CN108441510B

CN108441510B - Cultivation of transgenic rice GRH and black golden rice and detection method of GRH target gene

Info

Publication number: CN108441510B
Application number: CN201810249280.8A
Authority: CN
Inventors: 陈浩; 林拥军
Original assignee: Wuhan Towin Biotechnology Co ltd
Current assignee: Wuhan Towin Biotechnology Co ltd
Priority date: 2018-03-26
Filing date: 2018-03-26
Publication date: 2020-12-22
Anticipated expiration: 2038-03-26
Also published as: CN108441510A

Abstract

The invention provides a method for cultivating transgenic rice GRH and black golden rice and detecting a GRH target gene, and belongs to the field of rice breeding. The GRH cultivation method comprises the following steps: 1) constructing a final expression vector; 2) finally, genetic transformation of the expression vector is carried out to obtain T0 generation transformed plants; 3) screening plants with positive target genes in the T0 transformed plants, and selfing and fructifying to obtain T1 transformed plants; 4) screening out the plants without hpt expression in T1 generation transformed plants, and naming the plants as GRH. The black golden rice bred by taking GRH and black rice as parents is rich in anthocyanin, lutein and beta-carotenoid, and has certain eye-protecting and health-care effects. The method provided by the invention is simple and reliable, has high conversion rate, can not cause the inactivation of the expression of the endogenous gene of the rice by inserting the target gene, and has good commercialization potential.

Description

Cultivation of transgenic rice GRH and black golden rice and detection method of GRH target gene

Technical Field

The invention belongs to the field of rice breeding, and particularly relates to a method for cultivating transgenic rice GRH and black golden rice and detecting a GRH target gene.

Background

The secondary metabolites of some plants have important health care effect on human health. For example, anthocyanins have strong antioxidant ability and can protect human body from being damaged by free radicals. Studies have shown that anthocyanins can prevent certain chronic diseases such as diabetes, obesity, certain cancers, and cardiovascular diseases (Zhang et al 2014). Beta-carotene is an important provitamin a from plant sources, which can be converted to vitamin a in the human body. Vitamin a deficiency can lead to night blindness, dry eye, and severe deficiency can lead to blindness and death (Schaub et al.2017). Lutein can protect macula in retina and prevent blindness caused by age-related macular degeneration (Madaan et al.2017). In addition, the lutein can also filter harmful blue light entering eyes, reduce the damage of a display screen to the eyes, reduce the incidence rate of cataract and the like.

Rice is staple food for more than half of the population in the world and is the most important food crop in China. The slight change of the nutritional quality of rice is also a great promotion effect on health for population taking rice as staple food due to the accumulation effect of long-term eating. Rice is generally consumed as white and substantially free of anthocyanins, beta-carotene and lutein.

In addition, many health care products containing lutein, beta-carotene and natural antioxidants (anthocyanin or procyanidin) as effective components are available in the market, and include various domestic or imported products, which are called luck-eye. The main effects of the product are protecting eyesight and relieving asthenopia. But the price is generally higher, and the price of one bottle is dozens of yuan to hundreds of yuan; in addition, most of Chinese people are not used to eating the health care products, and the capsule form of the health care products is easy to cause the feeling of taking medicines. It is often difficult to maintain for a population whose body is substantially healthy. Chinese people are influenced by the thought of traditional Chinese medicine, and have good luck and medicine homology. At present, no relevant report on a cultivation method of eye-protecting health-care rice exists.

Disclosure of Invention

In view of the above, the present invention aims to provide a cultivation method of transgenic rice GRH and black golden rice, which is rich in anthocyanin, lutein and β -carotene and has a certain eye protection and health care effect.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a cultivation method of a transgenic rice variety GRH, which comprises the following steps:

1) transferring a target gene into an expression vector containing double T-DNA regions to obtain a final expression vector, wherein the double T-DNA regions comprise a first T-DNA region and a second T-DNA region, the first T-DNA region is connected with an hpt marker gene, and the second T-DNA region is connected with the target gene; the target genes are phytoene synthase gene psy and phytoene dehydrogenase gene crtI;

2) transforming the final expression vector into japonica rice variety empty-bred 131 by utilizing an agrobacterium-mediated genetic transformation method to obtain T0 generation transformed plants;

3) screening the plants with positive psy, crtI and hpt in the T0 transformed plants by using PCR, and carrying out selfing and fructification to obtain T1 transformed plants;

4) screening plants without hpt expression in the T1 generation transformed plants to obtain a transgenic japonica rice variety named as GRH.

Preferably, the 5 'end of the phytoene synthase gene psy in the step 1) is modified with a glutelin promoter and a HindIII enzyme cutting site, the 3' end is modified with a NOs terminator and a Sal I enzyme cutting site, and the nucleotide sequence of the modified phytoene synthase gene psy is shown as SEQ ID NO: 17.

Preferably, the 5 'end of the phytoene dehydrogenase gene crtI in the step 1) is modified with a glutelin promoter and an EcoR I enzyme cutting site, the 3' end is modified with a NOs terminator and a Kpn I enzyme cutting site, and the nucleotide sequence of the modified phytoene dehydrogenase gene crtI is shown as SEQ ID NO 18.

Preferably, the expression vector containing the double T-DNA region in the step 1) is obtained by modifying on the basis of an expression vector pCAMBIA 1300.

Preferably, the method for constructing the expression vector containing the double T-DNA region in step 1) comprises the following steps:

a) removing coding region segments of a CaMV35S promoter and an hpt gene by using a BstXI and Xho I double-enzyme digestion expression vector pCAMBIA1300 to obtain an intermediate vector pMF containing a second T-DNA region;

b) utilizing Sac I and Hind III to carry out double enzyme digestion on the expression vector pCAMBIA1300, removing a multiple cloning site section, and obtaining an intermediate vector pC 1300E;

c) introducing SacII enzyme cutting site to the side, close to EcoRI, of the Sph I enzyme cutting site of the intermediate vector pC1300E obtained in the step b) to construct an intermediate vector pC1300 ES;

d) removing the EcoR I enzyme cutting site of the intermediate vector pC1300ES obtained in the step c) to obtain an intermediate vector pC1300 NES;

e) digesting the intermediate vector pC1300NES obtained in the step d) by using Sac II to obtain a first T-DNA region segment carrying hpt;

f) connecting the intermediate vector pMF containing the second T-DNA region obtained in the step a) with the first T-DNA region fragment carrying hpt obtained in the step e) to obtain an expression vector containing double T-DNA regions;

there is no restriction on the chronological order between step a) and steps b), c), d) and e), respectively.

Preferably, the primer sequence selected by the PCR screening in the step 3) is shown as SEQ ID NO 1-6.

The invention also provides a method for cultivating black golden rice by using the GRH cultivated by the cultivation method as a parent, which comprises the following steps:

1) PCR screening psy and crtI dominant homozygous plants in the later plants of the GRH to hybridize with black rice to obtain F1 generations;

2) backcrossing the black rice serving as a recurrent parent with an F1 generation to obtain a BC3F1 generation;

3) and selfing the BC3F1 generation to select a psy and crtI dominant homozygous progeny plant to obtain black golden rice.

Preferably, the sequence of the screened primer in the step 1) is shown in SEQ ID NO 3-4 and SEQ ID NO 5-6.

Preferably, the black rice variety in the step 1) is black commander.

Preferably, the BC3F1 generation seed of step 2) has a black seed coat and a yellow endosperm.

The invention provides a cultivation method of black gold rice, the black gold rice obtained by the cultivation method is a variety bred by hybridization of a transgenic variety GRH and black rice, is rich in anthocyanin, lutein and beta-carotene, and has nutritional values respectively and remarkably higher than those of two parents; the rice is adopted to express the eye-protecting health-care component, so that the health-care effect can be achieved while eating; the cultivation method is simple, high in efficiency and short in cultivation period.

Drawings

FIG. 1 is a physical map of pCAMBIA1300 containing double T-DNA regions (a) and a schematic structure of the T-DNA region of the final expression vector pC1300dT-psy/crtI (b);

FIG. 2 is a graph of molecular detection and phenotypic observation of GRH; wherein (a) a PCR result chart for detecting the hpt marker gene in a T1 generation transgenic plant population; (b) southern analysis of GRH, total DNA digested with Hind III, using PCR amplified fragments of crtI gene as probe, GRH as transgenic material in lane T, DNAmarker in lane M, and wild type air-cultured 131 in lane W; (c) seeds of de-shelled air-bred 131 and GRH;

FIG. 3 is a flow chart of black golden rice breeding process, wherein (a) is a black golden rice breeding process; (b) comparing the phenotype of the black golden rice with the parent GRH and black commander;

FIG. 4 shows the insertion positions of foreign genes of GRH and black golden rice;

FIG. 5 is a graph showing the result of PCR detection of black golden rice;

FIG. 6 is a schematic diagram of an intermediate vector PMF structure;

FIG. 7 is a schematic diagram of the structure of an intermediate vector pC 1300E.

Detailed Description

In the invention, a target gene is transferred into an expression vector containing double T-DNA regions to obtain a final expression vector, wherein the first T-DNA region is connected with an hpt marker gene, and the second T-DNA region is connected with the target gene; the target genes are phytoene synthase gene psy and phytoene dehydrogenase gene crtI. The origin of the phytoene synthase gene psy is not particularly limited, and it may be obtained by amplification from a plant or may be synthesized directly. When the phytoene synthase gene psy is obtained by an amplification method, the phytoene synthase gene psy is preferably amplified from maize; when the phytoene synthase gene psy is artificially synthesized, the present invention is preferably synthesized by using a bio-company well known to those skilled in the art. In the present invention, the method for synthesizing the maize-derived phytoene synthase gene psy is not particularly limited, and it may be either amplified or synthesized, preferably synthesized, and in the case of synthesis, the sequence of the phytoene synthase gene psy of the present invention is preferably the same as the psy gene referred to in the published literature (patent et al 2005improving the nutritional value of golden Rice through cultured pro-visual A content Biotechnology 2005,23: 482. sup. 487).

When the phytoene synthase gene psy of the target gene of the present invention is linked to the second T-DNA region, the following modifications are preferably made: the 5' end of the phytoene synthase gene psy is modified with a glutelin promoter and a HindIII enzyme cutting site; the 3' end of the phytoene synthase gene psy is modified with a nos terminator and a Sal I enzyme cutting site. In the present invention, the gluten promoter is preferably a rice endosperm-specific gluten promoter, and the sequence of the rice endosperm-specific gluten promoter is preferably the sequence with the accession number D00584; in the invention, the promoter is preferably inserted between 7-845 bp. Preferably inserting the Hind III enzyme cutting site between 1-6 bp; the nos terminator is preferably a nos terminator derived from Agrobacterium. In the invention, the nos terminator is preferably inserted between 2507 and 2759bp, and the Sal I enzyme cutting site is preferably inserted between 2760 and 2765 bp. The nucleotide sequence of the modified phytoene synthase gene psy is shown in SEQ ID NO. 17.

The source of the phytoene dehydrogenase gene crtI is not particularly limited, and the phytoene dehydrogenase gene crtI can be obtained by amplification from a strain or directly synthesized artificially. When the phytoene dehydrogenase gene crtI is obtained by an amplification method, the phytoene dehydrogenase gene crtI is preferably amplified in Erwinia; when the phytoene dehydrogenase gene crtI is artificially synthesized, the phytoene dehydrogenase gene crtI is preferably synthesized by a bio-company known to those skilled in the art. In the present invention, the method for synthesizing the phytoene dehydrogenase gene crtI derived from Erwinia is not particularly limited, and it may be either amplified synthesis or artificial synthesis, preferably artificial synthesis, and in the case of artificial synthesis, the specific sequence of the phytoene dehydrogenase gene crtI of the present invention is preferably the same as that of the crtI gene involved in the published literature (patent et al 2005 amplifying the nuclear value of Golden Rice through cultured pro-vitamin A content Biotechnology 2005,23: 482. sup. 487).

The phytoene dehydrogenase gene crtI of the object of the present invention is preferably modified as follows when it is ligated to the second T-DNA region: the end of the phytoene dehydrogenase gene crtI5 'is modified with a glutelin promoter and an EcoR I enzyme cutting site, and the end of the phytoene dehydrogenase gene crtI 3' is modified with a nos terminator and a Kpn I enzyme cutting site. In the present invention, the gluten promoter is preferably a rice endosperm-specific gluten promoter, and the sequence of the rice endosperm-specific gluten promoter is preferably the sequence with the accession number D00584; in the invention, the glutelin promoter is preferably inserted between 7-845 bp, and the EcoR I enzyme cutting site is preferably inserted between 1-6 bp. In the present invention, the nos terminator is preferably a nos terminator derived from Agrobacterium. In the invention, the nos terminator is preferably inserted between 2502 and 2754bp, and the Kpn I enzyme cutting site is preferably inserted between 2755 and 2760 bp. The nucleotide sequence of the modified phytoene dehydrogenase gene crtI is shown in SEQ ID NO. 18.

The invention transfers the target gene into an expression vector containing double T-DNA regions, the marker gene hpt is in one independent T-DNA region, the target gene is constructed in the other T-DNA region, and when the expression vector containing the double T-DNA regions is used for infecting plants, the two T-DNAs are independently transferred, thereby providing possibility for screening of later-stage transgenic families without the hpt marker gene. In the present invention, the expression vector containing the double T-DNA region is preferably obtained by modifying an expression vector pCAMBIA1300, and the modification method preferably comprises the following steps:

c) introducing Sac II enzyme cutting site to the side, close to EcoR I, of the Sph I enzyme cutting site of the intermediate vector pC1300E obtained in the step b) to construct an intermediate vector pC1300 ES;

f) connecting the intermediate vector pMF containing the second T-DNA region obtained in the step a) with the first T-DNA region fragment carrying hpt obtained in the step e) to obtain an expression vector of a double T-DNA region;

The invention removes the coding region segments of the CaMV35S promoter and hpt gene by using BstXI and Xho I double-restriction enzyme expression vector pCAMBIA1300 to obtain an intermediate vector containing a second T-DNA regionThe body pMF. In the present invention, the system using double digestion with Bst XI and Xho I is preferably a 50. mu.L reaction system: pCAMBIA1300 plasmid 2. mu.g, 10 XH Buffer 5. mu.L, BstXI 5U, Xho I5U, supplemented with ddH₂O to 50. mu.L, in the present invention, the procedure using Bst XI and Xho I double digestion is preferably 37 ℃ for 2 h.

The double enzyme digestion method preferably comprises the steps of recovering vector fragments, filling the tail end and self-connecting, wherein the filling of the tail end preferably adopts T4DNA polymerase, and the system of the filling of the tail end is preferably a 10-mu-L reaction system: recovered vector fragment 5. mu.L, 10XBuffer 1. mu.L, 0.1% BSA 1. mu.L, 10mM dNTPs 1. mu.L, ddH₂O2. mu.L, treated at 70 ℃ for 5min, T4DNApolymerase 1. mu.l was added, the end-blunting procedure was preferably 37 ℃ for 5min, and then the enzyme was inactivated by vigorous shaking with a shaker and placed on ice until use.

The invention carries out self-ligation on the vector with the blunt end after the blunt end is filled, and the self-ligation system is preferably 4 mu L, 10x Buffer 1 mu L and ddH of the vector with the blunt end₂mu.L of O4, 1. mu.L of T4DNA ligase, and a self-ligation procedure preferably at 16 ℃ for 4h, resulting after self-ligation in the intermediate vector pMF containing the second T-DNA region, as shown in FIG. 6.

The invention utilizes Sac I and Hind III double enzyme digestion expression vector pCAMBIA1300 to remove the multiple cloning site section, and obtains intermediate vector pC 1300E. In the present invention, the system using Sac I and Hind III double digestion is preferably a 50 μ L reaction system: pCAMBIA 13002. mu.g, 10 XM Buffer 5. mu.L, Sac I5U, HindIII 5U, supplemented with ddH₂O to 50. mu.L, and in the present invention, the procedure using Sac I and Hind III double digestion is preferably 37 ℃ for 2 h.

In the present invention, the double digestion with Sac I and Hind III preferably includes the steps of recovering vector fragments, filling ends and self-ligating, wherein the filling ends are preferably filled with T4DNA polymerase, and the system for filling ends is preferably a 10 μ L reaction system: recovered vector fragment 5. mu.L, 10XBuffer 1. mu.L, 0.1% BSA 1. mu.L, 10mM dNTPs 1. mu.L, ddH₂O2. mu.L, treating at 70 ℃ for 5min, adding 1. mu.L of T4DNApolymerase, and the end-filling program is preferably 5m at 37 ℃in, then the enzyme was deactivated by vigorous shaking with a shaker and placed on ice until use. After the tail end is filled, the double enzyme digestion products after the tail end is filled are preferably self-connected, and the self-connected system is preferably a tail end filling carrier of 4 mu L, 10 multiplied by 1 mu L Buffer and ddH₂mu.L of O4, 1. mu.L of T4DNA ligase, and the procedure of self-ligation is preferably 16 ℃ for 4h, and the intermediate vector pC1300E containing the first T-DNA region is obtained after self-ligation, as shown in FIG. 7.

After the intermediate vector pC1300E is obtained, the invention introduces Sac II enzyme cutting site to the side of Sph I enzyme cutting site of the intermediate vector pC1300E close to EcoR I, and constructs the intermediate vector pC1300 ES. In the invention, the introduction is preferably performed in a PCR mode, the primer sequence of the PCR is preferably shown as SEQ ID NO. 21 and SEQ ID NO. 22, the primer sequence of the SEQ ID NO. 21 contains an EcoR I enzyme cutting site, and the primer sequence of the SEQ ID NO. 22 contains a Sac II enzyme cutting site on the side of the Sph I enzyme cutting site close to the EcoR I. In the present invention, the PCR system is preferably 10 XPCR Buffer 5. mu.L, 2mM dNTPs 4. mu.L, about 10. mu.M primers 0.5. mu.L each, DNA template 1. mu.L, Ex Taq 0.5. mu.L, ddH₂O38.5. mu.L, the PCR program is preferably 94 ℃ for 5 min; 30s at 94 ℃, 30s at 57 ℃, 30s at 72 ℃, 30cycles at 72 ℃, 5min at 72 ℃ and 1min at 25 ℃.

In the invention, the PCR can amplify a segment from EcoR I to Sph I of an intermediate vector pC1300E to obtain a PCR product, the PCR product is subjected to double enzyme digestion by utilizing EcoR I and Sph I to obtain a PCR product subjected to double enzyme digestion, and the PCR product subjected to double enzyme digestion is connected with a pC1300E intermediate vector which is also subjected to double enzyme digestion by utilizing EcoR I and Sph I to construct an intermediate vector pC1300 ES. In the present invention, the double enzyme digestion system is preferably a 50 μ L reaction system: PCR product or pC1300E vector 10. mu.L, 10 XH Buffer 5. mu.L, EcoR I5U, Sph I5U, supplemented with ddH₂The procedure for O to 50. mu.L of the double digestion is preferably 37 ℃ for 2 h.

After the construction of the intermediate vector pC1300ES is completed, the EcoR I enzyme cutting site of the intermediate vector pC1300ES is removed, and the intermediate vector pC1300NES is obtained. In the present invention, the removal is preferably performed by using EcoR I enzyme, and the enzyme digestion system is preferably a 50 μ L reaction system: pC1300ES 2 μ g, 10 XH Buffer 5 μ L,EcoR I5U, supplemented with ddH₂O to 50. mu.L, the procedure for said cleavage is preferably 37 ℃ for 2 h. The method preferably comprises the following steps of recovering a vector, filling the tail end and self-linking after the EcoR I enzyme is cut, wherein the tail end filling preferably adopts T4DNA polymerase to fill the tail end, and the system for filling the tail end is preferably a 10-mu-L reaction system: recovered vector fragment 5. mu.L, 10XBuffer 1. mu.L, 0.1% BSA 1. mu.L, 10mM dNTPs 1. mu.L, ddH₂O2. mu.L, treated at 70 ℃ for 5min, T4DNA Polymerase 1. mu.l was added, the end-blunting procedure was preferably 37 ℃ for 5min, and then the enzyme was inactivated by vigorous shaking with a shaker and placed on ice until use. The invention is self-linked after the filling of the tail end, and the self-linked system is preferably a tail end filling vector of 4 mu L, 10x Buffer of 1 mu L and ddH₂O4. mu.L, T4DNA ligase 1. mu.L, the procedure for self-ligation is preferably 16 ℃ for 4h, and after self-ligation, the intermediate vector pC1300NES with the EcoR I cleavage site removed is obtained.

After the intermediate vector pC1300NES is obtained, the invention uses Sac II to carry out enzyme digestion on the intermediate vector pC1300NES to obtain a first T-DNA region segment carrying hpt. In the present invention, the enzyme digestion system is preferably a 50 μ l reaction system: pC1300NES 2. mu.g, 10 XT Buffer 5. mu.L, 0.1% BSA 5. mu.L, Sac II 5U, supplemented with ddH₂O to 50. mu.L, the procedure for said cleavage is preferably 37 ℃ for 2 h.

After obtaining the intermediate vector pMF containing the second T-DNA region and the first T-DNA region segment carrying hpt, the invention connects the intermediate vector pMF containing the second T-DNA region obtained above with the first T-DNA region segment carrying hpt to obtain the expression vector of double T-DNA regions. In the present invention, the ligation is preferably performed by using T4 ligase, the ligation system is preferably 2. mu.L pMF vector, 6. mu.L of the first T-DNA fragment carrying hpt 10XBuffer 1. mu.L, and the ligation procedure is preferably 16 ℃ for 4h with T4DNA ligase 1. mu.L.

In the present invention, the expression vector of the double T-DNA region comprises two T-DNA regions, the selection marker hpt gene is in the first T-DNA region, and the target gene is constructed in the second T-DNA region. When the plant is infected by the expression vector with the double T-DNA regions, the two T-DNA regions are independently transferred, so that the possibility is provided for screening of later-stage marker-free transgenic families.

After obtaining the expression vector containing the double T-DNA regions, the invention transfers the target gene into the expression vector containing the double T-DNA regions to construct and obtain the final expression vector. In the present invention, the method of construction preferably comprises: HindIII and Sal I are respectively used for double enzyme digestion of psy and a pCAMBIA1300 vector containing double T-DNA regions and then are connected to form an intermediate vector pC1300 dT-psy; and carrying out double enzyme digestion on the crtI and the intermediate vector pC1300dT-psy respectively by using EcoR I and Kpn I, and then connecting to obtain a final expression vector pC1300 dT-psy/crtI.

In the present invention, the system of double digestion with Hind III and Sal I is preferably a 50. mu.L reaction system: 2. mu.g of the expression vector for the double T-DNA region, 7.5. mu.L of 10 XK Buffer, HindIII 5U, Sal I5U, supplemented with ddH₂O to 50. mu.L, the double digestion procedure with HindIII and Sal I preferably being 2h at 37 ℃; the system for double enzyme digestion by EcoR I and Kpn I is preferably a 50-L reaction system: pC1300dT-psy 2. mu.g, 10 XM Buffer 5. mu.L, EcoR I5U, Kpn I5U, supplemented with ddH₂O to 50. mu.L, the procedure for double cleavage with EcoR I and Kpn I is preferably 2h at 37 ℃. The preferred system of said connection is 2 μ L of carrier, 6 μ L of exogenous gene fragment 10XBuffer 1 μ L, and 1 μ L of T4DNA ligase, and the preferred program of said connection is 16 deg.C 4h

After the final expression vector pC1300dT-psy/crtI is obtained, the final expression vector is transformed into the japonica rice variety empty-bred 131 by using an agrobacterium-mediated genetic transformation method to obtain a T0 generation transformed plant. The Agrobacterium-mediated genetic transformation method is not particularly limited in the present invention.

After T0 generation transformed plants are obtained, the T0 generation transformed plants which are positive in psy, crtI and hpt are screened by PCR, and selfing and fructification are carried out to obtain T1 generation transformed plants. In the present invention, the template for PCR screening is preferably T0 generation plant genomic DNA, and more preferably genomic DNA extracted from leaves. In the invention, the primer sequence for PCR screening is shown as SEQ ID NO. 1-6, wherein the primers shown as SEQ ID NO. 1-2 are used for screening hpt genes, the primers shown as SEQ ID NO. 3-4 are used for screening psy genes, and the primers shown as SEQ ID NO. 5-6 are used for screening and amplifying crtI genes. In the present invention, the reaction system for PCR screening is preferably: 2 mu L of DNA template; 10 × buffer 2 μ L; dNTP (2mM) 2. mu.L; 0.2. mu.L of each of the left and right primers (10. mu.M); r-Taq 0.2 μ L; double distilled water was added to 20. mu.L. In the present invention, the amplification conditions of the PCR are preferably: 5min at 94 ℃; 94 ℃ 30sec, 58 ℃ 30sec, 72 ℃ 45sec, 28 cycles; 7min at 72 ℃.

In the present invention, transformed plants of T0 generation were selected, which were positive in psy, crtI and hpt, and in the present invention, the positive is that after PCR screening using the above primers, amplified products were subjected to agarose gel electrophoresis to have bands at 750bp (hpt gene), 901bp (psy gene) and 820bp (crtI gene), respectively, and the corresponding bands were indicated as positive.

The method for selfing and fructifying the positive T0 generation transformed plants is not particularly limited, and the selfing and fructifying are preferably carried out in a greenhouse under natural illumination.

After T1 generation transformed plants are obtained, the invention screens the plants without hpt expression in T1 generation transformed plants, and the plants are named as GRH. In the invention, the PCR screening is preferably carried out by using primers shown in SEQ ID NO. 1-2, the hpt marker gene is amplified, and plants without hpt expression in T1 generation transformed plants are screened and named as GRH. In the invention, the hpt marker gene is separated in the selfing process of T0 generation plants, the obtained GRH plant only has the target genes psy and crtI and is inserted in a single copy (figure 2b), and GRH is a transgenic plant with the external gene inserted in a single copy and the marker gene eliminated.

1) PCR screening psy and crtI dominant homozygous plants in the progeny plants of the GRH to hybridize with black rice to obtain F1 generations;

After GRH is obtained, the invention PCR screens the psy and crtI dominant homozygous plant and black rice in the GRH offspring plantHybridization gave generation F1. In the present invention, the GRH progeny is preferably the T3 th generation, the T3 generation is preferably obtained by selfing T0 generation plants. In the present invention, the dominant homozygous selection method is preferably a PCR method, and the dominant homozygous selection process is preferably: t3 generation families planted with 30 GRHs, each family planted with 100 plants. PCR detection is carried out on each plant by using primers of SEQ ID NO. 3-4 (for detecting psy gene) and primers of SEQ ID NO. 5-6 (for detecting crtI gene). The system of the PCR reaction is preferably: 2 mul of DNA template; 2. mu.l of 10 xbuffer; 2mM dNTP2 μ l; primers of SEQ ID NO 3-4 or primers of SEQ ID NO 5-6 are 0.2 mul each; R-Taq (Takara, Dalian) 0.2. mu.l; supplement dd H₂O to 20. mu.l. The conditions of the PCR reaction are preferably: 5min at 94 ℃; 94 ℃ 30sec, 58 ℃ 30sec, 72 ℃ 45sec, 28 cycles; 7min at 72 ℃. The PCR products are detected by 0.8% agarose gel electrophoresis, and the sizes of the PCR products of the primers SEQ ID NO. 3-4 and SEQ ID NO. 5-6 are 901bp and 820bp respectively. If all 100 plants in one family are positive through PCR detection of two pairs of primers SEQ ID NO. 3-4 and SEQ ID NO. 5-6, the family is a homozygous GRH family. In the present invention, the seed coat of black rice is rich in anthocyanidin, and the origin and variety of black rice are not particularly limited, and black rice is preferably used as a black commander. In the invention, the hybridization preferably uses black commander as a female parent and artificially castrates the black commander in the flowering period. GRH is used as a male parent, and the GRH is planted in batches to ensure that GRH and Heishai florescence meet. During the flowering phase, manually pollen is taken from the GRH plants and pollinated to the emasculated black and handsome plants. Then bagging and collecting the hybrid seeds.

After the F1 generation is obtained, the black rice of the variety is used as recurrent parent to carry out backcross with the F1 generation to obtain BC3F1 generation. In the present invention, as shown in fig. 3a, the backcross process is preferably performed, in the present invention, the plant height, the number of effective ears, the number of seeds per ear, the thousand seed weight, the fructification rate and the single plant yield of the BC3F1 generation are selected to be consistent with black and handsome, and the single plant in which psy and crtI are positive through PCR detection is selected to obtain the target BC3F1 generation, in the present invention, the seeds of the target BC3F1 generation have black seed coat and yellow endosperm. In the invention, the preferable primer sequence for PCR detection is shown as SEQ ID NO. 1-6, wherein the primers shown as SEQ ID NO. 1-2 are used for screening hpt gene, the primers shown as SEQ ID NO. 3-4 are used for screening psy gene, and the primers shown as SEQ ID NO. 5-6 are used for screening and amplifying crtI gene.

After the target BC3F1 generation is obtained, the invention obtains black golden rice by selfing the BC3F1 generation to select psy and crtI dominant homozygous progeny plants. In the present invention, there is no particular limitation on the method of selfing, and the homozygous screening method is preferably planting black golden rice plants, bagging for selfing at the flowering stage, and harvesting.

The invention also provides a detection method of the phytoene synthase gene psy and phytoene dehydrogenase gene crtI insertion sites of the black golden rice cultivated by the cultivation method, which comprises the following steps:

(1) extracting DNA of GRH, digesting with Kpn I, and obtaining the DNA from the ligation product;

(2) performing reverse PCR amplification by using the self-ligation product obtained in the step (1) as a template to obtain an amplification product; the primer sequence of the reverse PCR is shown as SEQ ID NO. 9-16;

(3) recovering the amplification product obtained in the step (2) and sequencing to obtain a rice genome sequence of the right boundary of the phytoene synthase gene psy and phytoene dehydrogenase gene crtI insertion site of the second T-DNA region and a rice genome sequence of the left boundary of the phytoene synthase gene psy and phytoene dehydrogenase gene crtI insertion site of the second T-DNA region;

(4) and (4) comparing the rice genome sequence at the right side boundary and the rice genome sequence at the left side boundary obtained in the step (3) with the whole rice genome, and determining the insertion site of the gene.

The invention extracts DNA of GRH, self-joins after Kpn I digestion, and is obtained from a ligation product. The DNA of the present invention is preferably tissue DNA of GRH, more preferably genomic DNA extracted from leaves, and the method of extracting the DNA is not particularly limited. During digestion, the dosage of Kpn I is preferably 30U/50 mu L system; the temperature of the digestion is preferably 37 ℃; the digestion time is preferably 12-20 h, more preferably 14-18 h, and most preferably 16 h.

In the present invention, it is preferable that the digestion further comprises a purification process, and the purification process results in a purified product. In the present invention, the step of purifying preferably comprises: adding 150 mu L of ddH into the digestion reaction system₂O, adding 200 mu L chloroform/isoamyl alcohol (24:1), and oscillating for 5 min; ② centrifuging at 12000r/min for 5min, absorbing 180 μ L supernatant and transferring to a new centrifuge tube; ③ adding 20 mu L of 3M NaAc and 400 mu L of frozen absolute ethyl alcohol, mixing evenly and then placing for 30min at minus 20 ℃; fourthly, freezing and centrifuging at 12000r/min for 20min, and pouring out supernatant; fifthly, adding 500 mu L of 75% ethanol for washing, then centrifuging at 12000r/min for 5min, and pouring out the supernatant; sixthly, after naturally drying, 50 mu L of ddH is added₂Dissolving O to obtain a purified product.

After obtaining a purified product, performing self-ligation on the purified product, wherein the self-ligation is preferably performed by using T4DNA Ligase, the self-ligation system is preferably a 100 mu L system, and the system preferably comprises: t4DNALigase 10U, 10. mu.L of 10 XT 4DNALigase Buffer, 300ng of purified product, supplemented with ddH₂O water to 100 mu L; the self-connection temperature is preferably 16 ℃, and the self-connection time is preferably 16 h.

After obtaining the self-ligation product, carrying out reverse PCR amplification by using the self-ligation product as a template to obtain an amplification product; the primer sequence of the reverse PCR is shown as SEQ ID NO. 9-16. In the present invention, the reverse PCR is preferably performed in two rounds, namely, a first round of reverse PCR amplification and a second round of reverse PCR amplification, and the amplification product specifically refers to a product of the second round of reverse PCR amplification. In the invention, the primer sequence of the first round of reverse PCR amplification is preferably shown as SEQ ID NO 9-10 and SEQ ID NO 13-14; in the present invention, the system for the first round of inverse PCR amplification preferably comprises: 4 μ L of 10 XPCR buffer, 3 μ L of 25mM MgCl ₂3 μ L of 2mM dNTP, 0.5 μ L of 10 μ M left and right primers, 2U of Taq DNA polymerase and 2 μ L of self-ligation product; in the invention, the reaction procedure of the first round amplification of the reverse PCR is preferably 94 ℃ pre-denaturation for 5min, 94 ℃ denaturation for 1min,55 ℃ annealing for 1min, 72 ℃ extension for 2min, and 32 cycles of 72 ℃ extension for 5 min.

The second round of reverse PCR amplification of the present invention preferably uses the product of the first round of reverse PCR amplification as a template. In the invention, the primer sequence of the reverse PCR second round amplification is preferably shown as SEQ ID NO. 11-12 and SEQ ID NO. 15-16; in the present invention, the system for the second round of inverse PCR amplification preferably comprises: 4 μ L of 10 XPCR buffer, 3 μ L of 25mM MgCl ₂3 μ L of 2mM dNTP, 0.5 μ L of 10 μ M left and right primers, 2U of Taq DNA polymerase and 2 μ L of reverse PCR first round amplified product; in the invention, the reaction procedure of the second round amplification of the reverse PCR is preferably pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 1min, annealing at 57 ℃ for 1min, extension at 72 ℃ for 2min, and extension at 72 ℃ for 5min after 30 cycles. In the invention, the nested PCR is carried out by two rounds of primers, so that the specificity of a PCR product can be improved.

After obtaining the reverse PCR second round amplification product, the invention recovers the reverse amplification product and then sequences to obtain the rice genome sequence of the left boundary of the phytoene synthase gene psy and phytoene dehydrogenase gene crtI insertion site of the second T-DNA region, and the rice genome sequence of the right boundary of the insertion site. In the present invention, the sequencing is preferably performed on pEASY-T3 to obtain the rice genome sequence of the right border of the insertion site of the phytoene synthase gene psy and phytoene dehydrogenase gene crtI in the second T-DNA region and the rice genome sequence of the left border of the insertion site of the phytoene synthase gene psy and phytoene dehydrogenase gene crtI in the second T-DNA region, wherein the rice genome sequence of the right border is shown as SEQ ID NO. 7, and the rice genome sequence of the left border is shown as SEQ ID NO. 8.

After the rice genome sequences of the left boundary of the phytoene synthase gene psy and the phytoene dehydrogenase gene crtI insertion site of the second T-DNA region, the rice genome sequences of the right boundary and the left boundary are compared with the whole rice genome, and the insertion site of the genes can be determined.

In the present invention, in order to verify the correctness of the target gene insertion site, it is preferable to further include PCR detection, when the left border sequence is subjected to PCR detection, the preferable primer sequences are shown as SEQ ID nos. 11 and 19, and the PCR detection system preferably includes: 50ng of DNA template, 2.0. mu.L of 10 XPCR buffer, 1.5. mu.L of 2mM dNTP, 25mM MgCl₂2.0. mu.L of each 10. mu.M primer (F/R) 0.4. mu.L, sterilized ddH₂O to 20 μ L; the procedure for the PCR detection was: 5min at 94 ℃; 94 ℃ for 1min,55 ℃ for 1min, 72 ℃ for 1.5min, 35 cycles; 5min at 72 ℃; when the foreign gene insertion site of GRH is detected, the DNA template is preferably the total DNA of GRH; when the insertion site of the foreign gene of the black golden rice is detected, the DNA template is preferably the total DNA of the black golden rice.

In the present invention, when the right border sequence is detected by PCR, the preferred primer sequences are shown as SEQ ID NO. 20 and SEQ ID NO. 16, and the PCR detection system preferably comprises: DNA template 50ng, 10 XPCRbuffer 2.0. mu.L, 2mM dNTP 1.5. mu.L, 25mM MgCl₂2.0. mu.L of each 10. mu.M primer (F/R) 0.4. mu.L, sterilized ddH₂O to 20 μ L; the procedure for the PCR detection was: 5min at 94 ℃; 94 ℃ for 1min,55 ℃ for 1min, 72 ℃ for 1.5min, 35 cycles; 5min at 72 ℃; the DNA template is preferably total DNA, more preferably total DNA extracted from leaves.

The cultivation method of black golden rice provided by the present invention is described in detail with reference to the following examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Construction of plant expression vector and agrobacterium-mediated air-cultured 131 genetic transformation:

artificially synthesizing a phytoene synthase gene psy (2765bp) with a5 ' end modified with a glutelin promoter and a HindIII enzyme cutting site, a 3 ' end modified with a nos terminator and a Sal I enzyme cutting site, a5 ' end modified with a glutelin promoter and an EcoR I enzyme cutting site, and a phytoene dehydrogenase gene crtI (5760bp) with a nos terminator and a Kpn I enzyme cutting site;

the final expression vector pCAMBIA1300 containing double T-DNA regions is used as an expression vector to construct a pC1300 dT-psy/crtI: firstly, carrying out double digestion on psy by HindIII and Sal I, and then connecting the psy to a pCAMBIA1300 vector containing double T-DNA regions which is also subjected to double digestion by HindIII and Sal I to form an intermediate vector pC1300 dT-psy; then, carrying out double digestion on crtI by using EcoR I and Kpn I, and then connecting to a pC1300dT-psy vector which is also subjected to double digestion by using EcoR I and Kpn I to obtain a final expression vector pC1300dT-psy/crtI, wherein the structural schematic diagram of pC1300dT-psy/crtI is shown in FIG. 1 b;

in the method for transforming the pC1300dT-psy/crtI expression vector into the japonica rice variety vacant 131 by using an agrobacterium-mediated genetic transformation method, the agrobacterium-mediated genetic transformation comprises the following specific steps:

(1) callus induction:

mature air-cultured 131 rice seeds are subjected to shelling treatment, then are sequentially treated with 75% ethanol for 1 minute, and the surfaces of 0.15% mercuric chloride seeds are disinfected for 20 minutes. Washing the seeds with sterilized single-steaming water for 4-5 times, and uniformly placing the seeds on an induction culture medium. Culturing the inoculated culture medium in a dark room for 4-6 weeks at 28 +/-1 ℃;

(2) callus subculture

Picking out bright yellow compact and relatively dry embryogenic callus, and culturing on a subculture medium in a dark room for 3 weeks at 28 +/-1 ℃;

(3) preculture

Picking compact and relatively dry embryogenic callus, and culturing for 4 days on a pre-culture medium under the dark condition at the temperature of 28 +/-1 ℃;

(4) agrobacterium culture

Pre-culturing agrobacterium on LA culture medium with carbenicillin for 2 days at 28 +/-1 ℃; transferring the agrobacterium to a suspension culture medium, and culturing for 2-3h on a shaking table at the temperature of 28 ℃ and the speed of 200 rpm;

(5) infection with Agrobacterium

Transferring the pre-cultured calli into sterilized bottles; adjusting the suspension of Agrobacterium to OD₆₀₀About 0.3; soaking the callus in Agrobacterium tumefaciens suspension for 10 min; transferring the callus to sterilized filter paper, blotting, and culturing in co-culture medium for 3dThe temperature is 19-20 ℃;

(6) callus wash and selection culture

Washing infected calluses with sterilized water for 7-8 times, and then soaking in sterilized water containing 400mg/L carbenicillin for 30 min; transferring the callus to sterilized filter paper, and after drying, transferring the callus to a selective culture medium for selective culture for 3 times, wherein each time is 2 weeks;

(7) differentiation

Transferring the resistant callus to a pre-differentiation culture medium to be cultured for 7 days in a dark place at the temperature of 26 +/-1 ℃; transferring the pre-differentiated cultured callus to a differentiation culture medium, and culturing under illumination at the temperature of 26 +/-1 ℃;

(8) rooting

Cutting off roots generated during differentiation; then transferring the strain to a rooting culture medium, and culturing for 2-3 weeks under illumination at the temperature of 26 +/-1 ℃;

(9) transplanting

Washing the residual culture medium on the roots clean, transferring T0 generation seedlings with good root system into a greenhouse, and keeping the moisture wet in the first few days;

the resulting T0 generation pC1300dT-psy/crtI transformed plants were grown to seed in small pots under natural light conditions in the greenhouse.

Example 2

PCR detection of transgenic plants and screening of marker-free families:

taking 2cm leaf tissues of T0 generation plants from individual plants, and extracting the genomic DNA of the rice in a small amount by a CTAB method; specific primers were designed for gene amplification, the primer sequences are shown in table 1:

TABLE 1 primers for PCR detection of transgenic plants

And (2) carrying out detection by using PCR, carrying out 0.8% agarose gel electrophoresis detection on a PCR product, screening out T0 generation regenerated plants of which the amplification of the three primers is positive, finally obtaining 17 positive T0 generation transformed seedlings, carrying out PCR detection on all descendants of the T1 generation plants by using the primers of SEQ ID NO: 1-2, wherein the PCR detection result is shown in figure 2a, and the result shows that one T1 generation plant has NO amplification band, is named as GRH, shows that the hpt marker gene is separated, and the Southern hybridization verification result is shown in figure 2b, and proves that the GRH has a target gene and is inserted in a single copy way. GRH was selfed to T3 generations, and T3 generations of pedigrees of 30 GRH were planted, with 100 plants planted per pedigree. PCR detection is carried out on each plant by using primers of SEQ ID NO. 3-4 (for detecting psy gene) and primers of SEQ ID NO. 5-6 (for detecting crtI gene). The PCR reaction system is as follows: 2 mul of DNA template; 2. mu.l of 10 xbuffer; 2. mu.l of 2mM dNTP; primers of SEQ ID NO 3-4 or primers of SEQ ID NO 5-6 are 0.2 mul each; R-Taq (Takara, Dalian) 0.2. mu.l; and dd H2O to 20. mu.l. The conditions of the PCR reaction were: 5min at 94 ℃; 94 ℃ 30sec, 58 ℃ 30sec, 72 ℃ 45sec, 28 cycles; 7min at 72 ℃. The PCR products are detected by 0.8% agarose gel electrophoresis, and the sizes of the PCR products of the primers SEQ ID NO. 3-4 and SEQ ID NO. 5-6 are 901bp and 820bp respectively. If all 100 plants in one family are positive through PCR detection of two pairs of primers SEQ ID NO. 3-4 and SEQ ID NO. 5-6, the family is a homozygous GRH family.

Example 3

GRH and black rice hybrid transformation

The method comprises the steps of hybridizing a homozygous GRH family line rich in beta-carotene with a black commander (HS) variety rich in anthocyanin in seed coats, backcrossing by taking the black commander as a recurrent parent, and then selfing and homozygous. And selecting single plants with plant height, effective spike number, seed number per spike, thousand seed weight, seed setting rate and single plant yield which are consistent with HS from the hybridization of GRH and HS and backcross progeny BC3F2, wherein the single plants are positive by the PCR detection of the foreign genes psy and crtI. Seeds of the selected plants, with a black seed coat and yellow endosperm. The plants were further selfed homozygous to obtain a line designated "black gold rice". The cultivation process of black golden rice is shown in fig. 3 a.

Example 4

And (3) separating the flanking sequences of the foreign genes of the black golden rice:

the reverse PCR strategy is adopted to separate flanking sequences at two sides of the foreign gene insertion site of the donor parent GRH of the black golden rice.

First, leaves of GRH were collected and total DNA was extracted. Mu.g of total DNA was digested with 30U of restriction enzyme Kpn I for 16h in a 50. mu.L reaction and then purified by the following specific steps:

adding 150 mu L of ddH into an enzyme digestion reaction system₂O, adding 200 mu L chloroform/isoamyl alcohol (24:1), and oscillating for 5 min;

② centrifuging at 12000r/min for 5min, absorbing 180 μ L supernatant and transferring to a new centrifuge tube;

③ adding 20 mu L of 3M NaAc and 400 mu L of frozen absolute ethyl alcohol, mixing evenly and then placing for 30min at minus 20 ℃;

fourthly, freezing and centrifuging at 12000r/min for 20min, and pouring out supernatant;

fifthly, adding 500 mu L of 75% ethanol for washing, then centrifuging at 12000r/min for 5min, and pouring out the supernatant;

sixthly, after naturally drying, 50 mu L of ddH is added₂And dissolving the O.

The purified product was self-ligated with 10U of T4DNALigase for 16h at 16 ℃ in a 100. mu.L reaction system. Then, the self-ligation product is taken as a template to carry out reverse PCR first round amplification, and the primer sequences are shown in Table 2 and respectively

SEQ ID NO

9 and 10, SEQ ID NO 13 and SEQ ID NO 14; the second round of amplification uses the product of the first round as a template and primers

SEQ ID NO

11 and 12, SEQ ID NO 15 and SEQ ID NO 16.

TABLE 2 primer information for reverse PCR

The first round of PCR reaction system was 40. mu.L in total volume, which included 4. mu.L of 10 XPCR buffer, 3. mu.L of 25mM MgCl2, 3. mu.L of 2mM dNTP, 0.5. mu.L of 10. mu.M left and right primers, 2U of Taq DNA polymerase and 2. mu.L ligation product. The PCR reaction program comprises pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 1min, annealing at 55 ℃ for 1min, extension at 72 ℃ for 2min, and extension at 72 ℃ for 5min after 32 cycles. The second round of PCR reaction system is the same as the first round, and the reaction program is pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 1min, annealing at 57 ℃ for 1min, extension at 72 ℃ for 2min, and extension at 72 ℃ for 5min after 30 cycles.

The amplified products were electrophoresed on 0.8% agarose gel with 0.5 XTBE, and the target fragments were excised, recovered, and cloned into pEASY-T3 (all gold) for sequencing. According to the sequencing result, a rice genome sequence (SEQ ID NO:7) of the right border insertion site of the T-DNA and a rice genome sequence (SEQ ID NO:8) of the left border insertion site of the T-DNA are respectively obtained.

Experimental example 1

The agronomic traits of the GRH obtained using example 2 were compared to wild type aerial breeding 131 and the results are shown in table 3:

TABLE 3 agronomic performance comparison of GRH with wild type aerial breeding 131

Note: in Table 3, GRH is the individual plant data, and the average value of 10 plant data is found in the air culture 131

As can be seen from table 3, the main agronomic traits of GRH were not significantly different from those of wild type air-bred 131, but the groh rice seeds were characteristically golden yellow after shelling, and were significantly different from those of wild type air-bred 131, as shown in fig. 2 c.

Experimental example 2

The black gold rice obtained in example 3 was subjected to conventional liquid chromatography, and the analysis results are shown in table 4:

TABLE 4 different Rice materials brown rice beta-carotene, lutein and anthocyanidin contents (μ g/g)

As can be seen from Table 4, the brown rice of black rice was rich in anthocyanins (1187.9. mu.g/g), xanthophylls (34.95. mu.g/g) and beta-carotene (11.50. mu.g/g). In contrast, brown rice, the donor parent GRH of black rice, contains only beta-carotene (3.72 μ g/g) and low lutein (2.14 μ g/g), no anthocyanins; the recurrent parent HS is rich in anthocyanin (1187.9 μ g/g), but the content of lutein (22.45 μ g/g) and beta-carotene (0.31 μ g/g) is significantly lower than black gold rice. The nutritive value of black golden rice is obviously higher than that of the two parents GRH and HS.

Experimental example 3

Detecting the insertion site of the GRH target gene:

the sequencing result of example 4 was aligned with the complete genome sequence of Minghui 63 (http:// rice. hzau. edu. cn/rice /) to determine the insertion site of the target gene fragment. Through analysis and comparison, the target gene fragment is inserted into the 5059344 base site on the No. 12 chromosome of the rice genome, and 137bp (5059345-5059481) genome deletion is caused. The target gene is inserted between two genes MH12g0118700 and MH12g0118800, and the upstream nearest gene MH12g0118700 is about 9.5kb and the downstream nearest gene MH12g0118800 is about 15.9 kb. Therefore, theoretically, the GRH exogenous gene insertion does not cause the inactivation of the rice endogenous gene expression.

Experimental example 4

Characteristic PCR detection of GRH target gene insertion site:

primers for characteristic PCR detection of the target gene insertion site are respectively designed according to flanking sequences at two ends of the GRH target gene insertion site and the foreign gene insertion sequence, wherein the primer sequences are shown in Table 5.

Table 5 primers for PCR detection characteristic of target gene insertion site

Primer and method for producing the same	Sequence of
		SEQ ID NO:11	GCGGTTTGCGTATTGGCTAG
SEQ ID NO:19	GGAAGATGTCCTGTTGCCCA
		SEQ ID NO:16	CTGGCCGTCGTTTTACAAC
SEQ ID NO:20	TCCGTACAAGGTGGTGGTCA

The PCR reaction system is as follows: 50ng of DNA template, 2.0. mu.L of 10 XPCR buffer, 1.5. mu.L of 2mMd NTP, 25mM MgCl22.0. mu.L of each, 0.4. mu.L of 10. mu.M primers (F/R), and sterile ddH2O to 20. mu.L. The PCR amplification reaction program is as follows: 5min at 94 ℃; 94 ℃ for 1min,55 ℃ for 1min, 72 ℃ for 1.5min, 35 cycles; 5min at 72 ℃. The amplification product is detected by electrophoresis on 0.8% agarose gel, the detection result is shown in figure 5, and the left border flanking sequence, the right border flanking sequence and the insertion site are accurate.

According to the embodiment, the black golden rice bred by the breeding method is rich in anthocyanin, lutein and beta-carotene and much higher in nutritive value than two parents, the target gene insertion site of the intermediate strain GRH is 5059344 basic site on chromosome 12 of a rice genome, 137bp (5059345-5059481) genome deletion is caused, the target gene is inserted between MH12g0118700 and MH12g0118800, and according to the upstream nearest gene MH12g0118700, about 9.5kb and the downstream nearest gene MH12g0118800, about 15.9 kb. Therefore, theoretically, the GRH exogenous gene insertion cannot cause the inactivation of the rice endogenous gene expression, and the method has good commercialization potential.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Wuhan space Biotechnology GmbH

<120> cultivation of transgenic rice GRH and black golden rice and detection method of GRH target gene

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> DNA

<213> Rice

<400> 1

agaatctcgt gctttcagct tcga 24

<210> 2

<211> 24

<212> DNA

<213> Rice

<400> 2

tcaagaccaa tgcggagcat atac 24

<210> 3

<211> 18

<212> DNA

<213> Rice

<400> 3

gtccgagcag aaggtcta 18

<210> 4

<211> 20

<212> DNA

<213> Rice

<400> 4

gaagttgttg tagtcgttgg 20

<210> 5

<211> 20

<212> DNA

<213> Rice

<400> 5

caacactgac attacttcca 20

<210> 6

<211> 18

<212> DNA

<213> Rice

<400> 6

cacggcttca atcttgtt 18

<210> 7

<211> 675

<212> DNA

<213> Rice

<400> 7

tccgtacaag gtgtggtcat ctcattgtgc aaagttggtt gatgatgtta cctataacaa 60

cattgattgg tgatggtttg gcatcgatga gcgtggactc gcaaacacga agtcttcttt 120

atagtactac tacactaata attactcgca aacatgagta ataatgtttc acgtacgttg 180

attgactaga atagaagaaa tctaggatgc tagggtgtac aatcaagtgg aaaaggggct 240

cgattggggc atcgggaagt taggccttgt ttagttccta atttttttta aaaaaaacgt 300

cacatcgaat ctttgacaca tgtatgaagc attaaattta gataaaatga aaaactaatt 360

gcacagtttg tattgaatcg tgagacgaat cttttaagac taattagttc ataattagcc 420

ataagtacta tagtaacccg tatatgctaa tggcatatta attaggctta ataaattcgt 480

ctcgtggttt ccatgcgagt tatgaaatta gttttttcat tcatgtccga aaaccctttc 540

cgatatccag tcaaacgttc gatgtgacac ccaaaaattt tcttttcagt agcacatgag 600

gcgagtgtgc tgcatgcaac ttaataataa ttggcctgat ggattggaaa tttgccagga 660

caacggtcaa cggac 675

<210> 8

<211> 850

<212> DNA

<213> Rice

<400> 8

ctaaaatcat tcaaccattc ttaggttaac tgaactagga aaacaatctt cctaataaat 60

cctaacagca gaatagatcg acaggaagct ccgacgatag atgtctgcat atacgaagcg 120

cgtgactatt tatatgcatg cacaagttta cattagagca aaatactata agatcgtgta 180

aacggattca tagaattcga tgacgtatta gtattattaa tatatatcta aatattgtat 240

gagttaacta gatgatatga caacaaatag agccaatagt taactcatag aatttatcta 300

ttgtttctaa aagtgacacg tgtaattatg tgatgaggtg gagtagaaag gtaggaagag 360

agaatgagcc acaccctcat ataaaaaaca atatctacat aatctccaag aaaaaagtga 420

aatctagtaa aaatatgaag agagtgaacc aacaaaaaaa aattattacg atttgtatat 480

taaagtaata cgttatatat actattatct tttaactttt aactaatgaa ttagtgatat 540

ggttaaaatt agaggtagta gttattttca acttgttctt atggtctcgt cagctacatt 600

tggccacaag ttcagttagg tgtgacttga caaaggcacc atgtgagctg acaagatata 660

cctagtggca acatggcagt tagatcgtca tgggttgacg agagatagcg tcaacaaagc 720

tattgatagt atatataggt atatcgaaga tctacatata tactacatac tacgtacttg 780

atagtacatg tattatatat cttttccgta ttattacatc gacatacaat tgggcaacag 840

gacatcttcc 850

<210> 9

<211> 20

<212> DNA

<213> Rice

<400> 9

gggtttctta tccggggtga 20

<210> 10

<211> 20

<212> DNA

<213> Rice

<400> 10

ctcactttat ctgcacgcgc 20

<210> 11

<211> 20

<212> DNA

<213> Rice

<400> 11

gcggtttgcg tattggctag 20

<210> 12

<211> 20

<212> DNA

<213> Rice

<400> 12

cgacagcagg tttgatgctg 20

<210> 13

<211> 20

<212> DNA

<213> Rice

<400> 13

cgctactgct cccatgttca 20

<210> 14

<211> 20

<212> DNA

<213> Rice

<400> 14

tgtggtacac gaaaggtgga 20

<210> 15

<211> 20

<212> DNA

<213> Rice

<400> 15

tgccggtctt gcgatgatta 20

<210> 16

<211> 19

<212> DNA

<213> Rice

<400> 16

ctggccgtcg ttttacaac 19

<210> 17

<211> 2765

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

aagcttgtta atcatggtgt aggcaaccca aataaaacac caaaatatgc acaaggcagt 60

ttgttgtatt ctgtagtaca gacaaaacta aaagtaatga aagaagatgt ggtgttagaa 120

aaggaaacaa tatcatgagt aatgtgtgag cattatggga ccacgaaata aaaagaacat 180

tttgatgagt cgtgtatcct cgatgagcct caaaagttct ctcaccccgg ataagaaacc 240

cttaagcaat gtgcaaagtt tgcattctcc actgacataa tgcaaaataa gatatcatcg 300

atgacatagc aactcatgca tcatatcatg cctctctcaa cctattcatt cctactcatc 360

tacataagta tcttcagcta aatgttagaa cataaaccca taagtcacgt ttgatgagta 420

ttaggcgtga cacatgacaa atcacagact caagcaagat aaagcaaaat gatgtgtaca 480

taaaactcca gagctatatg tcatattgca aaaagaggag agcttataag acaaggcatg 540

actcacaaaa attcatttgc ctttcgtgtc aaaaagagga gggctttaca ttatccatgt 600

catattgcaa aagaaagaga gaaagaacaa cacaatgctg cgtcaattat acatatctgt 660

atgtccatca ttattcatcc acctttcgtg taccacactt catatatcat gagtcacttc 720

atgtctggac attaacaaac tctatcttaa catttagatg caagagcctt tatctcacta 780

taaatgcacg atgatttctc attgtttctc acaaaaagca ttcagttcat tagtcctaca 840

acaacctgca gagatagcaa atatatggcc atcatactcg tacgagcagc gtcgccgggg 900

ctctccgccg ccgacagcat cagccaccag gggactctcc agtgctccac cctgctcaag 960

acgaagaggc cggcggcgcg gcggtggatg ccctgctcgc tccttggcct ccacccgtgg 1020

gaggctggcc gtccctcccc cgccgtctac tccagcctgc ccgtcaaccc ggcgggagag 1080

gccgtcgtct cgtccgagca gaaggtctac gacgtcgtgc tcaagcaggc cgcattgctc 1140

aaacgccagc tgcgcacgcc ggtcctcgac gccaggcccc aggacatgga catgccacgc 1200

aacgggctca aggaagccta cgaccgctgc ggcgagatct gtgaggagta tgccaagacg 1260

ttttacctcg gaactatgtt gatgacagag gagcggcgcc gcgccatatg ggccatctat 1320

gtgtggtgta ggaggacaga tgagcttgta gatgggccaa acgccaacta cattacacca 1380

acagctttgg accggtggga gaagagactt gaggatctgt tcacgggacg tccttacgac 1440

atgcttgatg ccgctctctc tgataccatc tcaaggttcc ccatagacat tcagccattc 1500

agggacatga ttgaagggat gaggagtgat cttaggaaga caaggtataa caacttcgac 1560

gagctctaca tgtactgcta ctatgttgct ggaactgtcg ggttaatgag cgtacctgtg 1620

atgggcatcg caaccgagtc taaagcaaca actgaaagcg tatacagtgc tgccttggct 1680

ctgggaattg cgaaccaact cacgaacata ctccgggatg ttggagagga tgctagaaga 1740

ggaaggatat atttaccaca agatgagctt gcacaggcag ggctctctga tgaggacatc 1800

ttcaaagggg tcgtcacgaa ccggtggaga aacttcatga agaggcagat caagagggcc 1860

aggatgtttt ttgaggaggc agagagaggg gtaactgagc tctcacaggc tagcagatgg 1920

ccagtatggg cttccctgtt gttgtacagg cagatcctgg atgagatcga agccaacgac 1980

tacaacaact tcacgaagag ggcgtatgtt ggtaaaggga agaagttgct agcacttcct 2040

gtggcatatg gaaaatcgct actgctccca tgttcattga gaaatggcca gacctagcca 2100

ccagagaagc tgcaatgcaa ggttcaggtt aggctagata gaaagttaaa tggggcaaca 2160

tcaggaggcc ttgatgaaaa acagacaacc tggtgaattg ttgttgggat caggcacaga 2220

acagataaga gccgcgcagc caacctagat ggatacggaa cattcgcctc ttattcggag 2280

caatatatgt ctctcaagga aagagcccaa catgtatact gccttctttt tctcatccca 2340

gatttggggg aaaaacaatg taaatgccaa tggtatcgta ggaagattac tagaagtaaa 2400

tgccaatgta aaaacagatg agttggcatt tacatgatag gatggtggga tcatcagact 2460

gaaaatgata ggggattgtg ctccccctgc gactccaact attaaaatcg ttcaaacatt 2520

tggcaataaa gtttcttaag attgaatcct gttgccggtc ttgcgatgat tatcatataa 2580

tttctgttga attacgttaa gcatgtaata attaacatgt aatgcatgac gttatttatg 2640

agatgggttt ttatgattag agtcccgcaa ttatacattt aatacgcgat agaaaacaaa 2700

atatagcgcg caaactagga taaattatcg cgcgcggtgt catctatgtt actagatcgg 2760

tcgac 2765

<210> 18

<211> 2760

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gaattcgtta atcatggtgt aggcaaccca aataaaacac caaaatatgc acaaggcagt 60

ttgttgtatt ctgtagtaca gacaaaacta aaagtaatga aagaagatgt ggtgttagaa 120

aaggaaacaa tatcatgagt aatgtgtgag cattatggga ccacgaaata aaaagaacat 180

tttgatgagt cgtgtatcct cgatgagcct caaaagttct ctcaccccgg ataagaaacc 240

cttaagcaat gtgcaaagtt tgcattctcc actgacataa tgcaaaataa gatatcatcg 300

atgacatagc aactcatgca tcatatcatg cctctctcaa cctattcatt cctactcatc 360

tacataagta tcttcagcta aatgttagaa cataaaccca taagtcacgt ttgatgagta 420

ttaggcgtga cacatgacaa atcacagact caagcaagat aaagcaaaat gatgtgtaca 480

taaaactcca gagctatatg tcatattgca aaaagaggag agcttataag acaaggcatg 540

actcacaaaa attcatttgc ctttcgtgtc aaaaagagga gggctttaca ttatccatgt 600

catattgcaa aagaaagaga gaaagaacaa cacaatgctg cgtcaattat acatatctgt 660

atgtccatca ttattcatcc acctttcgtg taccacactt catatatcat gagtcacttc 720

atgtctggac attaacaaac tctatcttaa catttagatg caagagcctt tatctcacta 780

taaatgcacg atgatttctc attgtttctc acaaaaagca ttcagttcat tagtcctaca 840

acaacgagct catggcttct atgatatcct cttccgctgt gacaacagtc agccgtgcct 900

ctagggggca atccgccgca gtggctccat tcggcggcct caaatccatg actggattcc 960

cagtgaagaa ggtcaacact gacattactt ccattacaag caatggtgga agagtaaagt 1020

gcatgaaacc aactacggta attggtgcag gcttcggtgg cctggcactg gcaattcgtc 1080

tacaagctgc ggggatcccc gtcttactgc ttgaacaacg tgataaaccc ggcggtcggg 1140

cttatgtcta cgaggatcag gggtttacct ttgatgcagg cccgacggtt atcaccgatc 1200

ccagtgccat tgaagaactg tttgcactgg caggaaaaca gttaaaagag tatgtcgaac 1260

tgctgccggt tacgccgttt taccgcctgt gttgggagtc agggaaggtc tttaattacg 1320

ataacgatca aacccggctc gaagcgcaga ttcagcagtt taatccccgc gatgtcgaag 1380

gttatcgtca gtttctggac tattcacgcg cggtgtttaa agaaggctat ctgaagctcg 1440

gtactgtccc ttttttatcg ttcagagaca tgcttcgcgc cgcacctcaa ctggcgaaac 1500

tgcaggcatg gagaagcgtt tacagtaagg ttgccagtta catcgaagat gaacatctgc 1560

gccaggcgtt ttctttccac tcgctgttgg tgggcggcaa tcccttcgcc acctcatcca 1620

tttatacgtt gatacacgcg ctggagcgtg agtggggcgt ctggtttccg cgtggcggca 1680

ccggcgcatt agttcagggg atgataaagc tgtttcagga tctgggtggc gaagtcgtgt 1740

taaacgccag agtcagccat atggaaacga caggaaacaa gattgaagcc gtgcatttag 1800

aggacggtcg caggttcctg acgcaagccg tcgcgtcaaa tgcagatgtg gttcatacct 1860

atcgcgacct gttaagccag caccctgccg cggttaagca gtccaacaaa ctgcagacta 1920

agcgcatgag taactctctg tttgtgctct attttggttt gaatcaccat catgatcagc 1980

tcgcgcatca cacggtttgt ttcggcccgc gttaccgcga gctgattgac gaaattttta 2040

atcatgatgg cctcgcagag gacttctcac tttatctgca cgcgccctgt gtcacggatt 2100

cgtcactggc gcctgaaggt tgcggcagtt actatgtgtt ggcgccggtg ccgcatttag 2160

gcaccgcgaa cctcgactgg acggttgagg ggccaaaact acgcgaccgt atttttgcgt 2220

accttgagca gcattacatg cctggcttac ggagtcagct ggtcacgcac cggatgttta 2280

cgccgtttga ttttcgcgac cagcttaatg cctatcatgg ctcagccttt tctgtggagc 2340

ccgttcttac ccagagcgcc tggtttcggc cgcataaccg cgataaaacc attactaatc 2400

tctacctggt cggcgcaggc acgcatcccg gcgcaggcat tcctggcgtc atcggctcgg 2460

caaaagcgac agcaggtttg atgctggagg atctgatatg aatcgttcaa acatttggca 2520

ataaagtttc ttaagattga atcctgttgc cggtcttgcg atgattatca tataatttct 2580

gttgaattac gttaagcatg taataattaa catgtaatgc atgacgttat ttatgagatg 2640

ggtttttatg attagagtcc cgcaattata catttaatac gcgatagaaa acaaaatata 2700

gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag atcgggtacc 2760

<210> 19

<211> 20

<212> DNA

<213> Rice

<400> 19

ggaagatgtc ctgttgccca 20

<210> 20

<211> 20

<212> DNA

<213> Rice

<400> 20

tccgtacaag gtggtggtca 20

Claims

1. The method for cultivating black golden rice by using GRH as a parent comprises the following steps:

1) PCR screening of progeny plants of the GRHpsyAndcrtIhybridizing the dominant homozygous plant with the black rice to obtain an F1 generation; the black rice variety is black commander;

3) selfing and selecting the BC3F1 generationpsyAndcrtIobtaining black golden rice after dominant homozygous progeny plants;

the GRH cultivation method comprises the following steps:

firstly, transferring a target gene into an expression vector containing double T-DNA regions to obtain a final expression vector, wherein the double T-DNA regions comprise a first T-DNA region and a second T-DNA region, and the first T-DNA region is connected with a first T-DNA regionhptA marker gene, said second T-DNA region linked to a gene of interest; the target gene is phytoene synthase genepsyAnd phytoene dehydrogenase genecrtI(ii) a The phytoene synthase genepsyModified with glutelin promoter at the 5' end of (A) andHindIII restriction enzyme site, 3' end is modified with nos terminator andSali enzyme cutting site, modified phytoene synthase genepsyThe nucleotide sequence of (A) is shown as SEQ ID NO. 17;

the phytoene dehydrogenase genecrtIModified with glutelin promoter at the 5' end of (A) andEcoRi enzyme cutting site, 3' end is modified with nos terminator andKpni enzyme cutting site, modified phytoene dehydrogenase genecrtIThe nucleotide sequence of (A) is shown as SEQ ID NO. 18Shown;

the expression vector containing the double T-DNA regions is obtained by modifying the expression vector pCAMBIA 1300;

secondly, transforming the final expression vector into japonica rice variety null-bred 131 by utilizing an agrobacterium-mediated genetic transformation method to obtain T0 generation transformed plants;

thirdly, screening the T0 generation transformed plants by using PCRpsy、crtIAndhptcarrying out selfing and fructification on the plants which are all positive to obtain T1 generation transformed plants;

screening none of the T1 generation transformed plantshptThe expressed plant is used for obtaining a transgenic japonica rice variety named as GRH;

the construction method of the expression vector containing the double T-DNA regions comprises the following steps:

a) by usingBstXI and XIXhoI double restriction enzyme expression vector pCAMBIA1300, removal of CaMV35S promoter andhpta coding region segment of the gene, resulting in the intermediate vector pMF comprising a second T-DNA region;

b) by usingSacI andHindIII, double enzyme digestion of the expression vector pCAMBIA1300, and removal of a multiple cloning site section to obtain an intermediate vector pC 1300E;

c) to the intermediate vector pC1300E obtained in step b)SphI the site of enzyme is close toEcoRI one side introductionSacII, enzyme cutting sites, and constructing an intermediate vector pC1300 ES;

d) removing the intermediate vector pC1300ES obtained in step c)EcoRI, enzyme cutting site to obtain an intermediate vector pC1300 NES;

e) by usingSacII enzyme digestion of the intermediate vector pC1300NES obtained in step d) to obtain a vectorhptA first T-DNA region segment of (a);

f) combining said intermediate vector pMF comprising a second T-DNA region obtained in step a) with said vector obtained in step e)hptThe first T-DNA region segments are connected to obtain an expression vector containing double T-DNA regions;

the step a) and the steps b), c), d) and e) are not limited in time sequence;

and step three, the sequence of the primer selected by the PCR screening is shown as SEQ ID NO 1-6.

2. The method for cultivating black golden rice according to claim 1, wherein the screened primer sequences in the step 1) are shown as primers of SEQ ID NO. 3-4 and SEQ ID NO. 5-6.

3. The method for cultivating black gold rice according to claim 1, wherein the BC3F1 generation seed of step 2) has a black seed coat and a yellow endosperm.