WO2023092738A1 - Method for detecting trace nucleic acid on basis of lamp combined with cas13a nuclease and use - Google Patents

Abstract

A method for detecting a trace nucleic acid on the basis of LAMP combined with a Cas13a nuclease, comprising: amplifying a target nucleic acid by means of LAMP to obtain an amplified target nucleic acid (S11); transcribing the amplified target nucleic acid by means of an RNA polymerase to obtain a transcribed nucleic acid (S12); and using a complex formed by means of the Cas13a nuclease and crRNA, wherein the Cas13a nuclease with a non-specific RNase activity that is activated after the transcribed nucleic acid is identified by means of crRNA is used for shearing a fluorescent substrate, and an obtained fluorescence signal is used for detection (S13). Also disclosed is the use of a method for detecting a trace nucleic acid during virus detection. The universal, rapid and accurate identification and detection of a trace nucleic acid can be realized.

Description

Method and application of detecting trace nucleic acid based on LAMP combined with Cas13a nuclease technical field

This application relates to the field of biotechnology, in particular to a method and application for detecting trace nucleic acids based on LAMP combined with Cas13a nuclease.

Background technique

With the rapid development of molecular biology technology, it is necessary to detect extremely small amounts of nucleic acid (trace nucleic acid) in many fields. Trace nucleic acid detection can be applied to the detection of diseases caused by viruses (such as SARS, bird flu, new coronavirus, etc.), bacteria, parasites, etc., rapid detection of item safety inspection and import and export (such as infection detection of new coronavirus), cells and It has important application value in the fields of quality control analysis and identification of gene therapy viral vector drug products. However, traditional spectrophotometers and various Nano ultra-micro spectrophotometers can only detect ng-level nucleic acid molecules, and are helpless for the detection of nucleic acid molecules with concentrations lower than ng-level.

technical problem

The main purpose of this application is to provide a method and application for detecting trace nucleic acids based on LAMP combined with Cas13a nuclease, which can solve the problem that trace nucleic acids are difficult to detect quickly and accurately.

technical solution

In order to solve the above technical problems, a technical solution adopted by the present application is to provide a method for detecting trace nucleic acids based on LAMP combined with Cas13a nuclease. The method comprises: amplifying the target nucleic acid by LAMP to obtain the amplified target nucleic acid; using RNA polymerase to transcribe the amplified target nucleic acid to obtain the transcribed nucleic acid; using a complex formed by Cas13a nuclease and crRNA, wherein The Cas13a nuclease that activates non-specific RNase activity after crRNA recognizes the transcribed nucleic acid cleaves the fluorescent substrate to obtain a fluorescent signal for detection.

Among them, the target nucleic acid is amplified by the LAMP method, and the amplified target nucleic acid includes: obtaining 6 primers, which are used to specifically identify the fragment of the target nucleic acid, and making the amplified target nucleic acid loop in the process of LAMP amplification .

Wherein, the 6 primers include: a first upstream primer, a second upstream primer, an upstream looping primer, a first downstream primer, a second downstream primer and a downstream looping primer, wherein the upstream looping primer is located between the first upstream primer and the second upstream primer Downstream of the two upstream primers, the downstream looping primer is located downstream of the first downstream primer and the second downstream primer.

Wherein, the promoter fragment is a T7 promoter sequence.

Wherein, the RNA polymerase is T7 RNA polymerase.

Among them, the complex formed by Cas13a nuclease and crRNA is used, wherein the Cas13a nuclease, which activates non-specific RNase activity after recognizing the transcribed nucleic acid by crRNA, cleaves the fluorescent substrate, and obtains a fluorescent signal before detection, including: transcribed nucleic acid as Template design targeting crRNA.

Wherein, the template for designing the targeted crRNA is a segment in the transcribed nucleic acid that does not change during amplification and transcription.

Wherein, when the target nucleic acid includes the HSV viral genome, the amount of the target nucleic acid is at least 60 copies.

In order to solve the above technical problems, another technical solution adopted by the present application is to provide an application of a method for detecting trace amounts of nucleic acid in virus detection. The method is a method for detecting trace nucleic acids based on LAMP combined with Cas13a nuclease described in the above technical scheme.

Beneficial effect

The beneficial effects of the present application are: different from the situation of the prior art, the present application performs isothermal amplification of the target nucleic acid through LAMP, combined with Cas13a nuclease for fluorescence detection, can detect the target nucleic acid with a template concentration lower than ng level, and realize the target nucleic acid Universal, rapid and accurate identification and detection of trace nucleic acids.

Description of drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings that need to be used in the description of the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present invention. For those skilled in the art, other drawings can also be obtained based on these drawings without creative effort.

Fig. 1 is the schematic flow chart of the first embodiment of the method for detecting trace nucleic acid of the present application;

Fig. 2 is a schematic diagram of the experimental process of an embodiment of the method for detecting trace amounts of nucleic acid in the present application;

Fig. 3 is the fluorescence detection result of an embodiment of the method for detecting trace nucleic acid of the present application.

Embodiments of the present invention

The following will clearly and completely describe the technical solutions in the embodiments of the present application with reference to the accompanying drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of them. Based on the embodiments in this application, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the scope of protection of this application.

The terms "first", "second", etc. in this application are used to distinguish different objects, not to describe a specific order. Furthermore, the terms "include" and "have", as well as any variations thereof, are intended to cover a non-exclusive inclusion. For example, a process, method, system, product or device comprising a series of steps or units is not limited to the listed steps or units, but optionally also includes unlisted steps or units, or optionally further includes For other steps or units inherent in these processes, methods, products or apparatuses.

Reference herein to an "embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment can be included in at least one embodiment of the present application. The occurrences of this phrase in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments. It is understood explicitly and implicitly by those skilled in the art that the embodiments described herein can be combined with other embodiments.

Before describing this application in detail, first introduce the basic concepts related to this application.

In conventional technology, trace nucleic acid detection methods include SHERLOCK, which combines isothermal amplification technology RPA (Recombinase Polymerase Amplification) and CRISPR/Cas family protein Cas13a, specifically detect trace nucleic acids. The steps of the method are as follows: the isothermal amplification technology RPA mainly utilizes three core proteins: recombinant protein RecA, single-stranded DNA binding protein SSB and strand-displacing DNA polymerase to amplify the DNA template; After the T7 promoter, the amplified product can be transcribed into RNA, and the fluorescent signal generated after the RNA fluorescent substrate is cut by the non-specific RNase activity generated after the Cas13a and crRNA complex recognizes the RNA template is used for detection.

The reaction temperature of RPA is 37~42 ℃. During the amplification process of the isothermal amplification technology RPA, the protein-DNA complex formed by the combination of the recombinant protein and the primer can search for homologous sequences in the double-stranded DNA. Once the primers determine the homologous sequence, a strand exchange reaction occurs and DNA synthesis is initiated, exponentially amplifying the target region on the template. Instead, the replaced DNA strand binds to the SSB to prevent further substitutions.

The T7 promoter is a sequence that initiates gene transcription. It is completely and exclusively controlled by T7 RNA polymerase. It is a strong promoter with powerful functions and high specificity. It controls the start time and degree of gene transcription and expression.

Cas13a activated by crRNA and RNA template can cleave the RNA, separating the fluorophore from the quencher to generate fluorescence. CRISPR is an excellent genome editing tool, the most commonly used is Cas9 (SpCas9) from Streptococcus pyogenes, but it is not the only option, Cas13a (formerly known as C2c2) is also more and more widely used. The biggest difference between Cas9 and Cas13a is that Cas13a binds and cuts RNA, while Cas9 cuts DNA. Structurally, Cas13a contains two HEPN domains, while Cas9 uses HNH and RuvC domains to cleave DNA targets. The HEPN domain is required for Cas13a to cleave RNA targets. Cas13a only needs crRNA to bind and cut RNA. crRNA interacts with Cas13a molecules through the uracil-rich stem-loop structure, and achieves target cutting through a series of conformational changes of Cas13a. Cas13a can tolerate a single mismatch between the crRNA and the target sequence, but if there are two mismatches, the cutting efficiency is greatly reduced. Its PFS sequence (equivalent to the PAM sequence) is located at the 3' end of the spacer and consists of A, U or C bases. The two conserved HEPN domains of the CRISPR Cas13a protein lead to the formation of a complex HEPN catalytic pocket in response to crRNA-guided RNA cleavage. In the absence of target RNA, the HEPN catalytic pocket of the Cas13a protein is inactive, and its cleavage unit for cleaving the target RNA is inactive. In the presence of the target RNA, the central seed region of the guide strand initiates binding to the complementary target, forming a guide-target RNA duplex, which then propagates to both ends of the guide strand. Guided target duplex formation induces a conformational change in the Cas13a protein, activating the HEPN catalytic site. Thus, upon target RNA binding, the activated HEPN catalytic site is fully RNase active. Activated Cas13a protein molecules indiscriminately cleave any exposed RNA molecules, including target RNA bound to Cas13a protein and any free RNA in solution, resulting in target degradation and incidental cleavage of host and any other phage RNA sequences.

Isothermal amplification techniques also include cross priming amplification (CPA), strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), and rolling circle amplification. Increase (rolling circle amplification, RCA), depends on the helicase-dependent amplification (helicase-dependent amplification, HDA) and so on.

CPA is carried out at around 63 °C and relies on Bst DNA polymerase, betaine and cross primers. According to the number of cross primers, it can be divided into double cross primer amplification and single cross primer amplification. Double crossover primer amplification uses two crossover primers and two stripper primers. The two cross primers are complementary to the template strand and then extended, and then the stripping primer strips the newly synthesized single strand under the action of Bst DNA polymerase, and the last two cross primers use the nascent single strand as Template synthesis of a large number of target fragments. Single cross primer amplification uses one cross primer, two stripper primers, and two normal primers. First, the cross primer combines with the template strand and extends into a double strand, and the stripping primer separates the new strand from the template under the action of Bst DNA polymerase; then the common primer uses the new strand as a template to synthesize two single-stranded DNAs of different lengths; Finally, the two single strands are used as templates, and the cross primer and common primer are used as primer pairs to form an amplification cycle.

The reaction temperature of SDA is about 37 ℃, and the reaction requires a restriction endonuclease, a strand-displacing DNA polymerase, and two pairs of primers, and one pair of primers (P1 and P2) contains an endonuclease recognition sequence. At the beginning of the reaction, P1 and P2 are complementary to the template strand, which is extended into a double strand under the catalysis of the polymerase, and then the endonuclease recognizes the enzyme cleavage sites at both ends of the double strand and cuts to form a sticky end. The second pair of primers binds to the end of the template strand, and under the action of the polymerase, a new strand is synthesized and a single strand is replaced.

NASBA technology is an isothermal amplification method for detecting RNA, which is usually performed at around 42 °C and requires AMV (avian myeloblastosis virus) reverse transcriptase, RNase H, T7 RNA polymerase and a pair of primers to complete. Its forward primer contains the complementary sequence of T7 promoter. During the reaction process, the forward primer combines with the RNA strand, and is catalyzed by AMV enzyme to form a DNA-RNA double strand; RNase H digests the RNA in the hybrid double strand, and retains the DNA single strand; under the action of the reverse primer and AMV enzyme, it forms a DNA-RNA double strand containing T7 The DNA double strand of the promoter sequence; under the action of T7 RNA polymerase, the transcription process is completed to produce a large amount of target RNA.

RCA borrows from the way circular DNA replicates in nature. The required enzyme is phi29 DNA polymerase, which is carried out at about 37 °C. The general RCA process is: the primer is combined with the circular DNA template and then extended to generate a DNA single strand containing a large number of target genes.

HDA simulates the DNA semi-conservative replication process in vivo. The reaction is carried out at about 37°C and relies on helicase, SSB, DNA polymerase and a pair of primers. The process is as follows: DNA double strands are unwrapped under the action of helicase, SSB combines with single strand DNA to keep it stable; at the same time, primers combine with single strands to form double strands under the catalysis of polymerase; newly synthesized DNA double strands serve as The template enters a new round of amplification.

The method used in this application is to use the isothermal amplification technology LAMP and the CRISPR/Cas family protein Cas13a to detect trace amounts of nucleic acids. LAMP (loop-mediated isothermal amplification), a loop-mediated isothermal amplification technique, is also a brand-new nucleic acid amplification method. The limitation of LAMP is that the design of primers is cumbersome, but this can be overcome by standardizing the primers. The basic process of LAMP is that the internal primer binds to the target gene and is extended into a double strand under the action of polymerase. The outer primer binds to the 5' end of the double-stranded DNA, forming a circular structure at one end. The other end goes through the same process to form a dumbbell-shaped structure with rings at both ends. Single-stranded DNA with a dumbbell-shaped structure has the dual functions of template and primer, and can be extended under the catalysis of polymerase. Inner primers can also bind to the loop structure and be extended by enzymes. During the DNA synthesis process of LAMP, pyrophosphate ions precipitated from deoxyribonucleic acid triphosphate substrates (dNTPs) react with magnesium ions in the reaction solution to produce a large amount of magnesium pyrophosphate precipitates, which appear white. Therefore, the turbidity can be used as the indicator of the reaction, and the amplification can be identified only by observing the white turbid precipitate with the naked eye. Unlike traditional PCR, it does not require thermal denaturation of the template, temperature cycling, electrophoresis, and ultraviolet observation. , can perform nucleic acid amplification in a short time under isothermal (usually 60-65°C) conditions, and is a simple, rapid, and specific method. LAMP uses at least four primers to accurately combine with six specific sites on the target sequence to carry out the amplification reaction, so its amplification specificity is higher than that of RPA amplified by two primers, and its amplification efficiency is also higher than that of RPA.

The present application will be described in detail below in conjunction with the accompanying drawings and embodiments.

Fig. 1 is a schematic flow chart of the first embodiment of the method for detecting trace amounts of nucleic acids of the present application. The method includes the following steps:

S11: Amplify the target nucleic acid by means of LAMP to obtain the amplified target nucleic acid.

In one embodiment, the target nucleic acid, ie the target DNA sequence, is amplified by means of LAMP. The method comprises: determining the target DNA sequence, designing primers for the target DNA sequence, and amplifying at a constant temperature of 60-65° C. under the action of DNA polymerase. It can realize nucleic acid amplification of 10^9 to 10^10 times in about 15 to 60 minutes.

In one embodiment, the primers designed for the DNA sequence, that is, the target nucleic acid in the LAMP process may include a first upstream primer, a second upstream primer, an upstream looping primer, a first downstream primer, a second downstream primer, and a downstream looping primer . These primers are used to specifically recognize fragments of template DNA and to circularize the amplified template DNA during LAMP amplification.

In one embodiment, the target DNA sequence is a replicating Herpes simplex virus (Herpes simplex virus, HSV) wild-type virus genome. Detect its trace presence or contamination in target samples, such as non-replicating HSV viral vector preparations. Trace quantities may be less than 100 copies of the genome. In the embodiment of the present application, when the genome of the target nucleic acid is the genome of the HSV virus, it can be clearly detected when the genome of the target nucleic acid has a copy number of 60. With the optimization of relevant experimental conditions, the amount of the genome can be further reduced, and the detection sensitivity of the method can be further improved. The experimental process is to use the HSV1 wild-type virus gene as a template, design primers for LAMP, crRNA design for its gD gene, and use Cas13a nuclease to detect whether there is residue or contamination of the wild-type HSV target genome with high sensitivity. Its gD gene sequence is shown in SEQ ID NO.1.

LAMP primers designed using the gene sequence as a template include FIP (F1C-F2), F3, Loop F, BIP (B1C-B2), B3, Loop B. F3 is the first upstream primer, which may also be referred to as an upstream outer primer. B3 is the first downstream primer, which may also be referred to as a downstream outer primer. FIP is the second upstream primer, also known as the upstream internal primer, which consists of F2 region and F1C region. The F2 region is complementary to the F2C region at the 3' end of the target gene, and the F1C region is the same as the F1C region at the 5' end of the target gene. BIP is the second downstream primer, also known as the downstream internal primer, consisting of B1C region and B2 region, the B2 region is complementary to the B2C region at the 3' end of the target gene, and the B1C region is the same as the B1C region at the 5' end of the target gene. Loop F and Loop B are the upstream loop-forming primer and the downstream loop-forming primer. The upstream looping primer is located downstream of the first upstream primer and the second upstream primer, and the downstream looping primer is located upstream of the first downstream primer and the second downstream primer. The related gene sequence is as follows:

FIP: TGTGGTACACGCGCCGGATTTTCCAATCGCTTTCGCGGCAAAG

F3: TCTCTCAAGATGGCCGACC

F2: CCAATCGCTTTCGCGGCAAAG

F1: GTCCGGCGCGTGTACCACAT

Loop-F: GTCAGCTGGTCCAGGAC

Loop-B: CAGCCTCCCGATCACGGTT

B3: GCGTTTAGGAGCACGCT

B2: CAGGCGCGCTCCAACACG

B1: GGCTGGAACGGGTCCGGTAG

BIP: CTACCGGACCCGTTCCAGCTTTTCAGGCGCGCTCCAACAC

The upstream looping primer and the downstream looping primer need to include a recognition sequence and a promoter sequence. This recognition sequence is used to specifically recognize a fragment of template DNA. The promoter sequence is because Cas13a nuclease can only target and recognize RNA, so it is necessary to introduce the promoter sequence into the 5' end of one or more of the 6 primers designed to help the amplified sequence perform RNA conversion and be Recognized by Cas13a.

Since primers F3 and B3 only act on the formation of the LAMP loop and do not appear in the DNA product produced by subsequent amplification, adding a promoter to these two primers is an invalid amplification, because the resulting amplification The product does not contain a promoter sequence, so in vitro transcription cannot be achieved, and subsequent experiments cannot be performed. The introduction of promoter sequences at the 5' ends of FIP and BIP primers will affect the looping process of LAMP, making the amplification process impossible. The promoter sequence introduced at the 5' end of the Loop primer has no effect on the entire amplification process of LAMP. The other four primers except the Loop primer can still complete the amplification process, and the Loop primer can further amplify the amplification product on this basis. Therefore, the primer design during the experiment introduced primers containing promoter sequences to replace the original Loop F and Loop b.

The promoter may include a T7 promoter, which is a strong promoter from T7 bacteriophage capable of specifically responding to T7 RNA polymerase, and is a sequence capable of initiating gene transcription.

The gene sequence of the T7 promoter is as follows:

T7 promoter: GAAATTAATACGACTCACTATAGGG

Instead of the original loop-forming primers Loop F and Loop The gene sequences of the new loop-forming primers T7-Loop F and T7-Loop B of B are as follows:

T7-LoopF: GAAATTAATACGACTCACTATAGGGGTCAGCTGGTCCAGGAC

T7-LoopB: GAAATTAATACGACTCACTATAGGGCAGCCTCCCGATCACGGTT

After using the T7 promoter sequence as the sequence for initiating RNA transcription, correspondingly, the RNA polymerase used subsequently is T7 RNA polymerase.

S12: Using RNA polymerase to transcribe the amplified target nucleic acid to obtain the transcribed nucleic acid.

In one embodiment, after the amplified template DNA is obtained, the template DNA is correspondingly transcribed in vitro by RNA polymerase, and transcribed into template RNA. After the transcription is completed, target crRNA is designed using the template RNA as a template.

For example, in above-mentioned embodiment, in taking HSV1 wild-type viral gene as template design six primers, FIP (F1C-F2), F3, T7-Loop F, BIP (B1C-B2), B3, the target nucleic acid of the replicating herpes simplex virus wild-type virus genome amplified under the action of T7-Loop B, the obtained amplification product is transcribed to obtain RNA, and the crRNA is designed using the RNA as a template .

The template for designing the targeted crRNA is a segment of the transcribed nucleic acid that does not change during amplification and transcription, thereby ensuring that the crRNA can target the ssRNA. ssRNA, that is, template RNA, is a target RNA fragment that can be recognized and cut by Cas13a nuclease.

In the above example, the product sequence of LAMP amplification and transcription has the following parts unchanged, F1/B1C, Loop B/B2C, Loop F/F2C. All of them can be used as targets for crRNA design. Its gene sequence is as follows:

F1-B1C: GTCCGGCGCGTGTACCACATCCAGGCGGGCCTACCGGACCCGTTCCAGCC

LoopB-B2C: CAGCCTCCCGATCACGGTTTACTACGCCGTGTTGGAGCGCGCCTG

LoopF-F2C: GGTCAGCTGGTCCAGGACCGGAAGGTCTTTGCCGCGAAAGCGATTG

S13: a complex formed by Cas13a nuclease and crRNA, wherein the Cas13a nuclease that activates non-specific RNase activity after recognizing the transcribed nucleic acid by crRNA cleaves the fluorescent substrate to obtain a fluorescent signal for detection.

Use the complex formed by combining the designed crRNA with Cas13a, wherein the designed crRNA is used to specifically recognize the template RNA, and after the recognition, the non-specific RNase activity of Cas13a nuclease will be activated, and then the Cas13a nuclease with non-specific RNase activity will be used Cleavage of fluorescent RNA substrates. The activated Cas13a nuclease is non-specific, so it can cut all RNA, and then it can cut the fluorescent substrate, and separate the fluorescent group from the quencher group to generate a fluorescent signal for detection .

The first embodiment of the present application will be described in more detail below with reference to FIG. 2 . Fig. 2 is a schematic diagram of the experimental flow of an embodiment of the method for detecting trace amounts of nucleic acid in the present application.

This embodiment takes the detection of a trace amount (genome <100 copies) of the wild-type viral genome of replicating herpes simplex virus in a target sample (such as a non-replicating HSV virus vector preparation) as an example. The method is to use the HSV1 wild-type virus genome as a template, design LAMP primers and crRNA for its gD gene, and use Cas13a nuclease to detect whether there is residue or contamination of the wild-type HSV target genome with high sensitivity.

The detection process can be roughly divided into three steps: amplification process, transcription process and detection process.

Amplification process: Firstly, an amplification scheme of 6 primers targeting the gD gene of HSV virus was designed. The six primers are FIP (F1C-F2), F3, Loop F, BIP (B1C-B2), B3, Loop B. After the T7 promoter was added to the loop primers, new primers T7-Loop F and T7-Loop B were formed to replace the original Loop F and Loop B.

After the primers are designed, a LAMP reaction system can be as follows: 1.6 µM FIP/BIP, 0.2 µM F3/B3, 0.4 µM T7-LoopF/B, 1.4 mM dNTP each, 8 µl Bst DNA polymerase (Beiyuntian, D7050S), 1× Bst reaction buffer, 8 mM MgSO ₄ , total system 25 µl, 65°C, 30 min. The reaction temperature and reaction time can be adjusted according to the actual test situation to achieve the best test effect.

Transcription process: After the LAMP amplification is completed, the amplified DNA product is also introduced into the T7 promoter sequence, and T7 RNA polymerase can be used for in vitro transcription, and the template DNA is transcribed into ssRNA for subsequent Cas13a detection. The reaction system can be as follows: 10 µl amplification product during amplification, 10 µl NTP, 1 µl T7 RNA polymerase, supplemented with RNase-free H ₂ O, total system 30 µl, 37°C for 30 min. The reaction temperature and reaction time can be adjusted according to the actual test situation to achieve the best test effect.

Detection process: After obtaining the transcript, it is necessary to design crRNA targeting ssRNA.

In this example, Loop B/B2C was selected as the target to design crRNA, and the length of the target sequence was 28 nt. The gene sequence of the gDcrRNA is as follows:

gD crRNA:

gauuuagacuaccccaaaaacgaaggggacuaaaacCuCCAACACGGCGuAGuAAACCGuGAuC

In order to obtain crRNA, the template ssDNA needs to be annealed with the T7 promoter for in vitro transcription. The gene sequence of the template DNA is as follows:

crRNA IVT DNA template:

GATCACGGTTTACTACGCCGTGTTGGAGgttttagtccccttcgtttttggggtagtctaaatcCCCTATAGTGAGTCGTATTAATTTC

A reaction system for this process can be shown as follows: 1 µl 100 mM ssDNA, 1 µl 100 mM T7 promoter, 1 µl 10×Taq buffer, 7 µl RNase-free H _{2 0} , 95°C for 5 min, then annealed at 0.2°C/s to 4°C, and then perform in vitro transcription according to the same method in the transcription process to obtain target ssRNA and purify it, and then use cas13a nuclease protein for fluorescent signal detection. A reaction system during the detection process can be shown as follows: 10 µl obtained during the transcription process ssRNA template, 0.5 µM cas13a enzyme, 2 µl RNaseAlert (Invitrogen, 4479768), 1 µl RNase inhibitor (NEB, M0314S), 1 µl crRNA, RNase-free H ₂ 0 supplemented to 20 µl, 37 ℃ for real time detection. Among them, RnaseAlert is a fluorescent RNA substrate, which is labeled with a fluorescent reporter molecule (fluorophore) at one end and a quencher group at the other end for cleavage by the activated Cas13a nuclease. The reaction temperature and reaction time can be adjusted according to the actual test situation to achieve the best test effect. The fluorescence detection signal of this detection process can be monitored in real time by qPCR, and the fluorescence data can also be read directly after a period of reaction.

The test results are shown in Figure 3. It can be seen from Figure 3 that good positive results can be obtained from template amounts of 10 ^-1 ng, 10 ^-2 ng, 10 ^-3 ng, 10 ^-4 ng, down to 10 ^-5 ng (60 copies) Amplifies the signal and exhibits a distinct fluorescent response. The Negative Control in Fig. 3C is the sample without HSV1 genome in the reaction system. Positive Control detects the in vitro transcription of ssDNA corresponding to the direct synthesis of crRNA. The gene sequence of the DNA is as follows:

Positive control IVT DNA template:

GCACGCTGCGGCAGGCGCGCTCCAACACGGCGTAGTAAACCGTGATCGGGAGGCTGCCCTATAGTGAGTCGTATTAATTTC

The experimental results further illustrate that adding the T7 promoter to the 5' end of the Loop primer by the method of the present application does not affect the amplification efficiency of LAMP, and the introduction is effective.

The present application also discloses an application, applying the above-mentioned method for detecting trace nucleic acids based on LAMP combined with Cas13a nuclease to virus detection, such as detection of diseases caused by virus infection, bacteria, parasites, etc., food and cosmetic safety inspection and Import and export rapid detection (such as detection of new coronavirus infection), quality control analysis and detection of cell and gene therapy virus vector preparations, etc.

This application introduces the T7 promoter into the Loop primer, so that the introduction of the promoter will not affect the amplification process, and can appear in the amplified product, and then the LAMP technology can be used for isothermal amplification of the target nucleic acid to achieve The exponential growth of the target nucleic acid, and then combined with the designed crRNA and Cas13a nuclease after the transcription of the target nucleic acid, realizes the recognition of the target nucleic acid after transcription and the cleavage of the fluorescent substrate, thereby generating fluorescence for identification and detection. The combined detection method of LAMP and Cas13a nuclease can be used to accurately detect any target nucleic acid, whether it is DNA or RNA fragments, without the need for a special PCR amplification instrument. The detection operation is convenient, fast and the results are accurate and reliable.

In summary, this application uses LAMP to amplify target nucleic acids, combined with Cas13a nuclease for fluorescence detection, can detect target nucleic acids with template concentrations lower than ng level, and realize universal, rapid and accurate identification of trace nucleic acids detection.

In the several implementation manners provided in this application, it should be understood that the disclosed methods and devices may be implemented in other ways. For example, the device implementation described above is only illustrative. For example, the division of the modules or units is only a logical function division. In actual implementation, there may be other division methods. For example, multiple units or components can be Incorporation may either be integrated into another system, or some features may be omitted, or not implemented.

The above is only an embodiment of the application, and does not limit the patent scope of the application. Any equivalent structure or equivalent process conversion made by using the specification and drawings of the application, or directly or indirectly used in other related technologies fields, are all included in the scope of patent protection of this application in the same way.

Claims (10)

1. A method for detecting trace nucleic acids based on LAMP combined with Cas13a nuclease, characterized in that, comprising:

   Amplify the target nucleic acid by LAMP to obtain the amplified target nucleic acid;

   Using RNA polymerase to transcribe the amplified target nucleic acid to obtain a transcribed nucleic acid;

   A complex formed by Cas13a nuclease and crRNA is used, wherein the Cas13a nuclease that activates non-specific RNase activity after recognizing the transcribed nucleic acid by the crRNA cleaves the fluorescent substrate to obtain a fluorescent signal for detection.
2. The method according to claim 1, wherein the target nucleic acid is amplified by the LAMP method to obtain the amplified target nucleic acid, comprising:

   6 primers are obtained for specifically recognizing fragments of the target nucleic acid and forming a circle of the amplified target nucleic acid during the LAMP amplification process.
3. The method according to claim 2, wherein the 6 primers comprise: a first upstream primer, a second upstream primer, an upstream looping primer, a first downstream primer, a second downstream primer, and a downstream looping primer, Wherein, the upstream looping primer is located downstream of the first upstream primer and the second upstream primer, and the downstream looping primer is located upstream of the first downstream primer and the second downstream primer.
4. The method according to claim 3, wherein the upstream looping primer and the downstream looping primer include a recognition sequence and a promoter sequence, wherein the recognition sequence is used to specifically recognize a fragment of the target nucleic acid , the promoter sequence is used to be recognized by the RNA polymerase to initiate transcription, and the promoter sequence is located at the 5' end of the fragment.
5. The method according to claim 4, wherein the promoter sequence is a T7 promoter sequence.
6. The method according to claim 5, wherein the RNA polymerase is T7 RNA polymerase.
7. The method according to claim 1, characterized in that, the complex formed by the Cas13a nuclease and crRNA is utilized, wherein the Cas13a nuclease that activates non-specific RNase activity after recognizing the transcribed nucleic acid by the crRNA is used to cut Cut fluorescent substrates to obtain fluorescent signals before detection, including:

   Targeted crRNA is designed using the transcribed nucleic acid as a template.
8. The method according to claim 7, wherein the template of the targeted crRNA is designed to be a fragment in the transcribed nucleic acid that does not change during the amplification and the transcription.
9. The method according to claim 1, characterized in that,

   When the target nucleic acid includes HSV virus genome, the amount of the target nucleic acid is at least 60 copies.
10. An application of a method for detecting trace nucleic acids in virus detection, wherein the method is a method for detecting trace nucleic acids based on LAMP combined with Cas13a nuclease as described in any one of claims 1-9.