CN112301102A - High-specificity loop-mediated isothermal amplification method and application thereof - Google Patents
High-specificity loop-mediated isothermal amplification method and application thereof Download PDFInfo
- Publication number
- CN112301102A CN112301102A CN201910701221.4A CN201910701221A CN112301102A CN 112301102 A CN112301102 A CN 112301102A CN 201910701221 A CN201910701221 A CN 201910701221A CN 112301102 A CN112301102 A CN 112301102A
- Authority
- CN
- China
- Prior art keywords
- amplification
- lamp
- primer
- sgrna
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/30—Production chemically synthesised
Abstract
The invention discloses a high-specificity loop-mediated isothermal amplification method, which comprises the following steps: 1) designing an amplification primer; 2) designing sgRNA; 3) amplification; 4) and (3) specific detection of the amplification product. The amplification method can achieve pollution removal at the femto-level, effectively reduces the false positive rate of detection by the traditional LAMP method, and improves the accuracy rate of detection. Meanwhile, the invention also comprises the application of the high-specificity loop-mediated isothermal amplification method in gene detection.
Description
Technical Field
The invention relates to the field of biological detection, in particular to a high-specificity loop-mediated isothermal amplification method and application thereof.
Background
Loop-mediated isothermal amplification (LAMP) is a nucleic acid amplification technology with high amplification speed, controllable cost and low equipment requirement, and was created by Notomi et al in 2000. It relies on a DNA polymerase with strand displacement activity and four primers, and can efficiently complete high specificity amplification reaction under isothermal condition. At present, the method is widely applied to the field of nucleic acid diagnosis, such as pathogen identification, biomarker detection, sex identification and the like. Nevertheless, it has several problems: first, since LAMP has an ultra-high sensitivity, a large amount of long-chain DNA is generated during the reaction, and a part of the DNA is released into the air as aerosols each having at least 10 are formed when the cover is opened6Copying the target gene, thereby causing cross contamination of the sample to be tested and forming a false positive result. Secondly, the LAMP product contains a plurality of long-chain structures like cauliflower which are repeated reversely, and is difficult to naturally degrade. Even if the product is partially degraded, it can be used as a template for amplification. Third, non-specific amplification sometimes occurs due to the high concentration of primers. Although the LAMP amplification method reacts pyrophosphate ions precipitated from deoxyribonucleic acid triphosphate substrates (dNTPs) with magnesium ions in the reaction solution at the time of DNA synthesis to produce a large amount of magnesium pyrophosphate precipitate in a white color, whether amplification is carried out or not can be identified only by visually observing the white turbid precipitate. However, most of the conventional LAMP amplification product detection methods are based on detection of double-stranded DNA products or by-products thereof in the polymerization reaction, and only judgment of whether the amplification reaction occurs or not is made, and identification of the target source and specificity of the amplification product is difficult. These problems have limited the use of LAMP. Therefore, how to solve these problems and further improve the practicability of LAMP amplification is the focus of the present invention.
The LAMP reaction scheme is shown in FIG. 1. Amplification is divided into three stages: the first stage is the initiation stage, which begins with the complementary pairing of region F2 of FIP (forward Inner primer) with region F2c of the target sequence, FIP extending by replication along the template strand under the action of a polymerase. F3 then hybridizes with the F3c region of the target sequence to synthesize a new DNA strand, displacing the single strand synthesized by FIP priming. BIP (Backward Inner primer) pairs with the B2c region of the replaced single-stranded DNA to guide new strand extension, and then the outer primer B3 pairs with B3c to extend to replace the DNA strand synthesized by BIP guide. The replaced single-stranded DNA has the 5 'end F1 complementary to F1c and the 3' end B1 complementary to B1c, and the two ends are folded back to form a dumbbell-shaped stem-loop structure. The second phase is the exponential amplification cycle phase. FIP and BIP mediate the dumbbell-shaped single-stranded DNA as a template to carry out exponential amplification to form a large number of double-stranded DNA products with different lengths, and the nucleic acid sequence of the products consists of target sequences which are reversely and alternately repeated. The third stage is an extension stage.
Crispr (clustered regulated short palindromic repeats) is an adaptive immune system found in bacteria and is effective against damage to bacteria caused by invading viruses or foreign DNA and the like. Cas9 and Cas12a proteins of type II in CRISPR systems are widely used gene editing tools at present. Cas9 is a guide RNA-guided DNA endonuclease that can target the induction of site-directed double strand breaks in DNA. CRISPR/Cas9 contains two components: guide RNAs (grnas or sgrnas) and CRISPR-associated endonucleases (Cas proteins). Cas9 cleavage requires two basic conditions: complementary target sequence and sgRNA; ② the Adjacent Protospace Adjacent Motif (PAM) site of the target. The PAM site of cas9 is NGG, with N being base A, T, G or C. The CRISPR/Cas12a is used for specific DNA/RNA target gene recognition, and can perform shearing action on a target gene and other single-stranded DNA or RNA in a reaction system under the condition of recognizing the target gene. The PAM site of Cas12a is VTTT, and V is base A, G or C.
Disclosure of Invention
The present invention is directed to solving the above-mentioned disadvantages and drawbacks of the prior art, and provides a loop-mediated isothermal amplification method with improved specificity and applications thereof.
The invention is realized by the following technical scheme:
a high-specificity loop-mediated isothermal amplification method (hereinafter referred to as CUT-LAMP) is characterized by comprising the following steps:
(1) designing an amplification primer: adding complementary site NCC of PAM in FIP/BIP primer of conventional LAMP amplification method to make product of CUT-LAMP contain PAM site NGG.
(2) Design of sgRNA: designing the sgRNA according to the primers of step (1) so that the Cas9/sgRNA complex can specifically recognize and cleave other contaminating sequences in the amplification product than the sequence of interest.
The method specifically comprises the following steps: a DNA template for transcribing sgRNA was first obtained by bridge PCR. Only two long primers are used in the PCR process, wherein the forward primer F is 64-nt long and comprises a T7 promoter and a sequence which is 20-nt related to a target DNA, the downstream primer R is 80-nt long and is used for coding the 3' terminal sequence of the sgRNA, and the two primers have a complete complementary sequence which is 20-nt long. And (3) transcribing the DNA template by the sgRNA obtained by PCR amplification, detecting a PCR product by agarose gel electrophoresis, purifying by using a kit, carrying out T7-RNA polymerase mediated transcription reaction on the product at 37 ℃ for 4-6h, and carrying out in-vitro transcription to obtain the sgRNA (100-nt). The resulting product was purified with an RNA purification kit and used in subsequent experiments after detection by polyacrylamide electrophoresis, or stored at-80 ℃.
(3) Amplification: adding the Cas9/sgRNA compound into an amplification system, and amplifying according to a normal LAMP amplification program, wherein the sgRNA is the sequence designed in the step (2).
The method specifically comprises the following steps: cas9/sgRNA with a certain working concentration is pre-incubated at 25 ℃ or room temperature to form a complex, then the complex is added into an amplification system, a primer group is incubated for 5-20min at 37 ℃, at the moment, a Cas9/sgRNA complex starts to search for an LAMP amplification product containing a PAM site in the system, and the Cas9/sgRNA cuts off the product at a position 3bp downstream of the PAM site, so that the LAMP amplification cannot be caused by a polluted product in the system.
(4) And (3) specific detection of the amplification product.
Further, the primers of the CUT-LAMP in the step (1) are designed in such a way that two bases C are added in the middle of the FIP/BIP primers of the conventional LAMP amplification method.
Further, if there is a base C in the middle of the FIP or BIP primer of the conventional LAMP amplification method, the CUT-LAMP primer of step (1) is designed such that a base C is added next to the base C of the conventional FIP or BIP primer.
Further, the detection method in step (4) is to place the amplification product and a single-stranded detection probe with a labeling group in a Cas12a/crRNA system for cleavage reaction, wherein the crRNA is designed according to a target sequence, the detection probe is cleaved while the amplification product is cleaved, and the specificity of the product is judged by detecting the characteristics of the labeling group after the detection probe is cleaved.
The method specifically comprises the following steps: searching a target containing a PAM site VTTT (V is a base A, G or C) site of Cas12a, designing 20-nt in crRNA to be complementary with the target, adding a T7 promoter sequence in front of a complementary region, and synthesizing two complementary DNA oligonucleotide strands. Annealing to form the template DNA of crRNA. The product is purified by a kit, and the purified DNA template is transcribed for 4-6h at 37 ℃ to obtain crRNA. The transcribed RNA was purified by RNA purification kit, and after detection by polyacrylamide electrophoresis, the concentration of the obtained crRNA was measured by Nanodrop 2000.
And (4) after the amplification in the step (3) is finished, adding the amplification reaction solution into a Cas12a/crRNA system. The incubation was carried out at 37 ℃ and the fluorescence signal was observed. When Cas12a/crRNA recognizes and cleaves a test sequence complementary to crRNA, the trans cleavage activity of Cas12a can be activated, cleaving the detection probe in the system. The specificity of the product is judged by detecting the characteristics of the labeling groups after the probe is sheared. Only the specifically amplified LAMP product can activate the activity of Cas12a, and non-specific amplification cannot. In addition, the method is also a LAMP detection mode based on sequence specificity.
Furthermore, the detection probe sequence is 5-12T basic groups, and both ends of the detection probe sequence are marked with functional groups.
Furthermore, one end of the probe is marked with a fluorescent group, and the other end of the probe is marked with a quenching group.
The Cas12a/crRNA complex recognizes a DNA target with a PAM site and complementary to the crRNA, and cleaves in cis. At this point, the trans-enzyme activity of Cas12a is activated and Cas12a can cleave the quenched fluorescent probe, resulting in fluorescence not being inhibited by the quencher and being released.
Further, the fluorophore of the probe is FAM.
Further, the detection of the fluorescence signal is performed by using a fluorescence quantitative PCR instrument, and if the fluorescence signal can be detected, the amplification product has high specificity.
Further, the detection of the fluorescence signal is performed by using an ultraviolet flashlight, and if the fluorescence signal can be detected, the amplification product has high specificity.
The invention also comprises the application of the high-specificity loop-mediated isothermal amplification method in gene detection.
Compared with the prior art, the invention has the following advantages and effects:
1. the high-specificity loop-mediated isothermal amplification method has high-efficiency pollution degradation capability and can resist high-concentration aerosol pollution. The high efficiency of Cas9/sgRNA makes CUT-LAMP have high cleavage efficiency, and can effectively degrade FEIKE-level pollution amplification products.
2. The highly specific loop-mediated isothermal amplification method of the present invention is compatible with all closed-tube and open-tube detection schemes. For closed tube detection, the Cas9/sgRNA system can be added with other reagents without additional addition steps.
3. The invention has universality and convenient and quick change and design of the primer. For different gene detection, only the forward primer of the sgRNA and the inner primer in the LAMP primer mixture need to be changed. Wherein the sgRNA only needs to change a targeted 20-nt sequence, the inner primer only needs to add NCC sites in F1c and F2, and the change of the middle site of the primer does not influence the amplification efficiency of LAMP. The existing restriction enzyme technology needs to add 4-6 sites, which easily causes amplification failure.
4. The CUT-LAMP of the invention does not significantly increase the number of steps. The same temperature control procedure as conventional LAMP can be used, since Cas9/sgRNA cleavage can be performed at room temperature, while the inactivation of Cas9/sgRNA is also lower than the LAMP working temperature (65 degrees), so no additional inactivation procedure is required.
5. The CUT-LAMP of the invention does not increase time significantly. Only 5 to 10 minutes more pre-incubation time is required compared to conventional LAMP. Without significantly affecting amplification efficiency and sensitivity.
6. The invention can realize high specificity detection of LAMP products by combining the CRISPR/Cas12a system, and solves the problem that the existing detection technology can not distinguish amplification products from non-specific amplification or primer dimers.
For a better understanding and practice, the invention is described in detail below with reference to the accompanying drawings.
Drawings
FIG. 1 is a schematic diagram of the LAMP principle.
FIG. 2 is a schematic diagram of the CUT-LAMP principle.
Fig. 3 is a schematic diagram of CRISPR/Cas12 a-mediated LAMP detection principle.
FIG. 4 is a real-time fluorescence curve used in example 2 to evaluate the feasibility of CUT-LAMP.
FIG. 5 is a case of evaluating the amplification of CUT-LAMP in a contaminated system by electrophoresis in example 2.
FIG. 6 is a comparison of the ability of CUT-LAMP in example 3 to tolerate mock contaminants compared to conventional LAMP.
Detailed Description
All materials, reagents and equipment selected for use in the present invention are well known in the art, but do not limit the practice of the invention, and other reagents and equipment well known in the art may be suitable for use in the practice of the following embodiments of the invention.
The primers in the following examples were synthesized by Biotechnology, Inc. (Shanghai, China), PCR purification kit and adenosine triphosphate (NTP) were synthesized by Biotechnology, Inc. (Shanghai, China), and RNA purification kit was purchased from Tiangen Biotechnology, Inc. (Beijing, China). Bst2.0 Hot Start DNA polymerase was purchased from NEB, dNTPs from TAKARA, and SYBR Green I from Saimer. Genomic DNA was extracted from a bacterial genome extraction kit of Tiangen Bio Inc.
Example 1
High-specificity loop-mediated isothermal amplification method
(1) Designing an amplification primer: a complementary site NCC of PAM is added in the FIP/BIP primer of the conventional LAMP amplification method, so that a product of CUT-LAMP contains a PAM site NGG which can be effectively recognized and CUT by Cas 9/sgRNA.
(2) The sgRNA was designed such that the Cas9/sgRNA complex can specifically recognize and cleave the amplification product without cleaving the target.
In this embodiment, the DNA template primer sequences for sgRNA in vitro transcription include a forward primer and a reverse primer;
the primers are subjected to PCR amplification, the reaction system is as follows, the reaction is carried out in a thermal cycle PCR instrument, and the PCR amplification procedure is as follows: denaturation at 95 ℃ for 20 seconds, annealing at 60 ℃ for 30 seconds, extension at 72 ℃ for 15 seconds, for a total of 35 cycles, and final extension at 72 ℃ for 10 minutes. The sgRNA obtained by PCR amplification transcribes the DNA template, and the PCR product is detected by agarose gel electrophoresis and purified by a kit.
sgRNA Synthesis System (50. mu.L)
| Reactants | Amount of addition | Final concentration | |
| Nuclease-free water | 20μL | —— | |
| Forward primer (10. mu.M) | 2.5μL | 0.5μM | |
| Reverse primer (10. mu.M) | 2.5μL | 0.5μM | |
| rTaq DNA | 25μL | 1× |
The purified product is subjected to transcription reaction mediated by T7-RNA polymerase for 4-6h at 37 ℃, and sgRNA (100-nt) is obtained through in vitro transcription. The sgRNA in vitro transcription reaction system is as follows, wherein the polymerase buffer solution is 40mM Tris-HCl，6mM MgCl21mM DTT, 2mM spermidine. The resulting product was purified with an RNA purification kit and used in subsequent experiments after detection by polyacrylamide electrophoresis, or stored at-80 ℃.
sgRNA in vitro transcription reaction System (20. mu.L)
| Reactants | Amount of addition | Final concentration | |
| Nuclease-free water | 11μL | —— | |
| Template DNA | 0.5 | 500ng | |
| 10 XRNA | 2μL | 1× | |
| NTP(10mM) | 4μL | 2mM | |
| RNase inhibitors | 0.5μL | 20U | |
| T7RNA polymerase | 2μL | 20U |
(3) Amplification: cas9/sgRNA forms a complex, and then an amplification system is added, and amplification is carried out according to a normal LAMP amplification program.
The method comprises the following specific steps: cas9 and sgRNA were incubated at 37 ℃ or room temperature for 10 minutes to form a complex. And then adding the primer group into an amplification system, and incubating for 5-20min at 37 ℃, wherein the Cas9/sgRNA complex begins to search for a LAMP amplification product containing a PAM site in the system, and the Cas9/sgRNA cuts off the product at a position 3bp downstream of the PAM site, so that the LAMP amplification cannot be caused by a contaminated product in the system.
CUT-LAMP amplification system (25 μ L)
(4) The CRISPR/Cas12a/crRNA system is combined to realize high specificity detection of LAMP products.
Searching a PAM site (VTTT) containing Cas12a in the target, designing 20-nt in the crRNA to be complementary with the target, adding a T7 promoter sequence in front of a complementary region, and synthesizing two complementary DNA oligonucleotide strands.
Annealing was performed in a thermal cycling PCR instrument, annealing two complementary oligonucleotide strands (10. mu.M), denaturing by heating at 95 ℃ for 5 minutes, slowly cooling to 25 ℃ in 1 Xbuffer (20nM Tris-Cl, pH 7.5, 100mM KCl, 5mM MgCl2) at 2 ℃/min, and synthesizing a double stranded DNA template of crRNA. The crRNA was then synthesized by transcription at 37 ℃ for 4 hours in the following system. The transcribed RNA was purified by RNA purification kit, and after detection by polyacrylamide electrophoresis, the concentration of the obtained crRNA was measured by Nanodrop 2000.
crRNA in vitro transcription synthesis system (20. mu.L)
| Reactants | Amount of addition | Final concentration | |
| Nuclease-free water | 11μL | —— | |
| Template DNA | 0.5 | 500ng | |
| 10 XRNA | 2μL | 1× | |
| NTP(10mM) | 4μL | 2mM | |
| RNase inhibitors | 0.5μL | 20U | |
| T7RNA polymerase | 2μL | 20U |
And (4) taking the amplification reaction solution from the step (3), adding the amplification reaction solution into a Cas12a/crRNA system, and carrying out in-vitro cleavage reaction. Incubating at 37 deg.C, detecting with fluorescent quantitative PCR instrument, or irradiating with 365nm ultraviolet flashlight, and observing fluorescent signal.
Cas12a/crRNA in vitro cleavage reaction system (20 μ L)
Referring to fig. 2, the primer design principle of the application is that 1-3 cytosine bases are added between two targeting regions of an inner primer of LAMP, so that a product amplified by using the primer contains a PAM site, and Cas9/sgRNA can identify and cut the amplification product containing the PAM site. In conventional LAMP, previously amplified products can serve as templates for negative controls leading to false positive amplification. In CUT-LAMP, CRISPR/Cas9 specifically recognizes and cleaves a previously amplified product containing PAM before LAMP reaction. Therefore, false positive amplification did not occur in the negative control group, and the positive group was amplified normally.
Referring to fig. 3, CRISPR/Cas12 a-mediated detection of LAMP products can distinguish between specific target amplification and non-specific amplification of primer dimers. Cas12a/crRNA recognizes and cleaves LAMP products in the target region that are complementary to the crRNA and have a PAM site (VTTT). After cleavage, the trans-enzyme activity of Cas12a is activated, degrading the fluorescent signal probe, releasing the fluorescent signal.
Example 2
Application of high-specificity loop-mediated isothermal amplification method in detection of salmonella typhimurium invA gene
The gene sequence is as follows (SEQ ID NO: 1): 5' -GATATTGCCTACAAGCATGAAATGGCAGAACAGCGTCGTACTATTGAAAAGCTGTCTTAATTTAATATTAACAGGATACCTATAGTGCTGCTTTCTCTACTTAACAGTGCTCGTTTACGACCTGAATTACTGATTCTGGTACTAATGGTGATGATCATTTCTATGTTCGTCATTCCATTACCTACCTATCTGGTTGATTTCCTGATCGCACTGAATATCGTACTGGCGATATTGGTGTTTATGGGGTCGTTCTACATTGACAGAATCCTCAGTTTTTCAACGTTTCCTGCGGTACTGTTAATTACCACGCTCTTTCGTCTGGCATTATCGATCAGTACCAG TCGTCTTATCTTGATTGAAGCCGATGCCGGTGAAATTATCGCCACGTTCGGGCAATTCGTTATTGGCGATAGCCTG GCGGTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGGTTCAGAACGTGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGAACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTTTACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTGACGCTATTGCCGGCATCATTATTATCTTTGTGAACTTTATTGGCGGTATT-3' (the underlined part is the primer targeting region and the underlined regions are F3, F2, LF, F1c, B1, LB, B2C, B3 in that order)
(1) Designing primers of CUT-LAMP: two bases C are added in the middle of FIP/BIP primer of the conventional LAMP, so that the product of CUT-LAMP contains PAM locus NGG.
The primer sequence of the CUT-LAMP in this example is as follows:
FIP (forward inner primer) (SEQ ID NO:2):
5’-GACGACTGGTACTGATCGATAGTTTTTCAACGTTTCCTGCGG-3’
FIP (forward inner primer-containing a PAM complementary site) (SEQ ID NO:3):
5’-GACGACTGGTACTGATCGATCCAGTTTTTCAACGTTTCCTGCGG-3’
BIP (reverse inner primer) (SEQ ID NO:4):
5’-CCGGTGAAATTATCGCCACACAAAACCCACCGCCAGGAACGAT-3’
FOP (Forward outer primer) (SEQ ID NO:5): 5'-GGCGATATTGGTGTTTATGGGG-3'
BOP (reverse outer primer) (SEQ ID NO:6): 5'-AACGATAAACTGGACCACGG-3'
LF (forward loop primer) (SEQ ID NO: 7): 5'-GACGAAAGAGCGTGGTAATTAAC-3'
LB (reverse loop primer) (SEQ ID NO: 8): 5'-GGGCAATTCGTTATTGGCGATAG-3'
(2) The sgRNA was designed such that the Cas9/sgRNA complex can specifically recognize and cleave the amplification product without cleaving the target.
In this example, the amplification sequences of the sgRNA in vitro transcribed DNA template primers are as follows:
forward primer (SEQ ID NO: 9): 5' -GAAATTAATACGACTCACTATAGGCGCAGGAAACGTTGAAAAACGTTTTAGAGCTAGAAATAGC-3' (the cross-hatched portion is the T7 promoter region)
Reverse primer (SEQ ID NO: 10): 5'-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3'
The primers were PCR-amplified and purified, and the purified product was transcribed with T7-RNA polymerase to obtain RNA for the product, in the same manner as in example 1.
(3) Cas9/sgRNA forms a complex, and then an amplification system is added, and amplification is carried out according to a normal LAMP amplification program.
Cas9 and sgRNA were incubated at 37 ℃ or room temperature for 10 min to form a complex, with Cas9 concentration of 60nM and sgRNA concentration of 60 nM. And then adding the primer group into an amplification system, and incubating for 5-20min at 37 ℃, wherein the Cas9/sgRNA complex begins to search for a LAMP amplification product containing a PAM site in the system, and the Cas9/sgRNA cuts off the product at a position 3bp downstream of the PAM site, so that the LAMP amplification cannot be caused by a contaminated product in the system.
The amplification system and procedure of this example were the same as in example 1.
(4) The CRISPR/Cas12a/crRNA system is combined to realize high specificity detection of LAMP products.
Searching a target containing a PAM site VTTT of Cas12a, designing 20-nt in crRNA to be complementary with the target, adding a T7 promoter sequence in front of a complementary region, and synthesizing two complementary DNA oligonucleotide strands, wherein a forward primer (SEQ ID NO:11) is:
5'-GCCCTTAATACGACTCACTATAGGGAATTTCTACTGTTGTAGATCTGCGGTACTGTTAATTACCACGC-3' (crossline segment is T7 promoter region)
The reverse primer (SEQ ID NO:12) was:
5’-GCGTGGTAATTAACAGTACCGCAGATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAAGGGC-3’。
the detection method in this example was the same as in example 1, and the sequence of the quenched fluorescent probe in this example was 5 'FAM-TTTTTT-Q3' (SEQ ID NO: 13).
In order to verify whether the CUT-LAMP in the embodiment has the expected cleavage effect, the experiment operation is carried out in a laboratory containing aerosol pollution, the conventional LAMP and the CUT-LAMP system are used as a control, a fluorescence quantifier is used for monitoring the fluorescence change of different amplification methods in real time by combining SYBR Green I dye, the fluorescence intensity is collected to form an amplification kinetic curve, and the pollution cleavage effect of the CUT-LAMP system is verified. As shown in fig. 3, the positive group of conventional LAMP-added targets (positive triangle) amplified efficiently, but the negative blank (circle) also amplified. In CUT-LAMP, no amplification occurred in negative samples treated with Cas9/sgRNA (targeting invA gene) (inverted triangle) and the amplification efficiency of positive samples was unaffected (diamond). The results show that the CUT-LAMP system can target and CUT off potential pollutants in the system, so that aerosol products mixed in the negative control cannot be further amplified.
FIG. 5 is an electrophoretic evaluation of the amplification of CUT-LAMP in a contaminated system. The negative control of the CUT-LAMP with the target sgRNA added (lane 4) did not amplify, only the lane with bright primers, which proves that the aerosol in the air did not amplify, the CUT-LAMP could avoid the amplification of contaminants, and did not CUT the target sequence, and the positive sample (lane 3) had a bright ladder lane, which was not affected by the amplification. Whereas the conventional LAMP (lanes 1 and 2) and CUT-LAMP (lanes 5 and 6) of the non-targeted sgRNA both have ladder-shaped bands and are amplified, which indicates that the two systems can not effectively resist pollution.
Example 3
Application of high-specificity loop-mediated isothermal amplification method in Neisseria meningitidis (conserved gene ctrA)
The gene sequence of ctrA is as follows:
5’-GTGTTTAAAGTGAAATTTTATATTCGTCACGCAGTATTATTATTGTGTGGAAGTTTAATTGTAGGATGCTCTGCGATTCCTTCATCAGGCCCCAGCGCAAAAAAAATTGTCTCTTTAGGGCAACAATCTGAAGTTCAAATTCCTGAAGTGGAGCTGATTGATGTGAATCATACGGTTGCTCAGTTATTATATAAGGCTCAGATAAATCAGTCATTCACTCAGTTTGGCGATGGTTATGCTTCGGCTGGTACGCTAAATATTGGTGATGTATTGGATATTATGATTTGGGAAGCGCCGCCGGCAGTATTGTTTGGTGGTGGCCTTTCTTCGATGGGCTCGGGTAGTGCGCATCAAACTAAGTTGCCAGAGCAGTTGGTCACGGCACGTGGTACGGTTTCTGTGCCGTTTGTTGGCGATATTTCGGTGGTCGGTAAAACGCCTGGTCAGGTTCAGGAAATTATTAAAGGCCGCCTGAAAAAAATGGCCAATCAGCCACAAGTGATGGTGCGTTTGGTGCAGAATAATGCGGCGAATGTGTCGGTGATTCGTGCTGGGAATAGTGTGCGTATGCCGCTGACGGCAGCCGGTGAGCGTGTGTTGGATGCGGTGGCTGCGGTAGGTGGTTCAACGGCAAATGTGCAGGATACGAATGTGCAGCTGACACGTGGCAATGTAGTACGAACTGTTGCCTTGGAAGATTTAGTTGCAAATCCGCGACAAAATATTTTGCTGCGTCGCGGTGATGTGGTTACCATGATTACCAATCCCTATACCTTTACGTCTATGGGTGCGGTGGGGAGAACACAAGAAATCGGTTTTTCAGCC AGAGGCTTATCGCTTTCTGAAGCCATTGGCCGTATGGGCGGTTTGCAAGATCGCCGTTCTGATGCGCGTGGTGTGT TTGTGTTCCGCTATACGCCATTGGTGGAATTGCCGGCAGAACGTCAGGATAAATGGATTGCTCAAGGTTATGGCAG TGAGGCAGAGATTCCAACGGTATATCGTGTGAATATGGCTGATGCGCATTCGCTATTTTCTATGCAGCGCTTTCCTGTGAAGAATAAAGATGTATTGTATGTGTCGAATGCGCCGTTGGCTGAAGTGCAGAAATTTTTGTCGTTTGTGTTCTCGCCGGTTACCAGTGGCGCGAACAGTATTAATAATTTAACTAATTAA-3' ((the underlined part is the primer targeting region, and the underlined regions are F3, F2, LF, F1c, B1, LB, B2C, B3 in that order)
(1) Designing primers of CUT-LAMP: two bases C are added in the middle of FIP/BIP primer of the conventional LAMP, so that the product of CUT-LAMP contains PAM locus NGG.
The primer sequence of the CUT-LAMP in this example is as follows:
FIP (forward inner primer) (SEQ ID NO:15):
5’CAAACACACCACGCGCATCAGATCTGAAGCCATTGGCCGTA3’
FIP (forward inner primer, containing PAM complementary site) (SEQ ID NO:16):
5’CAAACACACCACGCGCATCAGACCTCTGAAGCCATTGGCCGTA-3’
BIP (reverse inner primer) (SEQ ID NO: 17):
5’TGTTCCGCTATACGCCATTGGTACTGCCATAACCTTGAGCAA
FOP (forward outer primer) (SEQ ID NO:18):5 'AGCYAGAGGCTTATCGCTT-3' (wherein Y is a degenerate base, and represents cytosine C and thymine T)
BOP (reverse outer primer) (SEQ ID NO:19):5 'ATACCGTTGGAATCTCTGCC-3'
LF (forward loop primer) (SEQ ID NO: 20): 5 'CGATCTTGCAAACCGCCC-3'
LB (reverse loop primer) (SEQ ID NO: 21): 5 'GCAGAACGTCAGGATAAATGGA-3'
(2) The sgRNA was designed such that the Cas9/sgRNA complex can specifically recognize and cleave the amplification product without cleaving the target.
In this example, the amplification sequences of the sgRNA in vitro transcribed DNA template primers are as follows:
forward primer (SEQ ID NO: 9): 5'-GAAATTAATACGACTCACTATAGGGTACGGCCAATGGCTTCAGAGTTTTAGAGCTAGAAATAGC-3'
Reverse primer (SEQ ID NO: 22): 5'-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3'
The primers were PCR-amplified and purified, and the purified product was transcribed with T7-RNA polymerase to obtain RNA for the product, in the same manner as in example 1.
(3) Cas9/sgRNA forms a complex, and then an amplification system is added, and amplification is carried out according to a normal LAMP amplification program.
The amplification method of the invention comprises the following steps: cas9 and sgRNA were incubated at 37 ℃ or room temperature for 10 min to form a complex, with Cas9 concentration of 60nM and sgRNA concentration of 60 nM. And then adding the primer group into an amplification system, and incubating for 5-20min at 37 ℃, wherein the Cas9/sgRNA complex begins to search for a LAMP amplification product containing a PAM site in the system, and the Cas9/sgRNA cuts off the product at a position 3bp downstream of the PAM site, so that the LAMP amplification cannot be caused by a contaminated product in the system.
The amplification of the invention and the conventional LAMP amplification are both incubated at 65 ℃ for 50 minutes, the CUT-LAMP amplification system is the same as that of the embodiment 1, and the conventional LAMP amplification system is as follows:
conventional LAMP amplification System (25. mu.L)
(4) The CRISPR/Cas12a/crRNA system is combined to realize high specificity detection of LAMP products.
Searching a target containing a PAM site VTTT of Cas12a, designing 20-nt in crRNA to be complementary with the target, adding a T7 promoter sequence in front of a complementary region, and synthesizing two complementary DNA oligonucleotide strands, wherein a forward primer (SEQ ID NO:23) is:
5’-GCCCTTAATACGACTCACTATAGGGAATTTCTACTGTTGTAGATCTGCGGTACTGTTAATTACCACGC-3’
the reverse primer (SEQ ID NO:24) was:
5’-GCGTGGTAATTAACAGTACCGCAGATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAAGGGC-3’。
the detection method in this example is the same as in example 2.
FIG. 6 is a comparison of the universal type of CUT-LAMP for detection of the ctrA gene of Neisseria meningitidis versus the ability of conventional LAMP to tolerate mock contaminants. A. The tolerance capability of the CUT-LAMP to simulated pollutants is tested by using different pollution amounts, and the anti-pollution capability of the CUT-LAMP is further evaluated in the Neisseria meningitidis detection. Contamination with amplification product up to 10 picograms also did not result in any background amplification. Avoiding false positives caused by previously amplified products. And under the reaction condition, the CUT-LAMP does not influence the normal amplification of the genome DNA. B. Conventional LAMP was tested for simulated contaminants with varying amounts of contamination. In the conventional LAMP system, all groups with added mock contaminants can see significant fluorescent signals, even as low as1 femtogram of mock contaminants will cause false positive amplification.
The above embodiments can show that the amplification method of the present invention can achieve feike level pollution removal, effectively reduce the false positive rate of the traditional LAMP method, and improve the detection accuracy.
The present invention is not limited to the above-described embodiments, and various modifications and variations of the present invention are intended to be included within the scope of the claims and the equivalent technology of the present invention if they do not depart from the spirit and scope of the present invention.
Sequence listing
SEQUENCE LISTING
<110> university of south China
<120> high-specificity loop-mediated isothermal amplification method and application thereof
<160> 13
<170>PatentIn version 3.1
<210>1
<211>720
<212> DNA
<213> Salmonella typhimurium invA gene sequence
<220>
<223> Salmonella typhimurium invA gene sequence
<400>1
gatattgcct acaagcatga aatggcagaa cagcgtcgta ctattgaaaa gctgtcttaa 60
tttaatatta acaggatacc tatagtgctg ctttctctac ttaacagtgc tcgtttacga 120
cctgaattac tgattctggt actaatggtg atgatcattt ctatgttcgt cattccatta 180
cctacctatc tggttgattt cctgatcgca ctgaatatcg tactggcgat attggtgttt 240
atggggtcgt tctacattga cagaatcctc agtttttcaa cgtttcctgc ggtactgtta 300
attaccacgc tctttcgtct ggcattatcg atcagtacca gtcgtcttat cttgattgaa 360
gccgatgccg gtgaaattat cgccacgttc gggcaattcg ttattggcga tagcctggcg 420
gtgggttttg ttgtcttctc tattgtcacc gtggtccagt ttatcgttat taccaaaggt 480
tcagaacgtg tcgcggaagt cgcggcccga ttttctctgg atggtatgcc cggtaaacag 540
atgagtattg atgccgattt gaaggccggt attattgatg cggatgccgc gcgcgaacgg 600
cgaagcgtac tggaaaggga aagccagctt tacggttcct ttgacggtgc gatgaagttt 660
atcaaaggtg acgctattgc cggcatcatt attatctttg tgaactttat tggcggtatt 720
<210>2
<211>42
<212> DNA
<213> Artificial sequence
<220>
<223> Forward inner primer in example 2
<400>2
gacgactggt actgatcgat agtttttcaa cgtttcctgc gg 42
<210>3
<211>44
<212> DNA
<213> Artificial sequence
<220>
<223> Forward inner primer-containing PAM complementary site in example 2
<400>3
gacgactggt actgatcgat ccagtttttc aacgtttcct gcgg 44
<210>4
<211>43
<212> DNA
<213> Artificial sequence
<220>
<223> reverse inner primer in example 2
<400>4
ccggtgaaat tatcgccaca caaaacccac cgccaggaac gat 43
<210>5
<211>22
<212> DNA
<213> Artificial sequence
<220>
<223> Forward outer primer in example 2
<400>5
ggcgatattg gtgtttatgg gg 22
<210>6
<211>20
<212> DNA
<213> Artificial sequence
<220>
<223> reverse outer primer in example 2
<400>6
<210>7
<211>23
<212> DNA
<213> Artificial sequence
<220>
<223> Forward Loop primer in example 2
<400>7
gacgaaagag cgtggtaatt aac 20
<210>8
<211>23
<212> DNA
<213> Artificial sequence
<220>
<223> reverse loop primer in example 2
<400>8
gggcaattcg ttattggcga tag 23
<210>9
<211>64
<212> DNA
<213> Artificial sequence
<220>
<223> in vitro transcribed DNA template forward primer of sgRNA in example 2
<400>9
gaaattaata cgactcacta taggcgcagg aaacgttgaa aaacgtttta gagctagaaa 60
tagc 64
<210>10
<211>80
<212> DNA
<213> Artificial sequence
<220>
<223> in vitro transcribed DNA template reverse primer of sgRNA in example 2
<400>10
aaaagcaccg actcggtgcc actttttcaa gttgataacg gactagcctt attttaactt 60
gctatttcta gctctaaaac 80
<210>11
<211>68
<212> DNA
<213> Artificial sequence
<220>
<223> Forward primer required for crRNA in example 2
<400>11
gcccttaata cgactcacta tagggaattt ctactgttgt agatctgcgg tactgttaat 60
taccacgc 68
<210>12
<211>68
<212> DNA
<213> Artificial sequence
<220>
<223> reverse primer required for crRNA in example 2
<400>12
gcgtggtaat taacagtacc gcagatctac aacagtagaa attccctata gtgagtcgta 60
ttaagggc 68
<210>13
<211>6
<212> DNA
<213> Artificial sequence
<220>
<223> quenched fluorescent probe sequence in example 2
<400>13
<210>14
<211>1176
<212> DNA
<213> sequence of conserved gene ctrA of Neisseria meningitidis
<220>
<223> sequence of conserved gene ctrA of Neisseria meningitidis
<400>14
gtgtttaaag tgaaatttta tattcgtcac gcagtattat tattgtgtgg aagtttaatt 60
gtaggatgct ctgcgattcc ttcatcaggc cccagcgcaa aaaaaattgt ctctttaggg 120
caacaatctg aagttcaaat tcctgaagtg gagctgattg atgtgaatca tacggttgct 180
cagttattat ataaggctca gataaatcag tcattcactc agtttggcga tggttatgct 240
tcggctggta cgctaaatat tggtgatgta ttggatatta tgatttggga agcgccgccg 300
gcagtattgt ttggtggtgg cctttcttcg atgggctcgg gtagtgcgca tcaaactaag 360
ttgccagagc agttggtcac ggcacgtggt acggtttctg tgccgtttgt tggcgatatt 420
tcggtggtcg gtaaaacgcc tggtcaggtt caggaaatta ttaaaggccg cctgaaaaaa 480
atggccaatc agccacaagt gatggtgcgt ttggtgcaga ataatgcggc gaatgtgtcg 540
gtgattcgtg ctgggaatag tgtgcgtatg ccgctgacgg cagccggtga gcgtgtgttg 600
gatgcggtgg ctgcggtagg tggttcaacg gcaaatgtgc aggatacgaa tgtgcagctg 660
acacgtggca atgtagtacg aactgttgcc ttggaagatt tagttgcaaa tccgcgacaa 720
aatattttgc tgcgtcgcgg tgatgtggtt accatgatta ccaatcccta tacctttacg 780
tctatgggtg cggtggggag aacacaagaa atcggttttt cagccagagg cttatcgctt 840
tctgaagcca ttggccgtat gggcggtttg caagatcgcc gttctgatgc gcgtggtgtg 900
tttgtgttcc gctatacgcc attggtggaa ttgccggcag aacgtcagga taaatggatt 960
gctcaaggtt atggcagtga ggcagagatt ccaacggtat atcgtgtgaa tatggctgat 1020
gcgcattcgc tattttctat gcagcgcttt cctgtgaaga ataaagatgt attgtatgtg 1080
tcgaatgcgc cgttggctga agtgcagaaa tttttgtcgt ttgtgttctc gccggttacc 1140
agtggcgcga acagtattaa taatttaact aattaa 1176
<210>15
<211>41
<212> DNA
<213> Artificial sequence
<220>
<223> Forward inner primer in example 3
<400>15
caaacacacc acgcgcatca gatctgaagc cattggccgt a 41
<210>16
<211>43
<212> DNA
<213> Artificial sequence
<220>
<223> Forward inner primer containing PAM complementary site in example 3
<400>16
caaacacacc acgcgcatca gacctctgaa gccattggcc gta 43
<210>17
<211>42
<212> DNA
<213> Artificial sequence
<220>
<223> reverse inner primer in example 3
<400>17
tgttccgcta tacgccattg gtactgccat aaccttgagc aa 42
<210>18
<211>19
<212> DNA
<213> Artificial sequence
<220>
<223> Forward outer primer in example 3
<400>18
agcyagaggc ttatcgctt 19
<210>19
<211>20
<212> DNA
<213> Artificial sequence
<220>
<223> reverse outer primer in example 3
<400>19
<210>20
<211>18
<212> DNA
<213> Artificial sequence
<220>
<223> Forward Loop primer in example 3
<400>20
cgatcttgca aaccgccc 18
<210>21
<211>22
<212> DNA
<213> Artificial sequence
<220>
<223> reverse loop primer in example 3
<400>21
gcagaacgtc aggataaatg ga 22
<210>22
<211>80
<212> DNA
<213> Artificial sequence
<220>
<223> DNA template reverse primer for sgRNA in vitro transcription in example 3
<400>22
aaaagcaccg actcggtgcc actttttcaa gttgataacg gactagcctt attttaactt 60
gctatttcta gctctaaaac 80
<210>23
<211>68
<212> DNA
<213> Artificial sequence
<220>
<223> Forward primer required for crRNA in example 3
<400>23
gcccttaata cgactcacta tagggaattt ctactgttgt agatctgcgg tactgttaat 60
taccacgc 68
<210>24
<211>68
<212> DNA
<213> Artificial sequence
<220>
<223> reverse primer required for crRNA in example 3
<400>24
gcgtggtaat taacagtacc gcagatctac aacagtagaa attccctata gtgagtcgta 60
ttaagggc 68
Claims (10)
1. A high specificity loop-mediated isothermal amplification method comprises the following steps:
1) designing an amplification primer: adding complementary site NCC of PAM in FIP/BIP primer of conventional LAMP amplification method to make product of CUT-LAMP contain PAM site NGG;
2) design of sgRNA: designing the sgRNA according to the primer in the step (1) so that the Cas9/sgRNA complex can specifically recognize and cut other contaminating sequences in the amplification product besides the target sequence;
3) amplification: adding a Cas9/sgRNA compound into an amplification system, and amplifying according to a normal LAMP amplification program, wherein the sgRNA is a sequence designed in the step (2);
4) and (3) specific detection of the amplification product.
2. The method of claim 1, wherein the primers of the CUT-LAMP in step 1) are designed to add two bases C to FIP/BIP primers of the conventional LAMP amplification method.
3. The method of claim 2, wherein if there is a base C in the middle of FIP or BIP of the conventional LAMP amplification method, the CUT-LAMP primer of step 1) is designed to have a base C added next to the base C of the conventional FIP or BIP primer.
4. The method of claim 1, wherein the detection method in step 4) is to place the amplification product and a single-stranded detection probe with a labeling group in the Cas12a/crRNA system for cleavage reaction, the crRNA is designed according to the target sequence, the detection probe is cleaved while the amplification product is cleaved, and the specificity of the product is determined by detecting the characteristics of the labeling group after the probe is cleaved.
5. The method of claim 4, wherein the detection probe has 5-12T bases and functional groups labeled at both ends.
6. The method of claim 5, wherein the probe is labeled with a fluorophore at one end and a quencher at the other end.
7. The method of claim 6, wherein the fluorophore of the probe is FAM.
8. The method of claim 6, wherein the fluorescence signal is detected by a quantitative fluorescence PCR instrument, and if the fluorescence signal is detected, the amplification product has high specificity.
9. The method of claim 6, wherein the fluorescence signal is detected by an ultraviolet torch, and if the fluorescence signal is detected, the amplification product has high specificity.
10. Use of the highly specific loop-mediated isothermal amplification method of claims 1-9 for gene detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910701221.4A CN112301102A (en) | 2019-07-31 | 2019-07-31 | High-specificity loop-mediated isothermal amplification method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910701221.4A CN112301102A (en) | 2019-07-31 | 2019-07-31 | High-specificity loop-mediated isothermal amplification method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112301102A true CN112301102A (en) | 2021-02-02 |
Family
ID=74486149
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910701221.4A Pending CN112301102A (en) | 2019-07-31 | 2019-07-31 | High-specificity loop-mediated isothermal amplification method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112301102A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113943775A (en) * | 2021-10-28 | 2022-01-18 | 陕西科技大学 | Closed-tube visual PCR detection method for eliminating cross contamination |
| JP7374377B2 (en) | 2021-02-26 | 2023-11-06 | 王偉佳 | Test kit for Salmonella typhi, its manufacturing method, and its uses |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1059562A (en) * | 1990-05-01 | 1992-03-18 | 安姆根有限公司 | Reduce the method for carryover contamination in the amplification procedure |
| US5650302A (en) * | 1990-05-01 | 1997-07-22 | Amgen Inc. | Method for reducing carryover contamination in an amplification procedure |
| US20080311627A1 (en) * | 2004-06-17 | 2008-12-18 | Epigenomics Ag | Compositions and Methods for Preventing Carry-Over Contamination in Nucleic Acid Amplification Reactions |
| WO2010126913A1 (en) * | 2009-04-27 | 2010-11-04 | Gen-Probe Incorporated | Methods and kits for use in the selective amplification of target sequences |
| CN103382502A (en) * | 2013-05-28 | 2013-11-06 | 浙江今复康生物科技有限公司 | RT-PCR method integrated with restriction endonuclease removal of DNA pollution |
| CN109207563A (en) * | 2017-06-30 | 2019-01-15 | 青岛科技大学 | A kind of antipollution method of LAMP |
| WO2019011022A1 (en) * | 2017-07-14 | 2019-01-17 | 上海吐露港生物科技有限公司 | Application of cas protein, method for detecting target nucleic acid molecule and kit |
| CN109706227A (en) * | 2019-01-24 | 2019-05-03 | 浙江大学 | A kind of quick visualization and the nucleic acid on-site inspection method that Aerosol Pollution can be prevented |
-
2019
- 2019-07-31 CN CN201910701221.4A patent/CN112301102A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1059562A (en) * | 1990-05-01 | 1992-03-18 | 安姆根有限公司 | Reduce the method for carryover contamination in the amplification procedure |
| US5650302A (en) * | 1990-05-01 | 1997-07-22 | Amgen Inc. | Method for reducing carryover contamination in an amplification procedure |
| US20080311627A1 (en) * | 2004-06-17 | 2008-12-18 | Epigenomics Ag | Compositions and Methods for Preventing Carry-Over Contamination in Nucleic Acid Amplification Reactions |
| WO2010126913A1 (en) * | 2009-04-27 | 2010-11-04 | Gen-Probe Incorporated | Methods and kits for use in the selective amplification of target sequences |
| CN103382502A (en) * | 2013-05-28 | 2013-11-06 | 浙江今复康生物科技有限公司 | RT-PCR method integrated with restriction endonuclease removal of DNA pollution |
| CN109207563A (en) * | 2017-06-30 | 2019-01-15 | 青岛科技大学 | A kind of antipollution method of LAMP |
| WO2019011022A1 (en) * | 2017-07-14 | 2019-01-17 | 上海吐露港生物科技有限公司 | Application of cas protein, method for detecting target nucleic acid molecule and kit |
| CN109706227A (en) * | 2019-01-24 | 2019-05-03 | 浙江大学 | A kind of quick visualization and the nucleic acid on-site inspection method that Aerosol Pollution can be prevented |
Non-Patent Citations (5)
| Title |
|---|
| FRANCESCO IORIO ET AL.: "Unsupervised correction of gene-independent cell responses to CRISPR-Cas9 targeting", 《BMC GENOMICS》, vol. 19, no. 1, pages 1 - 16, XP021259523, DOI: 10.1186/s12864-018-4989-y * |
| HIROSHI ARAKAWA: "A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism", 《SCI ADV》, vol. 2, no. 8, pages 1 - 10, XP055909688, DOI: 10.1126/sciadv.1600699 * |
| LI SY ET AL.: "CRISPR-Cas12b-assisted nucleic acid detection platform", 《CELL DISCOV》, vol. 4, pages 1 - 4 * |
| TING WANG ET AL.: "An RNA-Guided Cas9 Nickase-Based Method for Universal Isothermal DNA Amplification", 《ANGEW CHEM INT ED ENGL》, vol. 58, no. 16, pages 5382 - 5386 * |
| 井豪: "基于恒温核酸扩增的沙门氏菌检测方法的研究", 《中国优秀硕士学位论文全文数据库 工程科技Ⅰ辑》, no. 10, pages 027 - 334 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP7374377B2 (en) | 2021-02-26 | 2023-11-06 | 王偉佳 | Test kit for Salmonella typhi, its manufacturing method, and its uses |
| CN113943775A (en) * | 2021-10-28 | 2022-01-18 | 陕西科技大学 | Closed-tube visual PCR detection method for eliminating cross contamination |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551800B (en) | Application of high-temperature-resistant Cas protein, and detection method and kit of target nucleic acid molecule | |
| CN111094588B (en) | Application of Cas protein, detection method of target nucleic acid molecule and kit | |
| JP5685085B2 (en) | Composition, method and kit for detecting ribonucleic acid | |
| AU2012251027B2 (en) | Quantitative nuclease protection Assay (qNPA) and sequencing (qNPS) improvements | |
| JP2021528090A (en) | Amplification methods, systems, and diagnostic methods based on the CRISPR effector system | |
| US20090053775A1 (en) | Copy dna and sense rna | |
| MX2014012214A (en) | Compositions and methods for quantifying a nucleic acid sequence in a sample. | |
| KR102648647B1 (en) | Improved detection of short homopolymeric repeat sequences | |
| CN110607356B (en) | Genome editing detection method, kit and application | |
| US20230056763A1 (en) | Methods of targeted sequencing | |
| JP2012080871A (en) | Method for directly detecting rna | |
| CN112301102A (en) | High-specificity loop-mediated isothermal amplification method and application thereof | |
| KR20140071968A (en) | Methods, systems, and compositions for detection of microbial dna by pcr | |
| CN115335536A (en) | Compositions and methods for point-of-care nucleic acid detection | |
| US20160122818A1 (en) | Gene expression analysis | |
| US20230323439A1 (en) | Crispr-based methods for the detection of nucleic acids in a sample | |
| CN114606298A (en) | Method for detecting length of one or more nucleic acid molecule amplification products in sample | |
| RU2800778C2 (en) | Use of high-therm-resistant cas-protein and a method and a set of reagents for detection of a target nucleic acid molecule | |
| US20230122979A1 (en) | Methods of sample normalization | |
| Heredia et al. | In vitro double transposition for DNA identification | |
| AU2015203545A1 (en) | Quantitative nuclease protection assay (qnpa) and sequencing (qnps) improvements | |
| CN113151409A (en) | High-specificity RPA/RAA detection kit and detection method | |
| CN117512075A (en) | Integrated nucleic acid detection method based on combination of nicking enzyme amplification and CRISPR/Cas12b | |
| CN116926070A (en) | Primer probe combination for loop-mediated isothermal amplification and application thereof | |
| CN116064736A (en) | Nucleic acid detection method based on medium-temperature Argonaute protein and isothermal amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |