a concentration of 10mM of molal volume,
Silver colloidal solution after being suspended, wherein the volume ratio of phosphate buffer and gold and silver colloidal solution is 1：1；
In specific implementation, when gold and silver colloidal solution is 1mL, selected phosphate buffer is also 1mL.
Preset DNA solution is added in the silver colloidal solution after suspending 5th step, reacts 12 hours, is then added
The sodium chloride solution salinization of a concentration of 0.1M of molal volume (i.e. mole every liter) 30 minutes, then it is placed in 4 degrees Celsius of temperature relaying
Continuous salinization 6 hours, obtains mixture, wherein the volume ratio of 2- thionaphthols (2NT) and sodium chloride solution is 1:2；
In the 5th step, in specific implementation, when the volume of the 2- thionaphthols (2NT) is 10uL, sodium chloride solution
Volume is 20uL.
In specific implementation, the specific preparation process of the preset DNA solution is as follows：
By the 5 of a concentration of 100uM of molal volume terminal modified sulfydryl DNA, (DNA sequence dna is：CCCCCACCTCCCTCCCACCT)
Solution is mixed with three (2- carboxyethyls) phosphonium salt hydrochlorate (TCEP) solution of a concentration of 10mM of molal volume, wherein DNA solution and three
The volume ratio of (2- carboxyethyls) phosphonium salt hydrochlorate (TCEP) solution is 20:3, and DNA solution and the 2- thionaphthols in third step
The volume ratio of (2NT) is 1:1, then room temperature, which is stood, activates 1 hour, obtains preset DNA solution.For example, when DNA solution is
When 10uL, three (2- carboxyethyls) phosphonium salt hydrochlorate (TCEP) solution are 1.5uL.
6th step centrifuges mixture 30 minutes under 8000 rpms of rotating speed, removes supernatant, is subsequently placed in and rubs
It suspends in the phosphate buffer (pH value 7) that your volumetric concentration is 10mM, obtains the Yin Na by the modification of DNA and 2- thionaphthols
Rice grain solution；
7th step will be coated in silicon dioxide substrates by the silver nano-grain of DNA and 2- thionaphthols modification, then be placed in
It is dried in drying box, finally forms the silver nano-grain by the modification of DNA and 2- thionaphthols in silicon dioxide substrates 25
Distributed areas 24 prepare surface-enhanced Raman (SERS) chip 19.
As shown in figure 5, being prepared by the above method, any one silver nano-grain 26 passes through 27, CHO acid of DNA chain
Base is closely joined together with silicon dioxide substrates 25, and the surface spraying of the silicon dioxide substrates 25 has silver nanoparticle film, described
It is coated on silver nanoparticle film and (is specially：Coated by point) DNA.
As shown in fig. 6, abscissa is Raman shift, wave-number difference of the light relative to incident light is exactly scattered, ordinate is light
Sub-count exactly scatters the intensity of light.In the presence of having silver ion in the drop instilled, silver nano-grain passes through " C-Ag2+-
Silver nano-grain is adsorbed onto SERS chip surfaces by C " structures, generates strong Raman signal, and characteristic peak is predominantly located at
1380cm-1Place, obtains concentration of silver ions, and transmit a signal to host node computer 10 and handled by the power of signal.
The present invention is based on " C-Ag2+A kind of structure of innovation of-C " structure designs, by the SERS effects of silver nano-grain, realize silver from
The microscratch detection of son, and there is real-time and original position, it is suitable for the real-time monitoring of groundwater supply pipeline, therefore energy of the present invention
Enough push the development of underground space infomation detection.
In conclusion compared with prior art, it is provided by the invention based on aldehyde radical chip and silver nano-grain detection silver
The environment network of ion concentration, can the environment of safe and reliable ground-to-ground down tube net carry out comprehensive monitoring, especially can
The content of silver ion is effectively detected in the enough water transmitted to underground pipe network, can reduce the security risk of underground pipe network, is protected
The safe handling for demonstrate,proving underground pipe network, is conducive to widely apply, be of great practical significance.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Claims (10)
1. detecting the environment network of silver ion content based on aldehyde radical chip and silver nano-grain, which is characterized in that including host node
Computer (10) is connect between the host node computer (10) and multiple sensors of default type for wireless signal；
Multiple sensors of the default type are mounted on the heat distribution pipeline (3) and water supply line being laid in the underground space (100)
(6) in and on the side wall of the underground space；
Multiple sensors of the default type are used to acquire the detection data of the corresponding underground space.
2. environment network as described in claim 1, which is characterized in that multiple sensors of the default type include：First
Temperature sensor (5), second flow sensor (9) and surface-enhanced Raman SERS water quality sensors (12)；
First temperature sensor (5), second flow sensor (9) and surface-enhanced Raman SERS water quality sensors (12) peace
In the water supply line (6), temperature, flow and silver ion content for detecting water in the water supply line (6), so
After be sent to host node computer (10).
3. environment network as claimed in claim 2, which is characterized in that multiple sensors of the default type further include：The
One pressure sensor (4), first flow sensor (8) and second temperature sensor (11)；
The first pressure sensor (4), first flow sensor (8) and second temperature sensor (11) are mounted on the heating power
In pipeline (3), pressure, flow and temperature for detecting institute's transmission medium in the heat distribution pipeline (3) are then sent to main section
Point computer (10).
4. environment network as claimed in claim 3, which is characterized in that multiple sensors of the default type further include：Oxygen
Gas sensor (13), carbon monoxide transducer (14), hydrogen sulfide sensor (15), Temperature Humidity Sensor (16) and nitrogen oxides pass
Sensor (17)；
The oxygen sensor (13), carbon monoxide transducer (14), hydrogen sulfide sensor (15), Temperature Humidity Sensor (16) and
NOx sensor (17) is separately mounted on the side wall of the underground space, dense for collecting the oxygen gas in the underground space
Degree, carbon monoxide gas concentration, sulfureted hydrogen gas concentration, temperature, humidity and nitrous oxides concentration, are then sent to host node
Computer (10).
5. environment network as claimed in claim 4, which is characterized in that further include：First monitoring camera (1) and the second monitoring
Camera (2)；
First monitoring camera is located at the upper right side of the second monitoring camera (2)；
First monitoring camera (1) and the second monitoring camera (2) are mounted on the side wall of the underground space, are respectively used to adopt
The image for collecting institute overlay area, is then sent to host node computer (10).
6. environment network as claimed in claim 5, which is characterized in that the host node computer (10), including：Data store
Module, data processing module and wireless data transfer module, wherein：
Data memory module, the detection data of the underground space for acquiring multiple sensors of the default type, in real time
It is stored；
Data processing module, with data memory module) it is connected, the ground for acquiring multiple sensors of the default type
The detection data of down space is compared with preset, corresponding normal value range respectively, if positioned at preset, corresponding
Normal value range within, then judge corresponding data qualifier, otherwise, then judge corresponding defect of data, meanwhile, in real time
Comparable situation is sent to the computer of ground base station by wireless data transfer module；
Data processing module is additionally operable to first monitoring camera (1) and the second monitoring camera (2) acquired image,
The computer of ground base station is sent to by wireless data transfer module.
7. such as environment network according to any one of claims 1 to 6, which is characterized in that further include：Crusing robot (7), institute
It states on the ground that crusing robot (7) is arranged between heat distribution pipeline (3) and water supply line (6).
8. environment network as claimed in claim 2, which is characterized in that the surface-enhanced Raman SERS water quality sensors (12)
Including kit (20) and detection switch (18), wherein：
Detection switch (18) is mounted on the water supply line (6)；
The kit (20) is located at the lower section of detection switch (18), and the top of the kit (20) has multiple holes；
Inserted with surface-enhanced Raman SERS chips (19), the surface-enhanced Raman SERS chips in the kit (20)
(19) include silicon dioxide substrates (25), be arranged at intervals on the silicon dioxide substrates (25) multiple by DNA and 2- naphthalene sulphur
The silver nano-grain distributed areas (24) of phenol modification；
The surface spraying of the silicon dioxide substrates (25) has silver nanoparticle film, and DNA is coated on the silver nanoparticle film；
Each silver nano-grain distributed areas (24) by the modification of DNA and 2- thionaphthols are correspondingly arranged and are connected with a hole
It is logical；
The kit (20) is arranged above a fibre-optical probe (23), and the fibre-optical probe (23) passes through an optical fiber
It is connected with a portable Raman detector (21)；
It is provided with antenna (22) on the portable Raman detector (21).
9. environment network as claimed in claim 8, which is characterized in that preparation has silver nanoparticle film in surface spraying and silver is received
The silicon dioxide substrates of DNA are also coated on rice film, specific preparation process includes the following steps：
First, it using the sheet glass of pre-set dimension as substrate, is impregnated 30 minutes in Piranha solution, makes its surface hydroxylation.
Volume ratio in Piranha solution between sulfuric acid and hydrogen peroxide is 7：3；
Then, by surface hydroxylation, substrate rich in hydroxyl immerse the 3- aminopropyl trimethoxy silicon containing 5% mass solubility
In the methanol solution of oxygen alkane APTMS, 12h is reacted at room temperature；
Then, continue to dip the substrate into the glutaraldehyde solution 4 hours that mass concentration is 2.5% so that glutaraldehyde solution and substrate
Amino reaction occurs for the APTMS of surface modification, generates aldehyde radical surface；
Then, it cleans the substrate of substrate with ultra-pure water and is dried with nitrogen stream.Then by the DNA of 5 terminal modified amino
(CCCCCACCTCCCACCCACC) it on the substrate surface after solution paint point to processing, reacts 4 hours at room temperature；
It is cleaned with the phosphate buffer solution solution of a concentration of 0.1M of molal volume and the wherein non-spy of cleaning removing three times is carried out to substrate
The DNA chain that the opposite sex combines；
Finally, the bovine serum albumin solution for being 2.5% with mass concentration wraps up the spot on DNA and the activity on blocking dna
Then site is cleaned with ultra-pure water, drying box is used in combination to dry, and final acquisition surface spraying has silver nanoparticle film and silver nanoparticle is thin
The silicon dioxide substrates of DNA are also coated on film.
10. environment network as claimed in claim 8, which is characterized in that the preparation packet of the surface-enhanced Raman SERS chips
Include following steps：
It is the first step, the silver nitrate solution of a concentration of 1mM of molal volume and the trisodium citrate of a concentration of 40nM of molal volume is molten
Liquid mixing is put into container, and with vigorous stirring, the sodium borohydride solution of a concentration of 112mM of molal volume is added dropwise,
Mixed solution gradually becomes khaki from transparent, obtains silver colloidal solution, wherein silver nitrate solution, citric acid three sodium solution with
Volume ratio is 50 between sodium borohydride solution:4:1；
Second step, the silver colloidal solution aging 24 hours by acquisition, make the sodium borohydride in silver colloidal solution decompose；
Third walks：The 2- thionaphthols of a concentration of 0.01mM of molal volume are added to silver colloidal solution and are mixed, wherein 2- thionaphthols
Volume ratio with silver colloidal solution is：1:100, it is then gently mixed 10 minutes, obtains the Nano silver grain of 2- thionaphthols label
Separating liquid；
4th step：The Nano silver grain separating liquid that 2- thionaphthols are marked, according to the speed centrifugation rotation 10 of 8000 rev/min
Minute, supernatant is removed, then suspended with the phosphate buffer of a concentration of 10mM of molal volume, the silver colloid after being suspended is molten
Liquid, wherein the volume ratio of phosphate buffer and gold and silver colloidal solution is 1：1；
Preset DNA solution is added in the silver colloidal solution after suspending 5th step, reacts 12 hours, then addition mole
The sodium chloride solution salinization that volumetric concentration is 0.1M 30 minutes, then be placed in 4 degrees Celsius of temperature and continue salinization 6 hours, it obtains
Mixture, wherein the volume ratio of 2- thionaphthols and sodium chloride solution is 1:2；
6th step centrifuges mixture 30 minutes under 8000 rpms of rotating speed, removes supernatant, is subsequently placed in a mole body
It suspends in the phosphate buffer of a concentration of 10mM of product, obtains the silver nanoparticle solution by the modification of DNA and 2- thionaphthols；
7th step will be coated in silicon dioxide substrates by the silver nano-grain of DNA and 2- thionaphthols modification, then be placed in drying
It is dried in case, finally forms the silver nano-grain distributed area by the modification of DNA and 2- thionaphthols in silicon dioxide substrates
Domain prepares surface-enhanced Raman SERS chips；
Wherein, in the 5th step, the specific preparation process of the preset DNA solution is as follows：
By the 5 of a concentration of 100uM of molal volume terminal modified sulfydryl DNA
(CCCCCACCTCCCTCCCACCT) three (2- carboxyethyls) phosphonium salt acid salt solutions of solution and a concentration of 10mM of molal volume
Mixing, the wherein volume ratio of DNA solution and three (2- carboxyethyls) phosphonium salt acid salt solutions are 20:3, and DNA solution is walked with third
In 2- thionaphthols volume ratio be 1:1, room temperature stands activation 1 hour, obtains preset DNA solution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810567754.3A CN108444545A (en) | 2018-06-05 | 2018-06-05 | The environment network of silver ion content is detected based on aldehyde radical chip and silver nano-grain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810567754.3A CN108444545A (en) | 2018-06-05 | 2018-06-05 | The environment network of silver ion content is detected based on aldehyde radical chip and silver nano-grain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108444545A true CN108444545A (en) | 2018-08-24 |
Family
ID=63206022
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810567754.3A Pending CN108444545A (en) | 2018-06-05 | 2018-06-05 | The environment network of silver ion content is detected based on aldehyde radical chip and silver nano-grain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108444545A (en) |
Citations (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0838528A1 (en) * | 1996-10-25 | 1998-04-29 | Kyoto Daiichi Kagaku Co., Ltd. | Method for measuring the concentration of polynucleotides |
| CN1556861A (en) * | 2001-09-24 | 2004-12-22 | ض� | Nucleid acid sequencing by Raman monitoring of molecular deconstruction |
| CN1712928A (en) * | 2005-07-01 | 2005-12-28 | 重庆工学院 | MZ interference SPR chemical and biological sensor and system with fibre-optical microstructure |
| CN1815194A (en) * | 2006-02-17 | 2006-08-09 | 湖南大学 | Method for raising surface plasma resonance sensor sensitivity by using nano gold grain catalytic growing |
| CN101216429A (en) * | 2008-01-07 | 2008-07-09 | 首都师范大学 | SERS biological probe and method for making same |
| US7476501B2 (en) * | 2002-03-26 | 2009-01-13 | Intel Corporation | Methods and device for DNA sequencing using surface enhanced raman scattering (SERS) |
| CN102127542A (en) * | 2010-12-27 | 2011-07-20 | 江南大学 | Preparation method of self-assembly material having surface-enhanced Raman activity |
| CN103398998A (en) * | 2013-08-07 | 2013-11-20 | 上海师范大学 | Raman probe used for detection of mercury ions and preparation method thereof |
| CN103595813A (en) * | 2013-11-22 | 2014-02-19 | 锦瀚智慧管网技术有限公司 | Intelligent pipe network application system and obtaining method thereof |
| CN104198464A (en) * | 2014-09-23 | 2014-12-10 | 南京农业大学 | Method for building surface enhanced Raman scattering detection system |
| CN104237203A (en) * | 2014-09-28 | 2014-12-24 | 苏州大学 | SERS sensor for quantitatively detecting concentration of mercury ions in water sample and preparation method of SERS sensor |
| CN104458704A (en) * | 2014-12-24 | 2015-03-25 | 中国科学院合肥物质科学研究院 | Method for detecting low-concentration mercury ions based on DNA modified SERS substrate |
| CN104568905A (en) * | 2015-01-19 | 2015-04-29 | 东南大学 | Three-dimensional code biological detection chip based on surface-enhanced Raman scattering (SERS) microflow platform as well as preparation method and detection method of biological detection chip |
| CN105019033A (en) * | 2015-07-22 | 2015-11-04 | 中国科学院合肥物质科学研究院 | DNA chip and detection method and production method thereof |
| CN105699355A (en) * | 2016-01-31 | 2016-06-22 | 南京邮电大学 | SERS (Surface Enhanced Raman Scattering) sensor for detecting mercury ions as well as preparation method and detection method thereof |
| CN205940615U (en) * | 2016-05-30 | 2017-02-08 | 东莞前沿技术研究院 | Wisdom city monitored control system |
| CN106669872A (en) * | 2016-12-29 | 2017-05-17 | 中国人民解放军国防科学技术大学 | Surface-enhanced Raman microfluidic test chip as well as preparation method and application thereof |
| CN107290519A (en) * | 2017-06-09 | 2017-10-24 | 浙江大学 | The construction method of SERS aptamer sensors based on nanometer package assembly and application |
| CN107515242A (en) * | 2017-08-04 | 2017-12-26 | 清华大学 | A kind of silicon substrate gold nano bowl array chip and preparation method and application |
-
2018
- 2018-06-05 CN CN201810567754.3A patent/CN108444545A/en active Pending
Patent Citations (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0838528A1 (en) * | 1996-10-25 | 1998-04-29 | Kyoto Daiichi Kagaku Co., Ltd. | Method for measuring the concentration of polynucleotides |
| CN1556861A (en) * | 2001-09-24 | 2004-12-22 | ض� | Nucleid acid sequencing by Raman monitoring of molecular deconstruction |
| US7476501B2 (en) * | 2002-03-26 | 2009-01-13 | Intel Corporation | Methods and device for DNA sequencing using surface enhanced raman scattering (SERS) |
| CN1712928A (en) * | 2005-07-01 | 2005-12-28 | 重庆工学院 | MZ interference SPR chemical and biological sensor and system with fibre-optical microstructure |
| CN1815194A (en) * | 2006-02-17 | 2006-08-09 | 湖南大学 | Method for raising surface plasma resonance sensor sensitivity by using nano gold grain catalytic growing |
| CN101216429A (en) * | 2008-01-07 | 2008-07-09 | 首都师范大学 | SERS biological probe and method for making same |
| CN102127542A (en) * | 2010-12-27 | 2011-07-20 | 江南大学 | Preparation method of self-assembly material having surface-enhanced Raman activity |
| CN103398998A (en) * | 2013-08-07 | 2013-11-20 | 上海师范大学 | Raman probe used for detection of mercury ions and preparation method thereof |
| CN103595813A (en) * | 2013-11-22 | 2014-02-19 | 锦瀚智慧管网技术有限公司 | Intelligent pipe network application system and obtaining method thereof |
| CN104198464A (en) * | 2014-09-23 | 2014-12-10 | 南京农业大学 | Method for building surface enhanced Raman scattering detection system |
| CN104237203A (en) * | 2014-09-28 | 2014-12-24 | 苏州大学 | SERS sensor for quantitatively detecting concentration of mercury ions in water sample and preparation method of SERS sensor |
| CN104458704A (en) * | 2014-12-24 | 2015-03-25 | 中国科学院合肥物质科学研究院 | Method for detecting low-concentration mercury ions based on DNA modified SERS substrate |
| CN104568905A (en) * | 2015-01-19 | 2015-04-29 | 东南大学 | Three-dimensional code biological detection chip based on surface-enhanced Raman scattering (SERS) microflow platform as well as preparation method and detection method of biological detection chip |
| CN105019033A (en) * | 2015-07-22 | 2015-11-04 | 中国科学院合肥物质科学研究院 | DNA chip and detection method and production method thereof |
| CN105699355A (en) * | 2016-01-31 | 2016-06-22 | 南京邮电大学 | SERS (Surface Enhanced Raman Scattering) sensor for detecting mercury ions as well as preparation method and detection method thereof |
| CN205940615U (en) * | 2016-05-30 | 2017-02-08 | 东莞前沿技术研究院 | Wisdom city monitored control system |
| CN106669872A (en) * | 2016-12-29 | 2017-05-17 | 中国人民解放军国防科学技术大学 | Surface-enhanced Raman microfluidic test chip as well as preparation method and application thereof |
| CN107290519A (en) * | 2017-06-09 | 2017-10-24 | 浙江大学 | The construction method of SERS aptamer sensors based on nanometer package assembly and application |
| CN107515242A (en) * | 2017-08-04 | 2017-12-26 | 清华大学 | A kind of silicon substrate gold nano bowl array chip and preparation method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mokrani et al. | Air quality monitoring using iot: A survey | |
| US8470525B2 (en) | Method for analyzing air | |
| JP2003281671A (en) | Multi-sensing atmospheric environment monitoring system device and monitoring method | |
| CN109029550A (en) | A kind of Underground Space Environment monitoring network | |
| CN107202821A (en) | The comprehensive detection machine people that imflammable gas for underground pipe gallery is monitored | |
| CN107505442A (en) | Distributed Multiparameter water quality monitoring system | |
| CN108444542A (en) | The environment network of silver ion content is detected based on gold silver nanometer particle | |
| CN108444545A (en) | The environment network of silver ion content is detected based on aldehyde radical chip and silver nano-grain | |
| CN108444547A (en) | The environment network of mercury ion content is detected based on genetic chip and silver nano-grain | |
| CN108507624A (en) | The environment network of silver ion content is detected based on genetic chip and gold nano grain | |
| CN108444546A (en) | The environment network of silver ion content is detected based on genetic chip and silver nano-grain | |
| CN108444540A (en) | The environment network of mercury ion content is detected based on aldehyde radical chip and silver nano-grain | |
| CN108444541A (en) | The environment network of silver ion content is detected based on aldehyde radical chip and gold nano grain | |
| CN108444539A (en) | The environment network of silver ion content is detected based on silver nano-grain | |
| CN108444538A (en) | The environment network of mercury ion content is detected based on aldehyde radical chip and gold nano grain | |
| CN108444544A (en) | The environment network of mercury ion content is detected based on silver nano-grain | |
| CN108444543A (en) | The environment network of mercury ion content is detected based on gold silver nanometer particle | |
| CN108519128A (en) | The environment network of mercury ion content is detected based on genetic chip and gold nano grain | |
| CN108444548A (en) | The environment network of mercury ion content is detected based on gold nano grain | |
| CN108507623A (en) | The environment network of silver ion content is detected based on gold nano grain | |
| Bourelly et al. | Measurement and applications: The role of communication technologies in developing distributed measurement systems and measurement applications | |
| CN108828022A (en) | Monitoring system and monitoring method for continuous online observation trace bicycle pump | |
| CN104458340B (en) | Many intake weighting water intake systems and method based on wireless sensor network | |
| Weli | Spatial and seasonal influence of meteorological parameters on the concentration of suspended particulate matter in an industrial city of Port Harcourt, Nigeria | |
| CN206594051U (en) | A kind of system for detecting choline glycerophosphatide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180824 |