CN116064736A - Nucleic acid detection method based on medium-temperature Argonaute protein and isothermal amplification - Google Patents

Abstract

The invention provides a nucleic acid detection method based on medium-temperature Argonaute protein and isothermal amplification. In particular, the present invention provides a detection system for detecting a target nucleic acid molecule, the system comprising: (a) a pair of guide ssDNA or a pair of guide ssRNA; (b) A medium-temperature Argonaute protein (Ago enzyme) which guides the cutting of target DNA or target RNA by taking DNA or RNA as a guide; (c) A fluorescent reporter nucleic acid bearing a fluorescent group and a quenching group; (d) reagents for isothermal amplification reactions; wherein the target nucleic acid molecule is a target nucleic acid. The method can be widely applied to the fields of detection of infectious diseases such as major infectious diseases and pathogen infectious diseases (viruses and pathogenic bacteria) and the like.

Description

Nucleic acid detection method based on medium-temperature Argonaute protein and isothermal amplification

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a nucleic acid detection method based on medium-temperature Argonaute protein and isothermal amplification.

Background

Nucleic acid detection is an important means of pathogen detection, genotyping, and disease course monitoring. Is widely applied to the fields of molecular medical diagnosis, food safety detection, environmental monitoring and the like.

The most effective current method for detecting viral nucleic acids is qPCR, which is also the gold standard for detecting viral nucleic acids. However, the method requires specialized and expensive instruments, has the defects of strict design requirements on primers and probes, and the like, and cannot be used as a portable and household detection method.

In recent years, isothermal amplification techniques have been developed in the field of nucleic acid detection. Isothermal amplification technology not only has the advantages of rapidness, high efficiency and specificity, but also does not need special equipment. Common isothermal nucleic acid amplification techniques such as loop-mediated isothermal amplification (LAMP), isothermal exponential amplification (EXPAR), etc. have now been combined with downstream detection techniques to develop novel nucleic acid detection techniques. However, most of the prior art techniques have tradeoffs in performance metrics (e.g., sensitivity and specificity).

The programmable nucleic acid binding protein can be targeted to different gene sequences and can specifically bind and cut target sequences, so that the specificity of the nucleic acid detection technology is further improved. Nucleic acid detection technology of CRISPR/Cas system is in progress, while the nucleic acid detection technology based on Argonaute protein is not limited by target sequence and is easy to realize one-enzyme multiplex detection, so that the technology is well developed and applied at present.

Nucleic acid detection methods based on the mesophilic prokaryotic Argonaute protein and reverse transcriptase have been developed but are not highly sensitive because they are incapable of amplifying viral nucleic acids in large quantities. At present, for the nucleic acid to be detected with extremely small quantity, a nucleic acid detection method with high development sensitivity and good specificity is still urgently needed.

Disclosure of Invention

The invention aims to provide a nucleic acid detection method with high development sensitivity and good specificity for a very small number of nucleic acid to be detected.

In a first aspect of the invention, there is provided a detection system for detecting a target nucleic acid molecule, the system comprising:

(a) A guide ssDNA pair or a guide ssRNA pair;

(b) A medium-temperature Argonaute protein (Ago enzyme) which guides the cutting of target DNA or target RNA by taking DNA or RNA as a guide;

(c) A fluorescent reporter nucleic acid bearing a fluorescent group and a quenching group;

(d) Reagents for isothermal amplification reactions;

wherein the target nucleic acid molecule is a target nucleic acid.

In another preferred embodiment, the medium temperature Argonaute protein (Ago enzyme) is a medium temperature Argonaute protein (Ago enzyme) that directs the cleavage of target DNA with DNA as a guide.

In another preferred embodiment, the medium temperature Argonaute protein (Ago enzyme) is a medium temperature Argonaute protein (Ago enzyme) that directs cleavage of a target RNA with RNA as a guide.

In another preferred embodiment, the isothermal amplification reaction comprises a (reverse transcription) amplification digestion reaction or a (reverse transcription) transcription reaction.

In another preferred embodiment, the isothermal amplification comprises RT-RAA, NASBA, RT-RPA.

In another preferred embodiment, the target nucleic acid includes single-stranded RNA, double-stranded RNA, single-stranded DNA, and double-stranded DNA.

In another preferred embodiment, the target nucleic acid comprises a target nucleic acid derived from a group consisting of: plants, animals, microorganisms, viruses, or combinations thereof.

In another preferred embodiment, the target nucleic acid is viral nucleic acid or bacterial 16s rRNA.

In another preferred embodiment, the target nucleic acid is an artificially synthesized or naturally occurring nucleic acid molecule.

In another preferred embodiment, the target nucleic acid comprises a wild-type or mutant nucleic acid molecule.

In another preferred embodiment, in the detection system, the target nucleic acid is subjected to isothermal amplification (digestion), and the obtained target DNA or RNA is recognized and cleaved by the medium-temperature Argonaute protein (Ago enzyme).

In another preferred embodiment, the target DNA is single stranded DNA.

In another preferred embodiment, the target RNA is single stranded RNA.

In another preferred embodiment, the medium temperature Argonaute protein (Ago enzyme) has the ability to direct cleavage of target DNA with DNA as a guide.

In another preferred embodiment, the medium temperature Argonaute protein (Ago enzyme) has the ability to direct cleavage of target RNA with RNA as guide.

In another preferred embodiment, the medium temperature Argonaute protein (Ago enzyme) is selected from the group consisting of: paenibacillus borealis Argonaute (PbAgo), clostridium butyricum Argonaute (CbAgo), kurthia massiliensis Argonaute (KmAgo), kluyveromyces polysporus Argonaute (KpAgo), human Argonaute 2 (hArgo 2) and mutants thereof.

In another preferred embodiment, the pair of guide ssDNA comprises a primary guide ssDNA and a secondary guide ssDNA.

In another preferred embodiment, the guide ssrnas comprise a primary guide ssRNA and a secondary guide ssRNA.

In another preferred embodiment, the guide ssDNA is a single-stranded DNA molecule.

In another preferred embodiment, the guide ssRNA is a single stranded RNA molecule.

In another preferred embodiment, the guide ssDNA is a 5' -phosphorylated single-stranded DNA molecule.

In another preferred embodiment, the guide ssRNA is a 5' -phosphorylated single stranded RNA molecule.

In another preferred embodiment, the length of the guide ssDNA or the guide ssRNA is n bases, and n is not less than 14.

In another preferred embodiment, n is equal to or less than 100, preferably equal to or less than 80, and more preferably equal to or less than 60.

In another preferred embodiment, the length of the guide ssDNA or guide ssRNA is 14-60nt, preferably 16-40nt.

In another preferred embodiment, the number of primary guide ssDNAs or guide ssRNAs is one or more pairs.

In another preferred embodiment, the number of secondary guide ssDNAs or guide ssRNAs is one or more.

In another preferred embodiment, the primary guide ssDNAs are complementarily paired to the target DNA.

In another preferred embodiment, said primary guide ssRNAs are complementarily paired to the target RNA.

In another preferred embodiment, the Ago enzyme comprises wild-type and mutant Ago.

In another preferred embodiment, the mutation sites corresponding to the different types of the target DNA are at positions 10 and 11 of the primary guide ssDNA.

In another preferred embodiment, the mutation sites corresponding to the different types of the target RNA are at positions 10 and 11 of the primary guide ssRNA.

In another preferred embodiment, the detection system further comprises (e) a magnesium ion solution.

In another preferred example, the magnesium ions are derived from magnesium chloride or magnesium sulfate.

In another preferred embodiment, the concentration of magnesium ions in the detection system is 0-5mM, preferably 0.3-4 mM mM, more preferably 0.33-3.33mM, still more preferably 0.33-1mM (e.g.0.67 mM).

In another preferred embodiment, the detection system further comprises a target nucleic acid molecule to be detected.

In another preferred embodiment, the amplification (digestion) product of the target nucleic acid molecule, upon cleavage by the Ago enzyme, produces a secondary guide ssDNA or a secondary guide ssRNA.

In another preferred embodiment, the length of the secondary guide ssDNA or secondary guide ssRNA is 10-25nt, preferably 12-20nt, more preferably 15-19nt.

In another preferred embodiment, the secondary guide ssDNA or secondary guide ssRNA is complementary to the sequence of the fluorescent reporter nucleic acid.

In another preferred embodiment, the secondary guide ssDNA or secondary guide ssRNA, upon complementary binding to the sequence of the fluorescent reporter nucleic acid, directs the Ago enzyme to cleave the fluorescent reporter nucleic acid, thereby generating a detectable signal (e.g., fluorescence).

In another preferred embodiment, the concentration of the target nucleic acid molecule to be detected (i.e.the nucleic acid as template) in the detection system is 10 ¹ -10 ⁸ Copy/microliter, preferably 10 ² -10 ⁶ Copy/microliter, more preferably 10 ³ -10 ⁶ Copy/microliter.

In another preferred embodiment, the concentration of the target nucleic acid molecule to be detected (i.e.the nucleic acid as template) in the detection system is 0.2fM-0.2nM, preferably 2fM-2pM, more preferably 20fM-2pM.

In another preferred embodiment, the Ago enzyme has an operating temperature of 25-70 ℃, preferably 30-60 ℃, more preferably 37-42 ℃.

In another preferred embodiment, the Ago enzyme has a duration of action of 30 minutes or more, preferably 60 minutes or more, more preferably 120 minutes or more.

In another preferred embodiment, in the detection system, the concentration of the fluorescent reporter nucleic acid is 200-1000 nM.

In another preferred embodiment, the molar ratio of the fluorescent reporter nucleic acid to the target DNA/RNA in the detection system is 10 ² :1 to 10 ⁵ :1, preferably 10 ² :1 to 10 ³ ：1。

In another preferred embodiment, the molar ratio of the target DNA/RNA to the Ago enzyme to the guide ssDNAs/guide ssRNAs is 1:50:2-1:100:2.

In another preferred embodiment, the fluorescent moiety and the quenching moiety are each independently located at the 5 'end and the 3' end of the fluorescent reporter nucleic acid.

In another preferred embodiment, the length of the fluorescent reporter nucleic acid is 20-60nt, preferably 26-30nt.

In another preferred embodiment, the reagents for isothermal amplification reactions comprise reagents required for performing RT-RAA or reagents required for performing NASBA.

In another preferred embodiment, the reagents required for performing RT-RAA include reagents for performing reverse transcription amplification using the RT-RAA principle.

In another preferred embodiment, the reagents required to perform an RT-RAA further comprise a primer pair required for an RT-RAA reaction.

In another preferred example, the primer pair includes a normal primer RT-RAA FW (P) and a sulfur modified primer RT-RAA RV (S).

In another preferred example, the reagent required for carrying out the RT-RAA is from RT-RAA kit developed by Jiangsu Qitide gene biosciences, zhejiang Shanghe Dai Jishi biosciences, weifang Anpu future biosciences, hangzhou Zhongjis biosciences; more preferably from RT-RAA kit developed by Jiangsu Qitian Gene biotechnology Co.

In another preferred embodiment, the reagents required to perform RT-RAA further include enzymes and buffers to digest the RT-RAA reaction products.

In another preferred embodiment, the enzyme that digests the RT-RAA reaction product is used to specifically hydrolyze non-sulfur modified single strands in dsDNA.

In another preferred embodiment, the enzyme that digests the RT-RAA reaction product comprises an exonuclease.

In another preferred embodiment, the exonuclease comprises a T7 exonuclease.

In another preferred embodiment, the exonuclease is used to digest non-sulfur modified DNA strands in the dsDNA of the RT-RAA reaction product.

In another preferred embodiment, the buffer for digestion of the RT-RAA reaction product is NEBuffer 4.

In another preferred embodiment, the reagents required to perform RT-RAA further comprise a reagent that deactivates an enzyme that digests the RT-RAA reaction product.

In another preferred embodiment, the reagents required to perform NASBA include reverse transcriptase, RNase Inhibitor.

In another preferred embodiment, the reagents required to perform NASBA further comprise: dNTP, NTP and reaction Buffer CutSmart Buffer.

In another preferred embodiment, the reverse transcriptase is AMV or MMLV having RNA-directed DNA polymerase activity and DNA-directed DNA polymerase activity; preferably AMV or MMLV with RNase H activity; more preferably BBI AMV Reverse Transcriptase.

In another preferred embodiment, the transcriptase is T7 RNA Polymerase.

In another preferred embodiment, the reagents required to perform NASBA also contain the primer pairs required for the NASBA reaction.

In another preferred embodiment, the primer pair comprises NASBA FW and NASBA RV.

In a second aspect, the invention provides a kit for detecting a target nucleic acid molecule, the kit comprising:

(i) The detection system according to the first aspect of the invention or a reagent for formulating the detection system; and

(ii) Instructions for use, the instructions describe a method for detecting a target nucleic acid molecule using the detection system.

In another preferred embodiment, the kit further comprises a magnesium ion solution.

In another preferred embodiment, the kit comprises:

(a) A first container and a pair of guide ssDNA or guide ssRNA located in the first container;

(b) A second container and a medium-temperature Argonaute protein (Ago enzyme) in the second container, wherein the medium-temperature Argonaute protein (Ago enzyme) guides cutting of target DNA or target RNA by taking DNA or RNA as a guide; and

(c) A third container and a fluorescent reporter nucleic acid located in the third container;

(d) Fourth container and reagent for isothermal amplification reaction in the fourth container.

In another preferred embodiment, the kit further comprises: (e) And a fifth container and a magnesium ion solution in the fifth container.

In a third aspect, the invention provides a method of detecting the presence or absence of a target nucleic acid molecule in a sample, comprising the steps of:

(a) Providing a detection system for detecting a target nucleic acid molecule according to the first aspect of the invention; and

(b) Reacting the detection system with a sample to be detected at a certain temperature, so as to form a first reaction solution;

(c) Performing fluorescence detection on the first reaction solution, thereby obtaining a fluorescence signal value;

wherein detection of a fluorescent signal value in the first reaction solution indicates the presence of a target nucleic acid molecule in the sample; and no fluorescence signal value is detected in the first reaction solution, which indicates that the target nucleic acid molecule is not present in the sample.

In another preferred embodiment, the sample to be detected is a sample obtained without amplification.

In another preferred embodiment, the sample to be detected comprises nucleic acid from a sample, wherein the sample is selected from the group consisting of: blood, cells, serum, saliva, body fluids, plasma, urine, prostatic fluid, bronchial lavage fluid, cerebrospinal fluid, gastric fluid, bile, lymph fluid, peritoneal fluid, stool, and the like, or combinations thereof.

In another preferred embodiment, the sample to be detected comprises a directly heat-cleaved nucleic acid sample, a directly-cleaving enzyme protease-treated nucleic acid sample, an extracted nucleic acid sample, or any nucleic acid-containing sample.

In another preferred embodiment, the method is used to detect whether a nucleic acid at a target site is at a SNP, a point mutation, a deletion, and/or an insertion.

In another preferred embodiment, the step (b) includes:

(b1) Carrying out isothermal amplification on a sample to be detected by using a reagent for isothermal amplification reaction in the detection system, thereby generating target DNA or target RNA;

(b2) And reacting the guide ssDNA pair or the guide ssRNA pair, the medium-temperature Argonaute protein (Ago enzyme) and the fluorescent reporter nucleic acid in the detection system with the target DNA or the target RNA at a certain temperature to form a first reaction solution.

In another preferred embodiment, the isothermal amplification comprises (reverse transcription) amplification digestion or (reverse transcription) transcription reaction.

In another preferred embodiment, the step (b) further comprises the step of inactivating enzymes in the reagents of the isothermal amplification reaction that digest the RT-RAA reaction product.

In another preferred embodiment, the enzyme that digests the RT-RAA reaction product comprises an exonuclease.

In another preferred embodiment, the exonuclease comprises a T7 exonuclease.

In another preferred embodiment, the inactivation comprises heat inactivation or use of an agent that inactivates an enzyme that digests the RT-RAA reaction product.

In another preferred embodiment, the heat inactivation reaction temperature is 70-90 ℃, preferably 70-80 ℃.

In another preferred embodiment, the heat inactivation reaction time is 15 to 40 minutes, preferably 18 to 30 minutes, more preferably 20 to 25 minutes.

In another preferred embodiment, the fluorescence detection in step (c) is performed using a qPCR instrument, a microplate reader, or a fluorescence spectrophotometer.

In another preferred embodiment, the method is an in vitro method.

In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

FIG. 1 shows a schematic diagram of cascade cleavage of the medium temperature Argonaute protein (Ago enzyme) against a target DNA, wherein a pair of primary guide ssDNAs is designed for the same target DNA strand, the corresponding cleavage sites of which are marked by black arrows, and the specific cleavage of the medium temperature Argonaute protein (Ago enzyme) is guided by the primary guide ssDNAs, yielding a secondary guide ssDNA and two further single-stranded DNAs. The secondary guide directs specific cleavage of the moderate temperature Argonaute protein (Ago enzyme) to the ssDNA, resulting in cleavage of the fluorescent reporter nucleic acid, thereby generating a fluorescent signal.

FIG. 2 shows a schematic diagram of cascade cleavage of the moderate temperature Argonaute protein (Ago enzyme) against a target RNA, wherein a pair of primary guide ssRNAs is designed against the same target RNA strand, the corresponding cleavage sites of which are indicated by black arrows, and the specific cleavage of the moderate temperature Argonaute protein (Ago enzyme) is guided by the primary guide ssRNAs, yielding a secondary guide ssRNA and two further single-stranded RNAs. The secondary guide ssRNA directs specific cleavage of the moderate temperature Argonaute protein (Ago enzyme) resulting in cleavage of the fluorescent reporter nucleic acid, thereby generating a fluorescent signal.

FIG. 3 shows the steps and principles of a detection method based on medium temperature Argonaute proteins and RT-RAA.

FIG. 4 shows the steps and principles of a detection method based on medium temperature Argonaute proteins and NASBA.

FIG. 5 shows the sensitivity of a medium temperature Argonaute protein and RT-RAA based detection system.

Detailed Description

The inventors have conducted extensive and intensive studies to develop a nucleic acid detection method which is easy to operate and has good compatibility with respect to a target nucleic acid for the first time. The method of the invention first uses isothermal amplification techniques to amplify a large amount of a target nucleic acid and optionally digests with digestive enzymes to obtain the target nucleic acid. The characteristic of the medium temperature Argonaute protein (Ago enzyme) is re-used, i.e. after the first cleavage mediated by the primary guide ssDNA (guide ssDNA), the cleaved 5' nucleic acid fragment can be re-used by the medium temperature Argonaute protein (Ago enzyme) to cleave the complementary fluorescent reporter nucleic acid strand at the appropriate reaction temperature (e.g. about 25-70 ℃). The result shows that the method can be widely applied to the fields of detection of infectious diseases such as major infectious diseases and pathogen infectious diseases (viruses and pathogenic bacteria).

Specifically, the method of the present invention first uses an isothermal amplification method such as RT-RAA or NASBA (reagents for performing isothermal amplification) to amplify a target nucleic acid; subsequent digestion of the non-sulfur modified strand in the dsDNA with an enzyme (such as T7 exonuclease) to produce target DNA/RNA; finally, with a moderate temperature Argonaute such as PbAgo/KpAgo at a suitable reaction temperature (e.g., about 37 ℃) after the first mediated cleavage of the target DNA/RNA by the primary guide ssDNAs or ssRNAs, the cleaved nucleic acid fragment may again be used by the PbAgo/KpAgo enzyme to cleave the fluorescent reporter nucleic acid strand complementary thereto. The present invention has been completed on the basis of this finding.

Terminology

As used herein, the terms "detection system of the invention", "nucleic acid isothermal amplification (digestion) -cascade shear detection system" are used interchangeably and refer to the detection system described in the first aspect of the invention.

As used herein, the terms "detection method of the invention", "reaction method of isothermal amplification (digestion) -cascade shear detection of nucleic acids" are used interchangeably and refer to the detection method described in the third aspect of the invention.

As used herein, the terms "medium temperature Argonaute protein (Ago enzyme)", "Ago enzyme" are used interchangeably to refer to the enzyme described in the first aspect of the invention.

As used herein, the term "cascade cleavage" refers to cleavage of target DNA/RNA sequences formed by amplification and digestion of a target nucleic acid by the inventive medium temperature Argonaute protein (Ago enzyme) in the presence of primary guide ssDNAs or ssRNAs in the detection method of the invention to form new 5' phosphorylated nucleic acid sequences (secondary guide ssDNAs/ssRNAs); the secondary guide ssDNA/ssRNA then continues to be acted upon by the Ago enzyme, which is directed to cleave the fluorescent reporter nucleic acid complementary to the secondary guide. This specific cleavage of the target nucleic acid formed by the target nucleic acid sequence (first cleavage) followed by specific cleavage of the fluorescent reporter nucleic acid (second cleavage) is defined as "cascade cleavage". In the present invention, both the first cleavage and the second cleavage are specific cleavage.

Ago enzyme

In the detection system and detection method of the present invention, one core component is a gene editing enzyme, such as Ago enzyme.

In a preferred embodiment of the invention, the preferred Ago enzyme in a medium temperature Argonaute protein and RT-RAA based assay system is a medium temperature Argonaute protein (Ago enzyme) that directs the cleavage of target DNA with DNA as a guide, more preferably selected from the group consisting of: paenibacillus borealis Argonaute (PbAgo), clostridium butyricum Argonaute (CbAgo), kurthia massiliensis Argonaute (KmAgo) and mutants thereof.

Ago can be classified according to the preference of growth temperature of the microorganism from which Ago protein is derived. Unlike pH or osmotic pressure, microorganisms cannot regulate their temperature, i.e. their internal temperature corresponds to the temperature of the surrounding environment. Any temperature change has a great influence on the enzymes and their activity. The optimum growth temperature of the mesophilic bacteria (mesophilic bacteria) is 30-45 ℃, and the intracellular Ago protein tolerance temperature is low, which is called as mesophilic Ago; the most suitable growth temperature of thermophilic bacteria (Thermophile) is 50-85 ℃, and the intracellular Ago protein can tolerate higher temperature, which is called high temperature Ago (thermophilic Agos, thermophilic Ago).

In a preferred embodiment of the invention, the preferred Ago enzymes in the medium temperature Argonaute protein and NASBA based detection system are medium temperature Argonaute protein (Ago enzyme) -Kluyveromyces polysporus Argonaute (KpAgo) and mutants thereof directed to cleave target RNA with RNA as guide. Wherein, the gene length of Paenibacillus borealis Argonaute (PbAgo) is 2118bp, the amino acid sequence is composed of 705 amino acids, and the molecular weight is about 80.79kDa. Clostridium butyricum Argonaute (CbAgo) has a gene length of 2247bp, an amino acid sequence of 748 amino acids, a molecular weight of about 85.99kDa, a gene length of Kurthia massiliensis Argonaute (KmAgo) of 2212bp, an amino acid sequence of 737 amino acids, a gene length of 3753bp, a molecular weight of about 85.38kDa,Kluyveromyces polysporus Argonaute (KpAgo), an amino acid sequence of 1250 amino acids, and a molecular weight of about 140.04kDa.

The cleavage properties of the medium temperature Argonaute protein (Ago enzyme), such as PbAgo enzyme, are: the enzyme can utilize 5' phosphorylated or hydroxylated oligonucleotides as guide ssDNA to guide the precise shearing of the enzyme to a target DNA sequence under normal temperature; the cleavage site is located in the phosphodiester bond between the target DNA (ssDNA) corresponding to nucleotides 10 and 11 of the guide ssDNA. Typically, the preferred operating temperature of the PbAgo enzyme is 37+ -2deg.C.

Guide ssDNA pairs or ssRNA pairs

In the detection system and method of the present invention, one core component is guide ssDNA pairs or ssRNAs.

In the present invention, preferred guide ssDNAs or ssRNAs are oligonucleotides of length 14-24nt (e.g., 19 nt).

As shown in FIG. 1 or 2, a pair of primary guide ssDNAs or ssRNAs are designed for the same target DNA/RNA strand, the corresponding cleavage sites of which are indicated by black arrows, and the specific cleavage of the gene editing enzyme is guided by the primary guide ssDNAs, resulting in a secondary guide ssDNA/ssRNA and two additional single-stranded DNA/RNA strands.

Reporter nucleic acid molecules

In the detection system and detection method of the present invention, one core component is a reporter nucleic acid carrying a reporter molecule.

Preferred reporter molecules are fluorescent molecules or fluorophores. One preferred reporter nucleic acid molecule is a nucleic acid molecule carrying a fluorescent group and a quencher group, respectively. For example, a fluorescent group (F) is labeled at the 5 'end, and a quenching group (Q) is labeled at the 3' end. FIG. 2 shows a fluorescent reporter nucleic acid 30nt in length, with a fluorescent group (F) labeled at the 5 'end and a quenching group (Q) labeled at the 3' end.

In the present invention, the fluorescent reporter nucleic acid is determined based on the position of secondary guide ssDNA/ssRNA production; the target DNA/RNA sequence is sheared by the primary guide ssDNAs or ssRNAs to form new 5' phosphorylated nucleic acid sequences, referred to as secondary guide ssDNA/ssRNA, and fluorescent reporter nucleic acids cover the corresponding positions of the secondary guide ssDNAs/ssRNAs.

Detection system

The present invention provides a detection system for detecting a target nucleic acid molecule comprising:

(a) A guide ssDNA pair or a guide ssRNA pair;

(b) A medium-temperature Argonaute protein (Ago enzyme) which guides the cutting of target DNA or target RNA by taking DNA or RNA as a guide;

(c) A fluorescent reporter nucleic acid bearing a fluorescent group and a quenching group;

(d) Reagents for isothermal amplification reactions;

wherein the target nucleic acid molecule is a target nucleic acid.

In another preferred embodiment, the detection system further comprises (e) a magnesium ion solution.

In another preferred example, the magnesium ions are derived from magnesium chloride, magnesium sulfate, or the like.

In another preferred embodiment, the concentration of magnesium ions (final concentration) in the detection system is 0-5mM, preferably 0.3-4mM, more preferably 0.33-3.33mM, even more preferably 0.33-1mM (e.g.0.67 mM).

In a preferred embodiment, the present invention provides two detection systems for detecting a target nucleic acid.

The first medium temperature Argonaute protein and RT-RAA based system comprises:

(a) Guide ssDNA pairs;

(b) A medium-temperature Argonaute protein (Ago enzyme), wherein the medium-temperature Argonaute protein (Ago enzyme) is used for guiding the cutting of target DNA by taking DNA as a guide;

(c) A fluorescent reporter nucleic acid bearing a fluorescent group and a quenching group;

wherein the target nucleic acid is a viral nucleic acid.

In another preferred embodiment, the detection system further comprises (d) reagents required for performing (reverse transcription) PCR, i.e.for performing RT-RAA.

In another preferred embodiment, the detection system further comprises (e) a primer pair required for the RT-RAA reaction.

In another preferred embodiment, the assay system further comprises (f) an enzyme that digests the RT-RAA reaction product and a buffer.

In another preferred embodiment, the detection system further comprises (g) a magnesium ion solution.

In another preferred example, the magnesium ions are derived from magnesium chloride or magnesium sulfate.

In another preferred embodiment, the concentration of magnesium ions in the detection system is 0-5mM, preferably 0.33-3.33 mM, more preferably 0.67mM.

The second medium temperature Argonaute protein and NASBA based system comprises:

(a) Guide ssDNA pairs;

(b) A medium-temperature Argonaute protein (Ago enzyme) which guides the cutting of target DNA/RNA by taking the DNA/RNA as a guide;

(c) A fluorescent reporter nucleic acid bearing a fluorescent group and a quenching group;

wherein the target nucleic acid is a viral nucleic acid.

In another preferred embodiment, the detection system further comprises (d) reagents required for (reverse transcription) transcription, i.e.for NASBA.

In another preferred embodiment, the detection system further comprises (e) a primer pair required for the NASBA reaction.

In another preferred embodiment, the detection system further comprises (f) an enzyme that digests the NASBA reaction product and a buffer.

In another preferred embodiment, the detection system further comprises (g) a magnesium ion solution.

In another preferred example, the magnesium ions are derived from magnesium chloride or magnesium sulfate.

In another preferred embodiment, the concentration of magnesium ions in the detection system is 0-5mM, preferably 0.33-3.33 mM, more preferably 0.67mM.

Detection method

The invention also provides two nucleic acid detection methods based on the multienzyme system. The first is based on all reverse transcriptase and DNA recombinase in RT-RAA kit, digestive enzyme T7 exonuclease, gene editing enzymes such as Paenibacillus borealis Argonaute (PbAgo) etc.; the second is based on reverse transcriptase AMV, transcriptase T7 RNA Polymerase, gene editing enzymes such as Kluyveromyces polysporus Argonaute (KpAgo), etc.

To facilitate understanding, the inventors provide the principle of the detection method of the present invention. It should be understood that the scope of the invention is not limited by the principles described.

The principle of the detection method based on medium temperature Argonaute protein and RT-RAA is shown in FIG. 3. In the method of the invention, the target nucleic acid is firstly subjected to isothermal amplification based on an RT-RAA kit; then, digesting the DNA single strand which is not modified by sulfur in the RT-RAA reaction product by using T7 exonuclease to generate target DNA; finally, based on the shearing activity of moderate-temperature Argonaute such as PbAgo, a series of guide ssDNA pairs can be designed according to the difference of target DNA sequences, the guide ssDNAs target nucleic acid to be detected and mediate PbAgo to shear a target fragment so as to form new secondary guide ssDNA, and the secondary guide ssDNA continuously shears fluorescent reporter nucleic acid complementary to the secondary guide ssDNAs under the action of PbAgo, so that the detection of target nucleic acid is achieved (figure 1).

In the invention, a plurality of target nucleic acids to be detected and guide ssDNAs can be added into a shearing system of PbAgo enzyme simultaneously, and multiple detection of target nucleic acids can be achieved by combining the reporter nucleic acids with different fluorophores.

The detection method comprises the following steps:

Step 1: designing amplification primers RT-RAA FW (P) and RT-RAA RV (S), specific oligonucleotide guide ssDNAs and fluorescent reporter nucleic acid aiming at different target nucleic acid sequences to be detected;

step 2: collecting a sample to be detected, and extracting a nucleic acid compound containing a target sequence;

step 3: adding the obtained sample to be detected as a template into an amplification primer pair to perform RT-RAA reaction;

step 4: adding T7 exonuclease and a reaction buffer NEBuffer 4 thereof into the RT-RAA reaction system in the step 3, and digesting a DNA single chain which is not subjected to sulfur modification in the RT-RAA reaction product to generate target DNA;

step 5: adding specific oligonucleotide guide ssDNAs, corresponding fluorescent reporter nucleic acid and PbAgo enzyme into the digestion system in the step 4, performing specific shearing under the condition of continuous heat preservation at 37 ℃, and collecting fluorescent signals;

step 6: and analyzing the fluorescence signal value, adjusting the Start value, end value and threshold line of Baseline, and judging the result.

In the present invention, the primer design principle used for the RT-RAA reaction is basically the same as that of the ordinary PCR primer design principle: RT-RAA FW (P) and RT-RAA RV (S) are about 22 bases long and are complementary to the 5 'and 3' ends of the template, respectively, wherein sulfur modification is carried out between 4 bases of the 3 'and 5' ends of the RT-RAA RV (S). Preferably, the amplification primer is designed so as to avoid the segment to be detected.

The principle of the detection method based on the medium temperature Argonaute protein and NASBA is shown in FIG. 4. In the method of the invention, the target nucleic acid is firstly reverse transcribed based on reverse transcriptase AMV, and then is transcribed by T7 RNA Polymerase to generate target RNA; finally, based on the cleavage activity of moderate-temperature Argonaute such as KpAgo, a series of guide ssRNA pairs can be designed according to the difference of target RNA sequences, the guide ssRNAs target nucleic acid to be detected and mediate the KpAgo to cleave a target fragment to form new secondary guide ssRNA, and the secondary guide ssRNA continuously cleaves fluorescent reporter nucleic acid complementary to the secondary guide ssRNAs under the action of the KpAgo, so that the detection of target nucleic acid is achieved (figure 2).

In the invention, a plurality of target nucleic acids to be detected and guide ssRNAs can be added into a cutting system of KpAgo enzyme at the same time, and the target nucleic acids can be detected in multiple ways by combining the reporter nucleic acids with different fluorophores.

The detection method comprises the following steps:

step 1: designing amplification primers NASBA FW and NASBA RV, specific oligonucleotide guide ssRNAs and fluorescent reporter nucleic acid aiming at different target nucleotide sequences to be detected;

step 2: collecting a sample to be detected, and extracting a nucleic acid compound containing a target sequence;

Step 3: adding the obtained sample to be detected as a template into an amplification primer pair to perform NASBA reaction to generate target RNA;

step 4: adding specific oligonucleotides to the NASBA system in the step 3 to guide ssRNAs, fluorescence reporter nucleic acid corresponding to the ssRNAs and KpAgo enzyme, performing specific shearing under the condition of continuous heat preservation at 37 ℃, and collecting fluorescence signals;

step 5: and analyzing the fluorescence signal value, adjusting the Start value, end value and threshold line of Baseline, and judging the result.

In the present invention, the primer design principle used for NASBA reaction is different from the ordinary PCR primer design principle: NASBA FW is about 20 bases long and its sequence is identical to the 5' end of the template; NASBA RV is about 45 bases long and has about 20 bases at its 3' end complementary to the 3' end of the template and a promoter sequence at its 5' end that is recognized by the T7 RNA Polymerase. Preferably, the amplification primer is designed so as to avoid the segment to be detected.

Kit for detecting a substance in a sample

The invention also provides a kit for use in the detection method of the invention.

Typically, the kit comprises:

(a) A first container and a pair of guide ssDNA or guide ssRNA located in the first container;

(b) A second container and a medium-temperature Argonaute protein (Ago enzyme) in the second container, wherein the medium-temperature Argonaute protein (Ago enzyme) guides cutting of target DNA or target RNA by taking DNA or RNA as a guide; and

(c) A third container and a fluorescent reporter nucleic acid located in the third container;

(d) Fourth container and reagent for isothermal amplification reaction in the fourth container.

In another preferred embodiment, the kit further comprises:

(e) And a fifth container and a magnesium ion solution in the fifth container.

In a preferred embodiment, the invention also provides a kit for use in two detection methods of the invention.

Typically, the medium temperature Argonaute protein and RT-RAA based kit comprises:

(a) A first container and a guide ssDNA located in the first container;

(b) A second container and a medium-temperature Argonaute protein (Ago enzyme) in the second container, wherein the medium-temperature Argonaute protein (Ago enzyme) is Argonaute protein (Ago enzyme) which guides DNA as a guide to cut target DNA; and

(c) And a third container and a fluorescent reporter nucleic acid located in the third container.

In another preferred embodiment, the kit further comprises:

(d) Fourth container and reagent for RT-RAA in the fourth container.

In another preferred embodiment, the kit further comprises:

(e) A fifth vessel and an enzyme located in the fifth vessel that digests the RT-RAA reaction product.

In another preferred embodiment, the kit further comprises:

(f) And a sixth container and a magnesium ion solution in the sixth container.

The medium-temperature Argonaute protein and NASBA-based kit comprises:

(a) A first container and a guide ssRNA located in the first container;

(b) A second container and a medium-temperature Argonaute protein (Ago enzyme) in the second container, wherein the medium-temperature Argonaute protein (Ago enzyme) is used for guiding the cutting of target RNA by taking RNA as a guide; and

(c) And a third container and a fluorescent reporter nucleic acid located in the third container.

In another preferred embodiment, the kit further comprises:

(d) Fourth container and reagents required for performing NASBA in the fourth container.

In another preferred embodiment, the kit further comprises:

(e) And a fifth container and a magnesium ion solution in the fifth container.

The main advantages of the invention include:

1) The test sample of the method of the invention is viral nucleic acid or bacterial 16s rRNA;

2) The method only needs a small amount of detection samples, and has higher detection sensitivity and accuracy;

3) The nucleic acid detection method based on the medium-temperature Argonaute protein such as Paenibacillus borealis Argonaute (Pbago) fully exerts the characteristic shearing property of the gene editing enzyme, so that the method becomes a detection means with high specificity;

4) The method is a normal-temperature isothermal detection method, has simple required conditions and instruments, and can optimize and develop portable household detection;

5) The method can expand application to the detection field of infectious diseases, such as major infectious diseases and pathogen infectious diseases, and can realize active management of prediction, prevention and the like;

6) The reaction system can be simultaneously added with a plurality of target nucleic acids to be detected, corresponding primary guide ssDNAs/ssRNAs and fluorescent reporter nucleic acids, so that single-tube multiple detection is realized;

7) The method of the invention can be used for genotyping detection of viruses or bacteria.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated.

The reagents and materials used in the examples of the present invention were all commercially available products unless otherwise specified.

Sequence information

The examples relate to primers for isothermal amplification of target genes, and the oligonucleotide sequences of guide ssDNAs to ssRNAs or to fluorescent reporter nucleic acids, as described in the following table.

Example 1

Preparation and detection method of nucleic acid detection reagent based on PbAgo and RT-RAA

In this example, reagents for use in the gene editing enzyme Paenibacillus borealis Argonaute (PbAgo) and RT-RAA based nucleic acid detection methods of the invention and methods of use thereof are provided.

1.1 detection reagent

In this example, taking the detection of the SRAS-COV2 1b gene as an example, the corresponding specific target nucleic acid sequence is 5'-GGGGAUAAAAGUGCAUUAACAUUGGCCGUGACAGCUUGACAAAUGU UAAAAACACUAUUAGCAUAAGCAGUUGUGGCAUCUCCUGAUGAGGUUC CACCUGGUUUAACAUAUAGUGAACCGCCACACAUGACCAUUUCACUCA AUACUUGAGCACACUCAUUAGCUAAUCUAUAGAAACGGUGUGACAAGC UACAACACGUUGU-3', SEQ ID No.:1.

based on the method of the invention, the corresponding detection reagents include the following:

(1) The specific sequence of the RT-RAA primer is as follows:

RT-RAA FW(P)：

5’-GGGGATAAAAGTGCATTAACATTGGCCGTG-3’(SEQ ID No.2)

RT-RAA RV(S)：

5’-A*C*A*ACGTGTTGTAGCTTGTCACACCGT*T*T*C-3’(SEQ ID No.3)

(2) Specific guide ssDNAs pairs, including primary guide ssDNA a strands and primary guide ssDNA B strands, are specifically sequences as follows:

primary guide ssDNA A strand 5'P-CTTGACAAATGTTAAA-3' (SEQ ID No. 6)

Primary guide ssDNA B strand 5'P-AACACTATTAGCATAA-3' (SEQ ID No. 7)

(3) The specific sequence of the fluorescent reporter nucleic acid corresponding to the secondary guide ssDNA is as follows:

fluorescent reporter nucleic acid: 5'FAM (fluorescent group) -TGACAAATGTTAAAAACACTATTAGCATAA-BHQ1 (quenching group) 3' (SEQ ID No. 10)

(4) RT-RAA kit (obtained from the sunday gene): for example buffer V, nucleic-free Water, magnesium acetate;

(5) T7 nuclease inhibitor (obtained from NEB), 10 XNEBuffer 4;

(6)、MgCl ₂ solution (powder obtained from Diamond): 20mM MgCl ₂ A solution;

(7) 25. Mu.M PbAgo (available from Shanghai university of transportation).

1.2 detection method

A schematic diagram of the nucleic acid detection method based on gene editing enzyme Paenibacillus borealis Argonaute (Pbago) and RT-RAA is shown in FIG. 3, and the specific operation steps are as follows:

(1) Dissolving the RT-RAA primer dry powder by using a nucleic-free Water to prepare a 10 mu M storage solution; the primary guide ssDNA A chain and B chain dry powder is dissolved by using a nucleic-free Water to prepare 10 mu M storage solution; the fluorescent reporter nucleic acid dry powder is dissolved by using a nucleic-free Water to prepare a 10 mu M storage solution;

(2) Mixing a nucleic acid sample, an RT-RAA primer and a reagent in an RT-RAA kit to prepare 10 mul RT-RAA system (the single reaction of the RT-RAA kit is 50 mul, the single reaction of the RT-RAA kit is divided into 5 equal parts according to a proportion, the final concentration of the RT-RAA primer is 400 nM), and carrying out isothermal amplification at 37 ℃ for 40 minutes;

(3) Adding T7 exonuclease, 10 XNEBuffer 4, and preparing into 13.3 μl digestion reaction system (NEBuffer 4 diluted to 1X, T7 exonuclease 20U), digesting at 25deg.C for 30min, and heat inactivating at 75deg.C for 20min;

(4) After digestion, adding PbAgo enzyme and MgCl into the step (3) ₂ The primary guide ssDNA A strand and B strand, and DNA fluorescent reporter nucleic acid were used as 30uL detection reaction system (MgCl) ₂ Final concentration of 0.67. 0.67 mM, final concentration of 0.27mM fluorescent reporter nucleic acid, final concentration of target nucleic acid molecule of 0, 8×10, respectively ² copies/μl、8×10 ³ copies/μl、8×10 ⁴ copies/μl、8×10 ⁵ The final concentration molar ratio of target nucleic acid molecule to PbAgo to guide ssDNAs was 1:88:1, a step of;

(5) And (3) placing the reaction system in the step (4) on a fluorescence quantitative PCR instrument for detection (the temperature is kept at 37 ℃ for 120 minutes, and a fluorescence signal is detected every minute).

1.3 detection of nucleic acids to be detected at different concentrations

For specific target nucleic acid(SEQ ID NO: 1) diluted to 0, 8X 10, respectively ² copies/μl、8×10 ³ copies/μl、8×10 ⁴ copies/μl、8×10 ⁵ The standard mother liquor of cobies/. Mu.l. The nucleic acid standard mother solutions with different concentrations are respectively added into the reaction system described in the example 1, sample addition reaction is carried out according to the steps, and fluorescent signal values at the wavelengths of the corresponding fluorophores are detected through fluorescent quantitative PCR. The results are shown in FIG. 5.

The result shows that the detection method can detect target nucleic acid with the copy number as low as 80 per reaction, and has high sensitivity and low detection limit.

Example 2

Preparation and detection method of nucleic acid detection reagent based on KBArgo and NASBA

In this example, reagents for use in the nucleic acid detection methods of the invention based on gene editing enzyme Kluyveromyces polysporus Argonaute (KpAgo) and NASBA and methods of use thereof are provided.

2.1 detection reagent

In this example, taking the detection of the SRAS-COV2 1b gene as an example, the corresponding specific target nucleic acid sequence is 5'-GGGGAUAAAAGUGCAUUAACAUUGGCCGUGACAGCUUGACAAAUGU UAAAAACACUAUUAGCAUAAGCAGUUGUGGCAUCUCCUGAUGAGGUUC CACCUGGUUUAACAUAUAGUGAACCGCCACACAUGACCAUUUCACUCA AUACUUGAGCACACUCAUUAGCUAAUCUAUAGAAACGGUGUGACAAGC UACAACACGUUGU-3', SEQ ID No.:1.

based on the method of the invention, the corresponding detection reagents include the following:

(1) NASBA primer with the specific sequence as follows:

NASBA FW：5’-GGGGATAAAAGTGCATTAAC-3’(SEQ ID No.4)

NASBA RV：

5’-TAATACGACTCACTATAGGGGATCCACAACGTGTTGT-3’(SEQ ID No.5)

(2) Specific guide ssRNAs pairs, including primary guide ssRNA C strand and primary guide ssRNA D strand, are as follows:

primary guide ssRNA C strand 5'P-CUGCUUAUGCUAAUAG-3' (SEQ ID No. 8)

Primary guide ssRNA D strand 5'P-UGUUUUUAACAUUUGU-3' (SEQ ID No. 9)

(3) The specific sequence of the fluorescent reporter nucleic acid corresponding to the secondary guide ssDNA is as follows:

fluorescent reporter nucleic acid: 5'FAM (fluorescent group) -UUAUGCUAAUAGUGUUUUUAACAUUUGUCA-BHQ1 (quenching group) 3' (SEQ ID No. 11)

(4) NASBA-reactive enzyme preparation and reaction solution (obtained from NEB): for example, 10 XCutSmart Buffer, BBI AMV RT, T7 RNA Polymerase;

(5) 10mM dNTP Mix (obtained from BBI), 10mM NTP Mix;

(6) RNase Inhibitor (40U/. Mu.l) (available from NEB);

(7)、MgCl ₂ solution (powder obtained from Diamond): 30mM MgCl ₂ A solution;

(8) 14. Mu.M KmAgo (from Shanghai university of transportation);

(9) Nuclease-free Water (from Industry).

2.2 detection method

A schematic diagram of the nucleic acid detection method based on gene editing enzyme Kluyveromyces polysporus Argonaute (KBArgo) and NASBA is shown in FIG. 4, and the specific operation steps are as follows:

(1) Dissolving the NASBA primer dry powder by using a nucleic-free Water to prepare a 10 mu M storage solution; the primary guide ssDNA A chain and B chain dry powder is dissolved by using a nucleic-free Water to prepare 10 mu M storage solution; the fluorescent reporter nucleic acid dry powder is dissolved by using a nucleic-free Water to prepare a 10 mu M storage solution;

(2) Mixing nucleic acid sample and NASBA primer with dNTP, 10×CutSmart Buffer, BBI AMV RT and RNase Inhibitor to prepare 10 μl system (NASBA primer final concentration of 1 μM and dNTP final concentration of 0.5mM,BBI AMV RT X U,RNase Inhibitor 4U), and performing reverse transcription at 42 ℃ for 1 hr;

(3) Adding NTP, 10×CutSmart Buffer and T7 RNA Polymerase into the above system, preparing into 20 μl reverse transcription reaction system (NTP final concentration is 0.5mM,T7 RNA Polymerase 20U), transcribing at 37deg.C for 2 hr, and heat inactivating at 65deg.C for 20min;

(4) After transcription is finished, adding into the step (3)KpAgo enzyme, mgCl ₂ The primary guide ssRNA C-strand and D-strand, and the RNA fluorescence reporter nucleic acid were used as a 30uL detection reaction system (MgCl) ₂ Final concentration of 0.67. 0.67 mM, final concentration of 0.27mM fluorescent reporter nucleic acid, final concentration of target nucleic acid molecule of 0, 8×10, respectively ² copies/μl、8×10 ³ copies/μl、8×10 ⁴ copies/μl、8×10 ⁵ The final concentration molar ratio of target nucleic acid molecule to PbAgo to guide ssDNAs was 1:100:1, a step of;

(5) And (3) placing the reaction system in the step (4) on a fluorescence quantitative PCR instrument for detection (the temperature is kept at 37 ℃ for 120 minutes, and a fluorescence signal is detected every minute).

2.3 detection of nucleic acids to be detected at different concentrations

Diluting the specific target nucleic acid (SEQ ID NO: 1) to 0, 8X 10, respectively ² copies/μl、8×10 ³ copies/μl、8×10 ⁴ copies/μl、8×10 ⁵ The standard mother liquor of cobies/. Mu.l. The nucleic acid standard mother solutions with different concentrations are respectively added into the reaction system described in the example 1, sample addition reaction is carried out according to the steps, and fluorescent signal values at the wavelengths of the corresponding fluorophores are detected through fluorescent quantitative PCR.

The results show that the method of the invention can detect as low as 10 ³ copies/. Mu.l of the target nucleic acid molecule. In addition, the detection method can adapt to different gene editing enzymes, and only needs to slightly adjust the system.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Sequence listing

<110> Shanghai university of transportation

<120> method for detecting nucleic acid based on medium-temperature Argonaute protein and isothermal amplification

<130> P2022-0094

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 203

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 1

ggggauaaaa gugcauuaac auuggccgug acagcuugac aaauguuaaa aacacuauua 60

gcauaagcag uuguggcauc uccugaugag guuccaccug guuuaacaua uagugaaccg 120

ccacacauga ccauuucacu caauacuuga gcacacucau uagcuaaucu auagaaacgg 180

ugugacaagc uacaacacgu ugu 203

<210> 2

<211> 30

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

ggggataaaa gtgcattaac attggccgtg 30

<210> 3

<211> 30

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

acaacgtgtt gtagcttgtc acaccgtttc 30

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

ggggataaaa gtgcattaac 20

<210> 5

<211> 37

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

taatacgact cactataggg gatccacaac gtgttgt 37

<210> 6

<211> 16

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

cttgacaaat gttaaa 16

<210> 7

<211> 16

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

aacactatta gcataa 16

<210> 8

<211> 16

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 8

cugcuuaugc uaauag 16

<210> 9

<211> 16

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 9

uguuuuuaac auuugu 16

<210> 10

<211> 30

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

tgacaaatgt taaaaacact attagcataa 30

<210> 11

<211> 30

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 11

uuaugcuaau aguguuuuua acauuuguca 30

Claims (10)

1. A detection system for detecting a target nucleic acid molecule, the system comprising:

(a) A guide ssDNA pair or a guide ssRNA pair;

(b) A medium-temperature Argonaute protein (Ago enzyme) which guides the cutting of target DNA or target RNA by taking DNA or RNA as a guide;

(c) A fluorescent reporter nucleic acid bearing a fluorescent group and a quenching group;

(d) Reagents for isothermal amplification reactions;

wherein the target nucleic acid molecule is a target nucleic acid.

2. The detection system of claim 1, wherein the isothermal amplification reaction comprises a (reverse transcription) amplification digestion reaction or a (reverse transcription) transcription reaction.

3. The detection system of claim 1, wherein the isothermal amplification comprises RT-RAA, NASBA, RT-RPA.

4. The detection system of claim 1, wherein the target nucleic acid comprises single-stranded RNA, double-stranded RNA, single-stranded DNA, double-stranded DNA.

5. The detection system according to claim 1, wherein the target nucleic acid is subjected to isothermal amplification (digestion) and the obtained target DNA or RNA is cleaved by recognition by the medium temperature Argonaute protein (Ago enzyme).

6. The assay system of claim 1, wherein the medium temperature Argonaute protein (Ago enzyme) has the ability to direct cleavage of target DNA with DNA as a guide.

7. The assay system of claim 1, wherein the medium temperature Argonaute protein (Ago enzyme) has the ability to direct cleavage of target RNA with RNA as a guide.

8. The assay system of claim 1, wherein the medium temperature Argonaute protein (Ago enzyme) is selected from the group consisting of: paenibacillus borealis Argonaute (PbAgo), clostridium butyricum Argonaute (CbAgo), kurthia massiliensis Argonaute (KmAgo), kluyveromyces polysporus Argonaute (KpAgo), human Argonaute 2 (hArgo 2) and mutants thereof.

9. A kit for detecting a target nucleic acid molecule, the kit comprising:

(i) The test system of claim 1 or a reagent for formulating the test system; and

(ii) Instructions for use, the instructions describe a method for detecting a target nucleic acid molecule using the detection system.

10. A method of detecting the presence of a target nucleic acid molecule in a sample, comprising the steps of:

(a) Providing a detection system for detecting a target nucleic acid molecule of claim 1; and

(b) Reacting the detection system with a sample to be detected at a certain temperature, so as to form a first reaction solution;

(c) Performing fluorescence detection on the first reaction solution, thereby obtaining a fluorescence signal value;

wherein detection of a fluorescent signal value in the first reaction solution indicates the presence of a target nucleic acid molecule in the sample; and no fluorescence signal value is detected in the first reaction solution, which indicates that the target nucleic acid molecule is not present in the sample.

Images