CN108384876A - Identify ring mediated isothermal amplification fluorescence detection method, primer, kit and the application of Radix Notoginseng ingredient - Google Patents
Identify ring mediated isothermal amplification fluorescence detection method, primer, kit and the application of Radix Notoginseng ingredient Download PDFInfo
- Publication number
- CN108384876A CN108384876A CN201810248004.XA CN201810248004A CN108384876A CN 108384876 A CN108384876 A CN 108384876A CN 201810248004 A CN201810248004 A CN 201810248004A CN 108384876 A CN108384876 A CN 108384876A
- Authority
- CN
- China
- Prior art keywords
- primer
- radix notoginseng
- amplification
- kit
- curve
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to ring mediated isothermal amplification fluorescence detection method, primer, kit and the applications of identification Radix Notoginseng ingredient, belong to technical field of biological.The new technique that the present invention is merged using nucleic acid in vitro rapid amplifying with detection technique of fluorescence, 6 special primers are designed by being directed to target fragment, the reaction process for monitoring entire isothermal duplication nucleic acid replication in real time by increasing curve, solubility curve analysis is done to product.The present invention establishes identification Radix Notoginseng ingredient loop-mediated isothermal amplification method, the fast qualitative detection for whether carrying out DNA levels in sample sheet containing Radix Notoginseng can be treated, detection usage time is greatly reduced, realize the quick detection of Radix Notoginseng plan ingredient, it can computer experiment without purifying after DNA extractions, 6 primer pairs answer the identification of 8 specific regions of target sequence to ensure that the high degree of specificity of detection reaction, have a good application prospect.
Description
Technical field
The invention belongs to technical field of biological, more particularly to identify the ring mediated isothermal amplification fluorescence inspection of Radix Notoginseng ingredient
Survey method, primer, kit and application.
Background technology
Radix Notoginseng is China's tradition rare traditional Chinese medicine, one of 40 kinds of bulk medicinal materials kinds, away from the modern application for having more than 400 years
History at home and abroad has long enjoyed a good reputation, and Radix Notoginseng just has the laudatory title of " hemostasis god's medicine " from ancient times.Due to the unique apparent effect of Radix Notoginseng, more
More common people start to take in daily life；The Chinese patent drug for doing raw material with it is related to pharmacy corporation more than 1350 up to more than 360 kinds
Family；It holds at high price, and the undulipodium of price is to influence the pharmacy corporation of thousands of families.Not it is well known that Radix Notoginseng city
The confusion that field hides behind, what is stealthily corroded is the health of consumer.
Because Radix Notoginseng is expensive, there are many criminals to reap staggering profits, mix the spurious with the genuine, adulterate, for purchase
The client of Radix Notoginseng makes troubles, and water Radix Notoginseng, Bulbilus boussingaultiae pseudobaselloidis, curcuma zedoary etc. are all adulterated doping because similar with Radix Notoginseng shape or character
Frequent goal, the Radix Notoginseng powder after in addition processing then are easier to juggle things.Therefore, as can establishing a kind of quick detection of gene level
Method, the above problem will be readily solved.
The islands Huan Jie isothermal amplification technique（LAMP）Novel molecular diagnostic techniques, reaction process under constant temperature into
Row makes by archaeal dna polymerase added with special strand-displacement activity and for the primer sets of target gene specific fragment design
Nucleic acid is completed under constant temperature, is had quickly, sensitive and special advantage.The detection that real-time fluorescence method is combined with LAMP technology
Mode then so that detection is more accurate and intuitive, can do annealing solubility curve point after nucleic acid replication amplified reaction to product
Whether analysis, solubility curve can the firm nucleic acid amplification product be further specific amplifications.It is more and more tested in recent years
Person be applied to it is actually detected in, it is accurate, efficiently, it is simple, quickly, it is special, be very suitable for Radix Notoginseng kind and quickly detect.
Invention content
It is an object of the present invention to solve the deficiency of the existing technology and provide a kind of quick, accurate, sensitive, easy to operate
Identification Radix Notoginseng ingredient ring mediated isothermal amplification fluorescence detection method, primer and kit.
To achieve the above object, the technical solution adopted by the present invention is as follows：
Identify the loop-mediated isothermal amplification (LAMP) primer of Radix Notoginseng ingredient, including external primers to, internal primer pair and ring primer pair；
The sequence of the external primers pair is：
Upstream outer primers F 3:atacgattagcaatgtcctcc；
Downstream outer primer B3:ccttgttgtgagctggtg；
The sequence of the internal primer pair is：
Upstream internal primers F IP:cagtgggcggatcaaagtacaacttgtcacggtccttaacc；
Downstream inner primer BIP:aggcataaccagcattggcattgtggatggaactcaacg；
The sequence of the ring primer pair is：
Upper lantern primer LF:tgttgtggacgtatggcaa；
Lower lantern primer LB:cccaagctcaatgcttcaag.
The present invention provides the kit of the identification Radix Notoginseng ingredient containing above-mentioned amplimer.
It is further preferred that the kit further includes：Positive control template, negative control template and PCR reactions
Liquid；
The positive control template is the genomic DNA of Radix Notoginseng；
The negative control template is the genomic DNA of other plant.
It is further preferred that the positive control template is the genomic DNA of Panax notoginseng root.
It is further preferred that the negative control template is the genomic DNA of water Radix Notoginseng or the genome of curcuma zedoary
DNA。
It is further preferred that the amplification system of the kit is：
4 μ L of template,
3 5uM of upstream outer primers F, 1 μ L,
1 μ L of downstream outer primer B3 5uM,
1 μ L of upstream internal primers F IP 40uM,
1 μ L of downstream inner primer BIP 40uM,
Upper 1 μ L of lantern primer LF 20uM,
Lower 1 μ L of lantern primer LB 20uM,
PCR reacts concentrate 15ul,
Amount to 25 μ L.
It is further preferred that the working procedure of the kit is：Amplification program：65 DEG C of amplification 30min；Dissolving
Program：98-80 DEG C, 0.05 DEG C is a cycle.
The present invention also provides application of the above-mentioned amplimer in differentiating the Radix Notoginseng true and false.
The present invention goes back while providing application of the mentioned reagent box in differentiating the Radix Notoginseng true and false.
The present invention additionally provides the ring mediated isothermal amplification fluorescence detection methods of identification Radix Notoginseng ingredient, using mentioned reagent box
Or above-mentioned amplimer, include the following steps：
Step（1）, sample DNA is extracted using Plant Genome extracts kit；
Step（2）, using positive control template, negative control template, sample DNA to be detected as template prepare respectively as follows
Amplification system：
4 μ L of template,
3 5uM of upstream outer primers F, 1 μ L,
1 μ L of downstream outer primer B3 5uM,
1 μ L of upstream internal primers F IP 40uM,
1 μ L of downstream inner primer BIP 40uM,
Upper 1 μ L of lantern primer LF 20uM,
Lower 1 μ L of lantern primer LB 20uM,
PCR reacts concentrate 15ul,
Amount to 25 μ L；
Step（3）, the above-mentioned amplification system prepared is subjected to PCR reactions；Amplification program is set：65 DEG C of amplification 30min；Dissolving
Program：98-80 DEG C, 0.05 DEG C is a cycle, does amplification curve and solubility curve；
Step（4）, judged according to obtained amplification curve and solubility curve：
If amplification curve has apparent " S " type curve and solubility curve peak type single and more sharp, it is determined as positive knot
Fruit illustrates to contain Radix Notoginseng in sample；
There is not apparent " S " type curve in amplification curve, then is determined as negative findings, illustrates not containing Radix Notoginseng in sample；
Amplification curve has apparent " S " type curve, but solubility curve peak type is not single is determined as non-specific amplification, then needs to repeat to walk
Suddenly（1）Step（3）, judged later again according to above-mentioned determination method；
The testing result of positive control template is positive findings, and the testing result of negative control template is negative findings, then is to say
Bright experiment is effective, and otherwise experiment is invalid.
Amplification curve has apparent " S " type curve in the present invention, but solubility curve peak type is not single is determined as non-specific expansion
Increase, illustrates the result is that false positive, it is possible to other materials are doped with, so to re-start detection.
PCR reacts in concentrate containing archaeal dna polymerase, Buffer, dNTP, MgSO4, Betaine, fluorescent dye
Evagreen。
The new technique that the present invention is merged using nucleic acid in vitro rapid amplifying with detection technique of fluorescence, by being directed to mesh
Segment design 6 special primers, use the Novel DNA polymerase for having sp act（DNA BST polymerases）, add double-strand knot
The fluorescent dye of conjunction；The reaction process for monitoring entire isothermal duplication nucleic acid replication in real time by amplification curve, does product and dissolves
Tracing analysis；Nucleic acid is carried out qualitative or simple quantitative（Sxemiquantitative）.
Compared with prior art, the present invention advantage is：
（1）High specific：6 primer pairs answer the high special that the identification of 8 specific regions of target sequence ensure that detection is reacted
Property.
（2）The present invention establishes detection Radix Notoginseng ingredient loop-mediated isothermal amplification method, can treat in sample sheet whether contain three
Seven carry out the fast qualitative detection of DNA levels；
（3）It, can computer experiment without purifying after nucleic acid extraction using the present invention；
（4）Loop-mediated isothermal amplification method has been used, detection usage time is greatly reduced, has realized the quick of Radix Notoginseng plan ingredient
Detection；It is compared with traditional method, present invention detection only needs 15 to 20 minutes；And traditional PCR is detected at least 3 hours；
（5）Detection process is simplified, reduces and the profession of operating personnel is required.Layman is allow to smoothly complete inspection
Survey work；
（6）Kit of the present invention can be used in multiple detection platforms, is not only used in isothermal duplication fluorescence detector and quantifies
PCR instrument can also be carried out with that can be provided at other in equipment of steady temperature, such as metal bath.
Description of the drawings
Fig. 1 is the amplification curve that specificity experiments obtain；
Fig. 2 is the amplification curve that specificity experiments obtain.
Specific implementation mode
With reference to embodiment, the present invention is described in further detail.
It will be understood to those of skill in the art that the following example is merely to illustrate the present invention, and it should not be regarded as limiting this hair
Bright range.In the examples where no specific technique or condition is specified, according to technology or condition described in document in the art
Or it is carried out according to product description.Production firm person is not specified in material therefor or equipment, is that can be obtained by buying
Conventional products.
PCR reactions concentrate of the present invention is purchased from OptiGene Ltd., model Isothermal Master
Mix(IMM)
Plant Genome extracts kit of the present invention is TIANGEN Plant Genome extracts kits DP305.
Step（1）, sample DNA is extracted using Plant Genome extracts kit；
Step（2）, using positive control template, negative control template, sample DNA to be detected as template prepare respectively as follows
Amplification system：
4 μ L of template,
3 5uM of upstream outer primers F, 1 μ L,
1 μ L of downstream outer primer B3 5uM,
1 μ L of upstream internal primers F IP 40uM,
1 μ L of downstream inner primer BIP 40uM,
Upper 1 μ L of lantern primer LF 20uM,
Lower 1 μ L of lantern primer LB 20uM,
PCR reacts concentrate 15ul,
Amount to 25 μ L；
The sequence of the external primers pair is：
Upstream outer primers F 3:atacgattagcaatgtcctcc；（SEQ ID NO.1）
Downstream outer primer B3:ccttgttgtgagctggtg；（SEQ ID NO.2）
The sequence of the internal primer pair is：
Upstream internal primers F IP:cagtgggcggatcaaagtacaacttgtcacggtccttaacc；（SEQ ID NO.3）
Downstream inner primer BIP:aggcataaccagcattggcattgtggatggaactcaacg；（SEQ ID NO.4）
The sequence of the ring primer pair is：
Upper lantern primer LF:tgttgtggacgtatggcaa；（SEQ ID NO.5）
Lower lantern primer LB:cccaagctcaatgcttcaag.（SEQ ID NO.6）
Step（3）, the above-mentioned amplification system prepared is placed in constant temperature fluorescent PCR instrument；Amplification program is set：65 DEG C of amplifications
30min；Dissolve program：98-80 DEG C, 0.05 DEG C is a cycle, does amplification curve and solubility curve；
Step（4）, judged according to obtained amplification curve and solubility curve：
If amplification curve has apparent " S " type curve and solubility curve peak type single and more sharp, it is determined as positive knot
Fruit illustrates to contain Radix Notoginseng in sample；
There is not apparent " S " type curve in amplification curve, then is determined as negative findings, illustrates not containing Radix Notoginseng in sample；
Amplification curve has apparent " S " type curve, but solubility curve peak type is not single is determined as non-specific amplification, then needs to repeat to walk
Suddenly（1）Step（3）, judged later again according to above-mentioned determination method；
The testing result of positive control template is positive findings, and the testing result of negative control template is negative findings, then is to say
Bright experiment is effective, and otherwise experiment is invalid.
Wherein, the positive control template is the genomic DNA of Panax notoginseng root.The negative control template is water three
Seven genomic DNA or the genomic DNA of curcuma zedoary.
It is detected simultaneously using traditional PCR detection method, as parallel control.It was found that present invention detection only needs 15 to 20 points
Clock；And traditional PCR is detected at least 3 hours.
1. specificity experiments
It uses the genomic DNA, curcuma zedoary genomic DNA, water Radix Notoginseng genomic DNA of Radix Notoginseng to be used as respectively and expands template, in use
State step（2）Step（4）Method is detected experiment, verifies the specificity of primer and kit.
2. result
Conclusion：The amplification curve finally obtained（Fig. 1）And solubility curve（Fig. 2）.There was only the genomic DNA of Radix Notoginseng in amplification curve
There is amplification for the sample of template（S type curves）, explanation is Radix Notoginseng sample；Curcuma zedoary, water Radix Notoginseng have no amplification（Curve is unchanged）, say
Bright is not Radix Notoginseng sample；The genomic DNA of Radix Notoginseng is single and sharp for the solubility curve peak type of the amplified production of template simultaneously, and
Curcuma zedoary genomic DNA, water Radix Notoginseng genomic DNA are unchanged as the solubility curve of the amplified production of amplification template, and explanation is used for
Detect the specific primer specificity of Radix Notoginseng DNA preferably.
The basic principles, main features and advantages of the present invention have been shown and described above.The technology of the industry
Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the above embodiments and description only describe this
The principle of invention, without departing from the spirit and scope of the present invention, various changes and improvements may be made to the invention, these changes
Change and improvement all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and its
Equivalent thereof.
Sequence table
<110>Yunnan Prov Agriculture University
<120>Identify ring mediated isothermal amplification fluorescence detection method, primer, kit and the application of Radix Notoginseng ingredient
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence ()
<400> 1
atacgattag caatgtcctc c 21
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence ()
<400> 2
ccttgttgtg agctggtg 18
<210> 3
<211> 41
<212> DNA
<213>Artificial sequence ()
<400> 3
cagtgggcgg atcaaagtac aacttgtcac ggtccttaac c 41
<210> 4
<211> 39
<212> DNA
<213>Artificial sequence ()
<400> 4
aggcataacc agcattggca ttgtggatgg aactcaacg 39
<210> 5
<211> 19
<212> DNA
<213>Artificial sequence ()
<400> 5
tgttgtggac gtatggcaa 19
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence ()
<400> 6
cccaagctca atgcttcaag 20
Claims (10)
1. identifying the loop-mediated isothermal amplification (LAMP) primer of Radix Notoginseng ingredient, which is characterized in that including external primers to, internal primer pair and
Ring primer pair；
The sequence of the external primers pair is：
Upstream outer primers F 3:atacgattagcaatgtcctcc；
Downstream outer primer B3:ccttgttgtgagctggtg；
The sequence of the internal primer pair is：
Upstream internal primers F IP:cagtgggcggatcaaagtacaacttgtcacggtccttaacc；
Downstream inner primer BIP:aggcataaccagcattggcattgtggatggaactcaacg；
The sequence of the ring primer pair is：
Upper lantern primer LF:tgttgtggacgtatggcaa；
Lower lantern primer LB:cccaagctcaatgcttcaag.
2. the kit of the identification Radix Notoginseng ingredient containing amplimer described in claim 1.
3. kit as claimed in claim 2, which is characterized in that further include：Positive control template, negative control template and
PCR reacts concentrate；
The positive control template is the genomic DNA of Radix Notoginseng；
The negative control template is the genomic DNA of other plant.
4. kit as claimed in claim 3, which is characterized in that the positive control template is the genome of Panax notoginseng root
DNA。
5. kit as claimed in claim 3, which is characterized in that the negative control template is the genome of water Radix Notoginseng
The genomic DNA of DNA or curcuma zedoary.
6. kit as claimed in claim 3, which is characterized in that its amplification system is：
4 μ L of template,
3 5uM of upstream outer primers F, 1 μ L,
1 μ L of downstream outer primer B3 5uM,
1 μ L of upstream internal primers F IP 40uM,
1 μ L of downstream inner primer BIP 40uM,
Upper 1 μ L of lantern primer LF 20uM,
Lower 1 μ L of lantern primer LB 20uM,
PCR reacts concentrate 15ul,
Amount to 25 μ L.
7. kit as claimed in claim 3, which is characterized in that its working procedure is：Amplification program：65 DEG C of amplification 30min；
Dissolve program：98-80 DEG C, 0.05 DEG C is a cycle.
8. application of the amplimer described in claim 1 in differentiating the Radix Notoginseng true and false.
9. application of the kit described in claim 2-7 any one in differentiating the Radix Notoginseng true and false.
10. identifying the ring mediated isothermal amplification fluorescence detection method of Radix Notoginseng ingredient, tried using described in claim 2-7 any one
Amplimer described in agent box or claim 1, which is characterized in that include the following steps：
Step（1）, sample DNA is extracted using Plant Genome extracts kit；
Step（2）, using positive control template, negative control template, sample DNA to be detected as template prepare respectively as follows
Amplification system：
4 μ L of template,
3 5uM of upstream outer primers F, 1 μ L,
1 μ L of downstream outer primer B3 5uM,
1 μ L of upstream internal primers F IP 40uM,
1 μ L of downstream inner primer BIP 40uM,
Upper 1 μ L of lantern primer LF 20uM,
Lower 1 μ L of lantern primer LB 20uM,
PCR reacts concentrate 15ul,
Amount to 25 μ L；
Step（3）, the above-mentioned amplification system prepared is subjected to PCR reactions；Amplification program is set：65 DEG C of amplification 30min；Dissolving
Program：98-80 DEG C, 0.05 DEG C is a cycle, does amplification curve and solubility curve；
Step（4）, judged according to obtained amplification curve and solubility curve：
If amplification curve has apparent " S " type curve and solubility curve peak type single and more sharp, it is determined as positive knot
Fruit illustrates to contain Radix Notoginseng in sample；
There is not apparent " S " type curve in amplification curve, then is determined as negative findings, illustrates not containing Radix Notoginseng in sample；
Amplification curve has apparent " S " type curve, but solubility curve peak type is not single is determined as non-specific amplification, then needs to repeat to walk
Suddenly（1）Step（3）, judged later again according to above-mentioned determination method；
The testing result of positive control template is positive findings, and the testing result of negative control template is negative findings, then is to say
Bright experiment is effective, and otherwise experiment is invalid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810248004.XA CN108384876A (en) | 2018-03-23 | 2018-03-23 | Identify ring mediated isothermal amplification fluorescence detection method, primer, kit and the application of Radix Notoginseng ingredient |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810248004.XA CN108384876A (en) | 2018-03-23 | 2018-03-23 | Identify ring mediated isothermal amplification fluorescence detection method, primer, kit and the application of Radix Notoginseng ingredient |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108384876A true CN108384876A (en) | 2018-08-10 |
Family
ID=63066865
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810248004.XA Withdrawn CN108384876A (en) | 2018-03-23 | 2018-03-23 | Identify ring mediated isothermal amplification fluorescence detection method, primer, kit and the application of Radix Notoginseng ingredient |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108384876A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109486999A (en) * | 2018-12-25 | 2019-03-19 | 云南农业大学 | The application of Radix Notoginseng SSR polymorphism primer, pleiomorphism detecting method and SSR marker on total saponin content determines |
| CN109486997A (en) * | 2018-12-25 | 2019-03-19 | 云南农业大学 | Purposes of the Radix Notoginseng SSR marker on ginsenoside Rb1's content determines |
| WO2023092738A1 (en) * | 2021-11-26 | 2023-06-01 | 中国科学院深圳先进技术研究院 | Method for detecting trace nucleic acid on basis of lamp combined with cas13a nuclease and use |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102888456A (en) * | 2012-09-21 | 2013-01-23 | 中国医学科学院药用植物研究所 | Method for quickly identifying pseudo-ginseng |
| CN104846101A (en) * | 2015-05-25 | 2015-08-19 | 湖南省食品药品检验研究院 | Specific primer pair and method for identifying panax notoginseng (Burkill) F. H. Chen |
-
2018
- 2018-03-23 CN CN201810248004.XA patent/CN108384876A/en not_active Withdrawn
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102888456A (en) * | 2012-09-21 | 2013-01-23 | 中国医学科学院药用植物研究所 | Method for quickly identifying pseudo-ginseng |
| CN104846101A (en) * | 2015-05-25 | 2015-08-19 | 湖南省食品药品检验研究院 | Specific primer pair and method for identifying panax notoginseng (Burkill) F. H. Chen |
Non-Patent Citations (4)
| Title |
|---|
| JING-JIAN LI等: "Loop-Mediated Isothermal Amplification (LAMP): Emergence As an Alternative Technology for Herbal Medicine Identification", 《FRONT PLANT SCI》 * |
| YOHEI SASAKI等: "Rapid Detection of Panax ginseng by Loop-Mediated Isothermal Amplification and Its Application to Authentication of Ginseng", 《BIOLOGICAL & PHARMACEUTICAL BULLETIN》 * |
| 童宇茹等: "基于DNA熔解曲线分析技术的三七粉分子鉴定", 《药物分析杂志》 * |
| 赵源等: "基于 LAMP 的人参物种鉴定技术的研究", 《植物检疫》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109486999A (en) * | 2018-12-25 | 2019-03-19 | 云南农业大学 | The application of Radix Notoginseng SSR polymorphism primer, pleiomorphism detecting method and SSR marker on total saponin content determines |
| CN109486997A (en) * | 2018-12-25 | 2019-03-19 | 云南农业大学 | Purposes of the Radix Notoginseng SSR marker on ginsenoside Rb1's content determines |
| CN109486997B (en) * | 2018-12-25 | 2022-04-19 | 云南农业大学 | Application of pseudo-ginseng SSR marker in determination of ginsenoside Rb1 content |
| WO2023092738A1 (en) * | 2021-11-26 | 2023-06-01 | 中国科学院深圳先进技术研究院 | Method for detecting trace nucleic acid on basis of lamp combined with cas13a nuclease and use |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2016054870A1 (en) | Method and use of nucleic acid isothermal amplification via polymerase spiral reaction | |
| CN105821138B (en) | A kind of method that double loop-stem structure DNA profiling detection nucleic acid are built based on coupled reaction | |
| CN108384876A (en) | Identify ring mediated isothermal amplification fluorescence detection method, primer, kit and the application of Radix Notoginseng ingredient | |
| CN102816847B (en) | LAMP primer for detecting Brucella and kit containing the same | |
| CN106868220A (en) | A kind of LAMP primer group and kit for expanding MERS CoV | |
| CN107828913A (en) | Prawn white spot syndrome（WSSV）RAA constant temperature fluorescence detection method and kit | |
| CN102952896B (en) | Universal loop-mediated isothermal amplification kit for detecting influenza A virus and application of universal loop-mediated isothermal amplification kit | |
| CN103276099B (en) | Primer and kit for fluorescent quatititive PCR (polymerase chain reaction) detection of helicobacter pylori | |
| CN107287320A (en) | The LAMP detections of GAPDH genes are combined and kit with primer | |
| CN108070636A (en) | A kind of processing method and kit of fluorescent PCR amplified sample | |
| CN104894265A (en) | Seahorse identification method | |
| CN102154487A (en) | Reagent for detecting francisella tularensis and complex probe and fluorescent quantitative polymerase chain reaction (PCR) method for detecting francisella tularensis | |
| CN106119390A (en) | A kind of based on MGB probe identification donkey skin, Corium Equi and the test kit of mule skin and detection method thereof | |
| CN105838807A (en) | Primer for LAMP detection method of sheep derived material, detection method and kit | |
| CN106399471A (en) | Detection kit and detection method of pneumocystis jiroveci | |
| CN116042926A (en) | Visual rapid detection method for peste des petits ruminants virus nucleic acid and kit thereof | |
| CN108456741A (en) | Detect ring mediated isothermal amplification fluorescence detection method, primer and the kit of Radix Notoginseng ingredient and application in soil | |
| CN107937617A (en) | Detect the RT LAMP primer compositions thing and its kit and method of Sai Neijia paddy viruses | |
| CN101928784A (en) | Real-time fluorescent quantitative PCR detection method for Sendai virus | |
| CN105039331B (en) | A kind of peronophythora litchi LAMP primer and its quick determination method and application | |
| CN107937567A (en) | The specific primer and its identification method of one group of identification stiff silkworm | |
| CN104278106B (en) | Duplex fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit for duck tembusu virus and egg drop syndrome virus | |
| CN104278024A (en) | Primer composition for identification of human adenovirus type 55 and application thereof | |
| CN106086226A (en) | A kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis and application thereof | |
| CN103014164A (en) | Duplex fluorescent quantitation RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit for shellfish Bonamia and Perkinsus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20180810 |