CN108373497B

CN108373497B - Fluroxypyrazolopyricetone resistance screening marker for phytophthora sojae genetic transformation

Info

Publication number: CN108373497B
Application number: CN201810207745.3A
Authority: CN
Inventors: 苗建强; 刘西莉; 薛昭霖; 王为镇; 迟源冬; 林东; 刘鹏飞; 黄中乔
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2018-03-14
Filing date: 2018-03-14
Publication date: 2020-09-11
Anticipated expiration: 2038-03-14
Also published as: CN108373497A

Abstract

The invention discloses a fluorothiazole pyrithylone resistance gene and application thereof as an oomycete transformation screening marker. The protein of the sequence 2 in the sequence table of the resistance gene coding sequence of the fluorothiazole pyrithylone is a mutant protein which can cause the oomycete to generate more than 500 times of resistance to the fluorothiazole pyrithylone. The invention uses the coding gene of the mutant protein which can cause the oomycete to generate more than 500 times of resistance to the fluorothiazole pyrithylone as a screening marker, and is used for screening transformants when the phytophthora sojae is transformed. The development of the screening marker solves the problem of single screening marker in the transformation of the oomycetes, and provides powerful guarantee for the work in the aspects of gene complementation, gene multi-knockout and the like in the transformation of the oomycetes.

Description

Fluroxypyrazolopyricetone resistance screening marker for phytophthora sojae genetic transformation

Technical Field

The invention relates to the field of genetic engineering, in particular to a novel resistance screening marker for transforming fluorothiazole pyrithylon by phytophthora sojae.

Background

Oomycetes (oomyces) are a group of eukaryotic organisms similar to fungi, and researchers have found that at least 1800 species of Oomycetes, most of which, except for some saprophytic ones, are pathogenic bacteria of plants, animals and other organisms, represent a significant economic loss to humans. The plant pathogenic oomycetes mainly include Downy mildew, Phytophthora, Pythium and Albugo. In contrast to fungi, oomycetes have some unique physiological and biochemical characteristics, such as: the trophosome is diploid; the main constituent of the cell wall is cellulose; most oomycetes are sterol auxotrophs; lysine production via the diaminopimelic acid pathway; hyphae have no or few septa; is insensitive to DMI (methanol demethylation inhibitor) bactericide, and is sensitive to terephthalamide bactericide and carboxylic acid amide bactericide, etc.

Phytophthora (phytophthora) pathogenic bacteria are the most important species of the plant pathogenic oomycete. Ten plant pathogenic oomycetes published in 2014 include 6 phytophthora pathogens-p.infestans, p.ramorum, p.sojae, p.capsici, p.cinnamomi and p.paratitica (Kamoun et al, 2015). Sojae belongs to the same matched oomycete, has a narrow host range, and can cause serious economic loss to soybean production in the field (Dorrance et al, 2007). Indoor sojae is easy to separate and culture, asexual spores are easy to induce in vitro, sexual reproduction can be performed in vitro through homologous matching for genetic research, the genome of phytophthora sojae is disclosed by sequencing, and the p.sojae gradually becomes a model phytopathogen for oomycete scientific research based on the characteristics.

In 2016, a subject group taught by Brett M.Tyler establishes a gene editing CRISPR (clustered regulated inserted short palindromic repeat sequences) technical system in phytophthora sojae, and verifies the function of an effector Avr4/6 in the interaction process of phytophthora sojae and a host by using the CRISPR technology (Fang and template, 2016), thereby laying a technical foundation for the research of the gene function of oomycetes.

For the study of gene function, gene knockout and the acquisition of complementary transformants are particularly critical. However, the available selection markers in the oomycetes are very limited, and the only reliable selection marker is NPTII gene, which can make the oomycetes resistant to geneticin (G418) by starting encoded protein through the universal strong promoter ham34 of the oomycetes, so that transformants can be selected. However, when NPT II is used in a CRISPR/Cas9 gene knockout system, because the transformant carrying the marker has G418 resistance, the transformant cannot be reused for anaplerosis experiments; due to the limitations of selectable markers, the re-knockout of other genes for the resulting knockout transformant with G418 resistance is still difficult to achieve. Therefore, the development of a novel oomycete transformation screening marker has important significance for the research of the gene function of the oomycetes.

Disclosure of Invention

In order to solve the problems in the prior art, the invention aims to provide a novel oomycete transformation screening marker-fluorothiazole pyrithylone resistance related protein and a coding gene PsORP1 thereof^ΔN777And the application of the gene as a phytophthora sojae transformation screening marker in the screening and transformation of phytophthora sojae.

In order to realize the purpose of the invention, the technical scheme of the invention is as follows:

the invention provides a fluorothiazole pyrithylone resistance related protein and a coding gene thereof, wherein the fluorothiazole pyrithylone resistance gene codes a target protein PsORP1 in oomycetes (particularly phytophthora sojae)^ΔN777Namely, the protein related to the resistance of the fluorothiazole pyrithylone is the protein shown in the following 1) or 2):

1) a protein consisting of an amino acid residue sequence of SEQ ID No.2 in a sequence table;

2) the protein which is derived from the SEQ ID NO.2 and has the same activity with the protein shown by the SEQ ID NO.2 after the substitution and/or deletion and/or addition of one or more amino acid residues of the SEQ ID NO.2 amino acid residue sequence in the sequence table.

For ease of sequence 1 encoding PsORP1^ΔN777Purification, the amino terminal or the carboxyl terminal of the protein consisting of the amino acid sequence shown in the sequence 2 in the sequence table can be connected with labels such as Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc and the like.

The PsORP1^ΔN777For example, in different species of different oomycetes, the protein may have different amino acids, including mutation of substitution, deletion, addition and the like, but when the 777 th aspartic acid is deleted, the resistance function of the concentration of the oomycete fluorothiazole-resistant pyrithylone can be improved by more than 100-fold.

PsORP1 described above^ΔN777Can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression. PsORP1 described above^ΔN777The coding gene can be obtained by deleting one or more codons of amino acid residues in a DNA sequence shown in a sequence 1 in a sequence table, and/or carrying out missense mutation of one or more base pairs, and/or connecting a coding sequence of a label to the 5 'end and/or the 3' end of the coding gene.

The invention provides a fluorothiazole pyrithylone resistance gene, the cDNA nucleotide sequence of which is shown in 1), 2) or 3) as follows:

1) SEQ ID NO: 1;

2) DNA molecules which can be recombined with the DNA sequence in 1) under strict conditions and code the protein related to the resistance of the fluorothiazole pyrithylone, and cause the resistance function that the concentration of the oomycete fluorothiazole-resistant pyrithylone is improved by more than 100-fold;

3) and SEQ ID NO: 1 has more than 90 percent of homology and codes the resistance related protein of the fluorothiazole pyrithylone, and can cause the resistance function of increasing the concentration of the anti-fluorothiazole pyrithylone of the oomycetes by more than 100-fold.

Flurozolopyrone resistance gene (selection marker PsORP1)^ΔN777) Can be obtained by introducing C, A, A three-base deletion mutation at the 2331/2332/2333 position of CDS sequence of PsORP1 gene (wild-type sensitive gene) by a PCR amplification method.

The invention also belongs to the protection scope of the invention, and discloses an expression cassette, a recombinant expression vector or a transgenic recombinant bacterium containing the fluorothiazole pyrithylone resistance gene.

The recombinant expression vector is obtained by introducing an expression cassette for expressing the fluorothiazole pyrithylone resistance related protein into a eukaryotic expression vector serving as a starting vector; preferably, the expression cassette for expressing the oxathiapiprolin resistance-related protein consists of a promoter, a coding gene of the oxathiapiprolin resistance-related protein and a terminator which are sequentially connected.

Wherein, the promoter is the following DNA molecules of 1) or 2) or 3):

1) a DNA molecule as shown in SEQ ID NO. 3;

2) a DNA molecule which is reacted with the DNA sequence defined in 1) and has the function of a promoter under strict conditions;

3) a DNA molecule which has more than 90% of homology with the DNA sequence limited by 1) or 2) and has a promoter function;

the terminator can be the following DNA molecules of 1) or 2) or 3):

1) a DNA molecule as shown in SEQ ID NO. 4;

2) DNA molecule having terminator function under strict condition with the DNA sequence defined in 1);

3) a DNA molecule which has more than 90% of homology with the DNA sequence limited by 1) or 2) and has a promoter function.

The starting vector is selected from pBluescript II SK⁺Vector or pEASY-T1 vector.

Further, In the specific embodiment of the invention, by designing primers, taking wild type phytophthora sojae strain cDNA as a template, amplifying the full-length coding sequence of the phytophthora sojae PsORP1 gene, taking wild type phytophthora sojae strain DNA as a template, respectively amplifying the upstream 1000bp sequence and the downstream 500bp sequence of the phytophthora sojae PsORP1, and simultaneously connecting the full-length coding sequence of the PsORP1, the upstream 1000bp sequence of the PsORP1 and the downstream 500bp sequence of the PsORP1 to the cloning vector pBluescript II SK by an In-Fusion connection method⁺Designing primers to remove the 2331/2332/2333-bit three-base CAA of the coding sequence of the PsORP1 through PCR mutation to obtain the recombinant expression vector so as to clone the screening marker PsORP1 in a large quantity^ΔN777The specific construction method of the recombinant expression vector is as follows:

(1) digestion of pBluescript II SK with restriction endonucleases EcoRI and BamHI⁺A carrier, wherein a commercialized glue recovery kit is used for recovering linearized carrier fragments;

(2) using the cDNA of the wild type strain of phytophthora sojae as a template, designing primers F1 (sequence: GGACCGAGCCATGCAGGCGCTCCAGGACG) and R1 (sequence: CTCCTTGTTATTAGTGGCCGGCAGCTGC), and using Takara high fidelity enzyme CloneAmp^TMCarrying out HiFi PCR Premix amplification on a CDS sequence of the PsORP1 gene, and recovering an amplification product fragment by using a commercial gel recovery kit;

(3) using the DNA of the wild type strain of phytophthora sojae as a template to design primers F2 (sequence: GATAAGCTTGATATCGAATTCGATCCCAGTTATTGCAACGTCA) and R2 (sequence: GCGCCTGCATGGCTCGGTCCCGCTTGCG) and using Takara high fidelity enzyme CloneAmp^TMHiFi PCR Premix amplifies the upstream 1000bp sequence (promoter sequence) of PsORP1 gene, and uses commercial glue recovery kit to recover the amplified product fragment;

(4) using the DNA of the wild type strain of phytophthora sojae as a template to design primers F3 (sequence: CGGCCACTAATAACAAGGAGCGAATGAGTTAGACG) and R3 (sequence: CGCTCTAGAACTAGTGGATCCTATCGACTTGGTCTCCATAAAA) and using Takara high fidelity enzyme CloneAmp^TMHiFi PCR Premix amplifies a sequence (terminator sequence) of 500bp downstream of the PsORP1 gene, and a commercial gel recovery kit is used for recovering an amplification product fragment;

(5) connecting the glue recovery products In the steps (1), (2), (3) and (4) by utilizing Takara commercialized In-Fusion HD recombinase to realize the insertion of a PsORP1 gene, and obtaining an expression vector (pBS-PsORP1) with PsORP 1;

(6) using vector plasmid (pBS-PsORP1) containing PsORP1 and upstream 1000bp and downstream 500bp sequences as template, introducing mutation sites into primers, designing F4 (sequence: GCTCAACACAAAGGGTCCTGTGCGCGTGACGTTCCC) and R4 (sequence: CAGGACCCTTTGTGTTGAGCATGGCGTTGGACTTGACGC), and using Takara high fidelity enzyme CloneAmp^TMHiFi PCR Premix amplifies pBS-PsORP1 vector, and recovers amplified product fragments using a commercial gel recovery kit;

(7) connecting the recovered products of the glue obtained In the step (6) by utilizing Takara commercial In-Fusion HD recombinase to realize mutation of the PsORP1 gene and obtain an expression vector (pBS-PsORP1) with mutation PsORP1^ΔN777Fig. 1);

(8) pBS-PsORP1^ΔN777Transferring into Escherichia coli competence Trans1-T1, smearing on LB plate containing ampicillin, selecting single colony, amplifying by using universal primers M13F and M13R, after positive colony is verified by sequencing, shaking in LB liquid culture medium, and extracting plasmid in small amount by using commercial kit.

In the above construction method, the vector in step (1) may be selected from other vectors (e.g., pEASY-T1 vector from holotype gold), and the restriction enzyme used in the linearized vector may correspond to other cleavage sites on the vector.

In the above construction method, the primer F3 used in step (3) and the microhomology sequences at both ends of the primer used in step (4) and the linearized vector need to be changed according to the change of the vector or endonuclease in step (1).

In the above-described construction method, step (5) and step (7) may be performed by selecting a recombinase having the same function as that of another company.

In the above construction method, the selection of the LB plate antibiotic of step (8) is determined according to the antibiotic resistance gene (e.g., ampicillin resistance gene, kanamycin resistance gene, etc.) carried on the vector.

The invention provides an application of a fluorothiazole pyrithylone resistance gene as an oomycete transformation screening marker.

Wherein the fluorothiazole pyrithylone resistance gene codes a target protein PsORP1 in phytophthora sojae^ΔN777The amino acid deletion was made at asparagine 777 relative to the wild type protein ORP 1.

And the resistance gene (also called as a resistance marker gene) is used as a novel oomycete transformation selection marker PsORP1^ΔN777。

The fluorothiazole pyrithylone resistance gene can be specifically the following DNA molecules of 1) or 2) or 3):

1) a DNA molecule as shown in SEQ ID NO. 1;

2) DNA molecules which are recombined with the DNA sequence limited by 1) under strict conditions and encode proteins related to the resistance of the oxathiapiprolin and can cause oomycetes to generate more than 500 times of resistance to the oxathiapiprolin;

3) DNA molecules which have more than 90 percent of homology with the DNA sequences limited by 1) or 2) and encode proteins related to the resistance of the oxathiapiprolin and can cause oomycetes to generate more than 500 times of resistance to the oxathiapiprolin.

The transgenic recombinant bacteria take oomycetes as starting strains, are transferred into the recombinant expression vector, and are screened to obtain the transgenic recombinant bacteria expressing the related protein of the oxathiapiprolin resistance. The oomycete strain is preferably phytophthora (phytophthora) pathogenic bacteria, and is particularly preferably phytophthora sojae; most preferred is the strain P6497 of Phytophthora sojae (Phytophthoara sojae). The invention also claims an oomycete strain, which is a mutant strain obtained by deleting 777 th amino acid-asparagine of oxysterol binding protein 1 of an oomycete strain; the oomycete strain is preferably phytophthora (phytophthora) pathogenic bacteria, and is particularly preferably phytophthora sojae (phytophthora sojae); most preferred is the strain P6497 of Phytophthora sojae (Phytophthoara sojae).

Further, the application of the invention specifically comprises: and (3) connecting the fluorothiazole pyrithylone resistance gene into a transformation vector containing a promoter and a terminator of phytophthora sojae PsORP1, and screening genetic transformation of the phytophthora sojae.

Wherein, the PsORP1 self promoter is a 1000bp sequence of an upstream sequence thereof, and the terminator is a 500bp sequence of a downstream sequence thereof.

More specifically, the application is: the screening marker is used for screening transformants when the oomycete is genetically transformed, or screening in a gene back-up experiment of a gene knockout transformant obtained by screening other resistance markers of the oomycete by using the marker, or screening for transformation of the re-knockout of other target genes of the gene knockout transformant obtained by screening other resistance markers of the oomycete by using the marker.

Wherein, the other selection marker gene can be NPT II gene commonly used in the prior art, but does not exclude other selection marker genes developed along with research development.

The novel screening marker provided by the invention makes up the defect of single screening marker gene in the prior art. However, it is within the scope of the present invention to use it alone as a selection marker or in combination with other selection markers to perform more complicated genetic engineering experiments (multi-step knock-out or complementation experiments, etc.).

Furthermore, the invention takes the phytophthora sojae wild type strain P6497 as an experimental material to obtain protoplast, and PEG-CaCl is used for the protoplast₂Mediated method to transfer vector with Fluothiazolopyrone resistance gene (pBS-PsORP1) into protoplast^ΔN777) And screening to obtain positive transformant.

The screening method specifically comprises the following steps:

the protoplast is regenerated for 1 day under the dark condition of 18 ℃, the fluorothiazole pyriethanone is used for carrying out the first screening of transformants, the culturing is carried out for 3 days under the dark condition of 25 ℃, the second screening is carried out by the fluorothiazole pyriethanone, the culturing is continued for 2-3 days under the dark condition of 25 ℃, the bacterial colony is transferred to a V8 plate with the drug containing the fluorothiazole pyriethanone after the bacterial colony grows out, the third screening is carried out, and the screening concentration is 0.005 mu g/ml.

The screening marker PsORP1 provided by the invention^ΔN777The source of the drug resistance gene and the CDS sequence of the phytophthora sojae sensitive strain ORP1 gene do not contain any intron, and the gene comprises 2904 nucleotides and can code 967 amino acids. Nucleotide mutation is introduced into the CDS sequence of the ORP1 gene by a PCR amplification method, namely three bases CAA at 2331/2332/2333 position of the CDS sequence of a sensitive gene is knocked out, and correspondingly, the protein encoded by the gene is deleted by amino acid asparagine at 777 position from the N end.

The oomycete is Phytophthora sojae (Phytophthora sojae). The invention takes phytophthora sojae as an example to illustrate the application potential of the screening marker and realize good application effect.

The mutation of the site is only one condition causing the drug resistance of the oomycete to the bactericides (PTIs), and the selection marker is also within the protection scope of the invention if the selection marker is an ORP1 gene which can cause the drug resistance of the bactericides and has other mutation sites or other oomycetes.

The invention has the beneficial effects that:

the modified vector obtained by the invention carries the fluorothiazole pyrithylone resistance gene PsORP1^ΔN777The screening marker can be used for screening transformants in phytophthora sojae transformation, the drug resistance gene is used for genetic transformation experiments of oomycetes as the screening marker, and the fluorothiazole pyrithylone is used as a screening medicament, so that the screening marker has the remarkable advantages of high screening efficiency, high screening positive rate, wide application range, low cost and the like.

Drawings

FIG. 1 shows that phytophthora sojae anti-fluorothiazole pyrithylone gene PsORP1 is obtained by PCR amplification^ΔN777And promoters and terminators thereof. A: the upstream 1000bp promoter sequence of the genome of the fluorothiazole pyrithylone sensitive gene ORP 1; b: an ORP1cds coding sequence of a fluorothiazole pyrithylone sensitive gene; c: 500bp terminator sequence at the downstream of the genome of the fluorothiazole pyrithylone sensitive gene ORP 1.

FIG. 2 susceptibility of Phytophthora sojae transformants to Fluroxypyrazolopyridone.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Strain information used in the following examples: the wild type strain P6497 of Phytophthora sojae, which is a standard strain subjected to genome sequencing, was given in the laboratory of professor Brett M.Tyler, USA.

The above strains are only materials used in the examples of the present invention, and in fact, any commercially available strain of oomycete may be used when applying the screening markers of the present invention.

The strains are identified by the existing morphological and molecular biological methods.

Screening agents used in the following examples: 96.7% Fluroxypyrazoletophenone as a raw drug, supplied by DuPont. The medicament is prepared into mother liquor with corresponding concentration by dimethyl sulfoxide, and the mother liquor is added into a culture medium by a thousand-fold dilution method.

Example 1 obtaining of Fluothiazolopyrone resistance Gene and recombinant expression vector thereof

One, the obtaining of resistance gene of fluorothiazole pyrithylone

The inventor of the invention finds that when oxysterol binding protein 1(ORP1, GENBANK Access Number is XP-009522569.1) expressed by a phytophthora sojae wild strain P6497 fluorothiazole pyrithylon resistance gene is deleted from 777 th amino acid (asparagine) of an amino terminal, the resistance of the strain to the fluorothiazole pyrithylon can be improved by more than 500 times. The method can improve the concentration of the deletion mutant strain anti-fluorothiazole pyrithylone by more than 500 times, and the mutant obtained by the deletion of 777 th amino acid (asparagine) of ORP1 can still grow after the concentration of the wild type non-growing fluorothiazole pyrithylone is improved by 500 times.

Accordingly, the inventor determines that the phytophthora sojae oxazalil fluorothiazole pyrithylon resistance protein is used as a screening marker for genetic transformation of phytophthora sojae, and the protein is named as PsORP1^ΔN777。

The sequence of the screening marker protein is shown as a sequence 2 in a sequence table. The coding gene PsORP1^ΔN777The sequence of (A) is shown as a sequence 1 in a sequence table, wherein, the 1 st-2901 st nucleotide from the 5' end of the sequence 1 in the sequence table is a coding sequence.

The screening marker PsORP1^ΔN777By a PCR amplification method, a C, A, A three-base deletion mutation is introduced into the 2331/2332/2333 position of a CDS sequence of a PsORP1 gene (a wild-type sensitive gene) to obtain PsORP1^ΔN777A gene.

The fragment shown in the sequence 1 in the sequence table can also be artificially synthesized.

Secondly, construction of recombinant expression vector for expressing fluorothiazole pyrithylone resistance gene

By designing primers, taking wild phytophthora sojae strain cDNA as a template, amplifying the full-length coding sequence of the phytophthora sojae PsORP1 gene, taking wild phytophthora sojae strain DNA as a template, respectively amplifying the upstream 1000bp sequence and the downstream 500bp of the phytophthora sojae PsORP1, and simultaneously connecting the full-length coding sequence of the PsORP1, the upstream 1000bp sequence of the PsORP1 and the downstream 500bp sequence of the PsORP1 into a cloning vector pBluescript II SK by an In-Fusion connection method⁺Designing primers to remove the 2331/2332/2333 th three-base CAA of the coding sequence of the PsORP1 through PCR mutation so as to clone the screening marker PsORP1 in a large quantity^ΔN777The specific technical scheme is as follows:

(2) using cDNA of wild type strain P6497 of soybean phytophthora as template, designing primers F1 (sequence: GGACCGAGCCATGCAGGCGCTCCAGGACG) and R1 (sequence: CTCCTTGTTATTAGTGGCCGGCAGCTGC), and using Takara high fidelity enzyme CloneAmp^TMCarrying out HiFi PCR Premix amplification on a CDS sequence of the PsORP1 gene, and recovering an amplification product fragment by using a commercial gel recovery kit;

(4) using the DNA of the wild type strain of phytophthora sojae as a template to design primers F3 (sequence: CGGCCACTAATAACAAGGAGCGAATGAGTTAGACG) and R3 (sequence: CGCTCTAGAACTAGTGGATCCTATCGACTTGGTCTCCATAAAA) and using Takara high fidelity enzyme CloneAmp^TMHiFi PCR Premix amplifies sequence 500bp (terminator sequence) downstream of PsORP1 gene, and commercialization is utilizedRecovering the amplified product fragment by the gel recovery kit;

(5) connecting the glue recovery products In the steps (1), (2), (3) and (4) by utilizing Takara commercialized In-Fusion HD recombinase to realize the insertion of a PsORP1 gene, and obtaining a recombinant expression vector (pBS-PsORP1) with PsORP 1;

(6) using a vector plasmid (pBS-PsORP1) containing PsORP1 and upstream 1000bp sequence as a template, introducing mutation sites into primers, designing F4 (sequence: GCTCAACACAAAGGGTCCTGTGCGCGTGACGTTCCC) and R4 (sequence: CAGGACCCTTTGTGTTGAGCATGGCGTTGGACTTGACGC), and using Takara high fidelity enzyme CloneAmp^TMHiFi PCRPermix amplifies the pBS-PsORP1 vector, and fragments of the amplified product are recovered using a commercial gel recovery kit;

(7) connecting the recovered products of the glue obtained In the step (6) by utilizing Takara commercial In-Fusion HD recombinase to realize mutation of PsORP1 gene and obtain PsORP1 with mutation^ΔN777An expression vector for the gene (pBS-PsORP 1. delta.N 777, FIG. 1); pBS-PsORP1^ΔN777The promoter shown in the sequence 3 and the PsORP1 shown in the sequence 1^ΔN777The gene is connected with a terminator shown in a sequence 4 in sequence to realize PsORP1^ΔN777Expression of the gene.

Example 2 screening marker PsORP1^ΔN777Application in phytophthora sojae genetic transformation

To verify the application potential of the selection marker, the plasmid (pBS-PsORP1) with the fluorothiazole pyrithylone resistance gene is used^ΔN777) Transferring the soybean phytophthora protoplast to verify whether the screening marker can be applied to screening of transformants in the genetic transformation of the soybean phytophthora and the working efficiency of the screening marker in the genetic transformation of the soybean phytophthora.

The specific operation process is as follows:

epidemic disease of soybeanObtaining protoplast by using wild strain as experimental material by Fang method, and obtaining protoplast by using PEG-CaCl₂Mediated method to transfer vector with Fluothiazolopyrone resistance gene (pBS-PsORP1) into protoplast^ΔN777) And screening to obtain a positive transformant, wherein an expression cassette of the fluorothiazole pyrithylone resistance gene carried in the vector is expressed in a genome.

The method for screening the transformant comprises the following steps:

the protoplast is regenerated for 1 day under the dark condition of 18 ℃, the fluorothiazole pyriethanone is used for carrying out the first screening of transformants, the transformants are cultured for 3 days under the dark condition of 25 ℃, the fluorothiazole pyriethanone is used for carrying out the second screening, the transformants are continuously cultured for 2-3 days under the dark condition of 25 ℃, after the colonies grow out, the colonies are transferred to a solid plate containing 10 percent V8 of the fluorothiazole pyriethanone with the drug, and the third screening is carried out.

In order to ensure the screening efficiency of transformants and the positive rate of the transformants, the concentration of the fluorothiazole pyrithylone in the culture medium during the first, second and third screening of the transformants is between 0.005 and 0.05 mu g/ml, and the culture medium is a 10 percent V8 solid flat plate (100ml V8 vegetable juice, 15g agar powder, 1g calcium carbonate and deionized water to be constant volume to 1L).

And (3) transferring transformants obtained by three times of screening to a V8 flat plate paved with glass paper, collecting hyphae after bacterial colonies grow out, extracting DNA, amplifying resistance markers of the transformants obtained by screening by using primers VF1 (sequence: CTAACAGACCCGAGATACACG) and VR1 (sequence: GCACCCTATTCAGGAGACAA), performing T clone connection on PCR products by using a commercial T clone vector, sending samples for sequencing verification, and taking the clone sequencing result as a positive transformant if a nucleotide sequence shown as a sequence 1 in a sequence table 1 exists, and taking a phytophthora sojae wild strain as a negative control.

Colonies of transformants obtained by the secondary screening can grow out during the third screening, and the transformants obtained by the third screening all contain the screening marker PsORP1^ΔN777And gene, which indicates that the screening positive rate is 100% when the marker is applied to genetic transformation of soybean phytophthora.

Example 3 analysis of biological Properties of transformants

4 strains of phytophthora sojae positive transformants are respectively numbered as T777-1, T777-4, T777-5 and T777-8, and a phytophthora sojae wild strain P6497.

V8 solid medium: 100ml of V8 vegetable juice, centrifuging for 10min at 1500 rpm (5000g), taking the supernatant and deionized water 1: 9 ratio dilution (900 ml deionized water to 100ml supernatant), 1g calcium carbonate, 15g agar, autoclaving (121 ℃ C.) for 20 min.

(1) Fluroxothiazolopyrone sensitivity

The fluorothiazole pyrithylone is prepared into 10 by dimethyl sulfoxide (DMSO)⁴Mu.g/ml of mother liquor. 1000 times of concentrated liquid medicine is prepared, and then the fluorothiazole pyrithylone is diluted into V8 solid culture medium with concentration gradient of 0.001 mu g/ml, 0.005 mu g/ml, 0.01 mu g/ml, 0.05 mu g/ml, 0.1 mu g/ml and 0.5 mu g/ml by using V8 solid culture medium according to 1000 times of proportion. The specific method comprises the steps of sucking the fluorothiazole pyrithylone liquid medicine by using a liquid transfer gun, adding the fluorothiazole pyrithylone liquid medicine into a sterilized 60ml V8 solid culture medium cooled to 45 ℃, and pouring the culture medium with the medicine into a culture dish with the diameter of 9 cm to obtain a V8 culture medium flat plate respectively containing 0.001 mu g/ml, 0.005 mu g/ml, 0.01 mu g/ml, 0.05 mu g/ml, 0.1 mu g/ml and 0.5 mu g/ml. A blank was prepared by adding 60. mu.l DMSO only, and 3 replicates were prepared for each ratio.

Respectively culturing the wild strain and the transformant of the phytophthora sojae on a V8 flat plate without a medicine for 5 days, punching a fungus cake with the diameter of 0.5cm along the edge of a bacterial colony by using a puncher, inoculating the fungus cake with the medicine and a control culture medium in a manner that the hypha faces downwards, placing the fungus cake in an incubator at 25 ℃ for dark culture, and measuring the diameter of the bacterial colony by a cross method after 5 days.

The results are shown in FIG. 2, transforming plasmid pBS-PsORP1^ΔN777The obtained four transformants can show the activity of resisting the fluorothiazole pyrithylone and can grow on a culture medium containing the fluorothiazole pyrithylone with the concentration of 0.005-0.05 mu g/ml, while the wild type strain P6497 of the phytophthora sojae cannot grow on a culture medium with the concentration of the fluorothiazole pyrithylone higher than 0.001 mu g/ml.

(2) Sporangial yield

10 wild type strains P6497 and 4 transformants T777-1, T777-4, T777-5 and T777-8 colony edge stipes (diameter 5mm) are picked up and put into a liquid culture medium containing 20ml of 10% V8 (100ml of V8 vegetable juice, 1g of calcium carbonate and deionized water to make the volume constant to 1L). Culturing at 25 deg.C in dark for 48h, pouring off culture medium, washing mycelia with 20ml sterile deionized water for 8 times at an interval of 30min, standing for 10h, and counting with microscope to observe number of sporangia.

The results are shown in Table 1, transforming plasmid pBS-PsORP1^ΔN777The sporangium yield of the four transformants obtained is not obviously different from that of the wild type strain.

TABLE 1 analysis of biological Properties of transformants

(3) Zoospore yield

The wild type strain P6497 and the 4 transformants T777-1, T777-4, T777-5 and T777-8 were inoculated on V8 medium, respectively, and cultured in the dark at 25 ℃ for 10 days. Then 30ml of sterilized sterile tap water is used for washing hyphae for 10 times at intervals of 30min, finally 15ml of sterile tap water is uniformly added into a culture dish respectively, the culture is carried out for 8 hours at 25 ℃ in the dark, and the number of zoospores is counted by a blood counting chamber.

The results are shown in Table 1, transforming plasmid pBS-PsORP1^ΔN777The zoospore yield of the four transformants obtained is not obviously different from that of the wild type strain.

(4) Germination rate of reposed spore

Approximately 500 spores were spread on 10% V8 solid medium, dark cultured at 25 ℃ for 4 hours, and the number of spore sprouts counted by microscopic observation, and spore germination was regarded as being the length of the sprout larger than the diameter of the resting spore.

The results are shown in Table 1, transforming plasmid pBS-PsORP1^ΔN777The germination rates of the obtained four transformants of the staurosporine are not obviously different from those of the wild type strain.

(5) Pathogenicity

The pathogenicity of the phytophthora sojae is determined by an in vitro leaf method. A freshly grown 5mm diameter cake of wild type or transformant was inoculated into the center of the front face of soybean (variety Williams-rps) leaves, cultured in a humidified petri dish at 25 ℃ for 3 days, and the lesion area was calculated using the software Image J.

The results are shown in Table 1, transforming plasmid pBS-PsORP1^ΔN777The pathogenicity of the obtained four transformants has no obvious difference from that of the wild type strain.

The above experiments demonstrate that the transformation plasmid pBS-PsORP1^ΔN777The method can be used for screening the transformant by using the fluorothiazole pyrithylone, has no obvious influence on the biological phenotype of the phytophthora sojae, and can be used for screening and marking the genetic transformant of the phytophthora sojae.

Although the invention has been described in detail above with reference to a general description and specific embodiments, it will be apparent to those skilled in the art that modifications or improvements may be made on the basis of the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Liu xi Li

<120> fluorothiazole pyrithylone resistance screening marker for genetic transformation of soybean phytophthora

<130>WHOI180015

<160>4

<170>PatentIn version 3.5

<210>1

<211>2901

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>1

atgcaggcgc tccaggacgc gcagcagcgc tttaacgacc tcgtcaacaa tgactggccc 60

gagcgggtgc ccgtggagtc gatggcggac tacgacccga cgtacatgaa ggagggcttc 120

ttgcagaaga agggccagcg cctcaagggc tggaagcgcc gctggttcgt gtgcgacggc 180

cgcacgctgt cctactacat ctcgaggaag gaccgcaagc ccaacgccgt gatcccgctc 240

gagggctgca cggtgcagga cggcgggctg agcgagacgt ggaactcgcc gcgcatctac 300

ctgacggacc cggccacggg catcatgtac tgcctgagcg ccgaggaggg gatcgtggtc 360

acgcagtggc tcgacgtgct gcgcgtggcc gtggcgcgcg tcaacaacgg cggcggcagc 420

agcagctcca actctgctgc ggcttcgtca tcgtcgtcgc agggggcgtc ttcgaacagc 480

aacagcaggg gacgacagca ggccaggact cagacccagc gactcccgtc ctcctcggac 540

gacgaggaca gccgcgtgca cctcaagcgc gccacgtcca tgggaccggc tcaggcgcgg 600

acagtcacgc tcaagtcggc gtcgtccgtg gtggggggat ccagcgcggc gttgacggcg 660

agttccaatg gcgacggcaa gcgcgcgaca aggatgacgt ccgcaccgtc agcggtgaac 720

agctccaata gcagtgcagc tcagccgacg cagcagcagc accgctcgca ccgtaccaag 780

acgcagcgcc tgcccacgac gatctcgctg gagaacgaac tctcgcatgg tctggacgtt 840

ctggaggcgc tgctgtgcggccacagcgcg acgggttcgt cgtctttgat ccggaaccat 900

gtcgtgttcc gccccattgg cgcgttgaac ggcgtgctgc gcagtattgg aacagactcg 960

ggatccggca agcagtacgc gcgcgccagt gtggtgctgc ccgtgtcttc agaggtggcg 1020

gcgattctgc tggcggacca tgggcgccgc gctgaatggg acctgcaatt cccgcagtcg 1080

tcgcatgttg caacttttga cgatgcaacg gacctggtgc acttatcgag tggcagcttt 1140

gcccagatcc agcggacgaa gccgtttgtg gcgcctcaca tggctgcggc ggcgtgcgca 1200

ctatgcgcgg ctcttttctc gggcgcttcg tcgtgggagg ccttactgac tgcgatggtg 1260

tacgctgcag ctattggcgg tattgtgaac agcatcgatt acagcgcgtt gacgaagccc 1320

cgagacctgg tgctgctgcg tcacgtgcga gaatctgctg cgccggattc gcaggactct 1380

ggtgacgaca agtccgtgga cgagatgggc cagtccgtcg tgctgatcct cgagaagtcg 1440

gtggtgaacg agctcaagcc ggttgccacg ggcgctgtgc gcgcgcacgt gggattgagc 1500

ggctggctgc tggagccggt ggattcgggc cacgctacgt tggcaactta cattaccgac 1560

ctggacatga aagggtggct gtcgcccacc acgcgccaga gcttcttgct ctcaaggctc 1620

gactgtgtgt ccgtgctgag cgaatacgtg aaccaggccc agctttgtgg atctgagctt 1680

ggattcggtg gtggtctgga cgaggatggt gagggtgagt atgagactcg cagcatcgga 1740

tacgaagaca ccagcgaagg aagcggtctc ggcgaagttg tagatggaga gtcgcctgcg 1800

atcttccacc cgaagacgta catgcgcggc atgatgccgc tgccgagcgg tggcttgaag 1860

ctgattgaca aggaggttgc caagaagcag agtggcgtgg tgaaggacgt gattaagtct 1920

gcaggagcca agatcctaga gggcaagtca gctgtgagtc tgtcgctgcc cgtgcgtatt 1980

tttgagcctc gtacgaactt ggagcgtgtg tgcgacttga tgctgtacgc gccgacgttc 2040

ctgaacgtcg cctatgctca gaacgacgcg ctggaacgct tcaagtacgt gatggcgttc 2100

gcagtggctg gtctgcacca cagtatcgga cagctgaagc cgtttaaccc gattctgggc 2160

gagactttcc agtcgacgct gaacgacggc accgacgtga gctgcgaaca tacgagccac 2220

cacccgccta tcagtaactt ccagtttacg ggcgacaagt actcgatcgc gggcttcgtg 2280

ctgtggcacg ccagcatgag cgtcaagtcc aacgccatgc tcaacacaaa gggtcctgtg 2340

cgcgtgacgt tccccgacac tgaaggtctc gctgggacga cgatcgagta caacttgccg 2400

tacctgcaga tcggcgggct cttgtgggga gaccgtacgg tggacatcat gggcaacatg 2460

atgttcgacg acaagaagaa ccacctgcag tgtgagctgc gcctgaaccc ggacgccaag 2520

tcgggcatgg gtggcatgtt ctcgagctcc aagaccccga ccgactctct ccgtggcgtg 2580

atcttggaca cgtcggtgtc gcccccgcgc gagatctgcg acgtctccgg ctcttggctg 2640

cacgacctcg tcttcggcag caagacgtac tggagcatca acaagcatca gagtggctac 2700

atggtgccgt acccggagga caagatccta gcgtccgact cgcggttccg cgaggacctg 2760

cactacctgg cggcgggcga cctggacgag tcgcaggagt ggaaggtcaa gctggaggtg 2820

ctgcagcgcg ccgaccgtaa ggctcgtctg gaaggccgac gccccaacca ctggtccttc 2880

cgcgcagctg ccggccacta a 2901

<210>2

<211>966

<212>PRT

<213> Phytophthora sojae (Phytophthora sojae)

<400>2

Met Gln Ala Leu Gln Asp Ala Gln Gln Arg Phe Asn Asp Leu Val Asn

1 5 10 15

Asn Asp Trp Pro Glu Arg Val Pro Val Glu Ser Met Ala Asp Tyr Asp

20 25 30

Pro Thr Tyr Met Lys Glu Gly Phe Leu Gln Lys Lys Gly Gln Arg Leu

35 40 45

Lys Gly Trp Lys Arg Arg Trp Phe Val Cys Asp Gly Arg Thr Leu Ser

50 55 60

Tyr Tyr Ile Ser Arg Lys Asp Arg Lys Pro Asn Ala Val Ile Pro Leu

65 70 75 80

Glu Gly Cys Thr Val Gln Asp Gly Gly Leu Ser Glu Thr Trp Asn Ser

85 90 95

Pro Arg Ile Tyr Leu Thr Asp Pro Ala Thr Gly Ile Met Tyr Cys Leu

100 105 110

Ser Ala Glu Glu Gly Ile Val Val Thr Gln Trp Leu Asp Val Leu Arg

115 120 125

Val Ala Val Ala Arg Val Asn Asn Gly Gly Gly Ser Ser Ser Ser Asn

130 135 140

Ser Ala Ala Ala Ser Ser Ser Ser Ser Gln Gly Ala Ser Ser Asn Ser

145 150 155 160

Asn Ser Arg Gly Arg Gln Gln Ala Arg Thr Gln Thr Gln Arg Leu Pro

165 170 175

Ser Ser Ser Asp Asp Glu Asp Ser Arg Val His Leu Lys Arg Ala Thr

180 185 190

Ser Met Gly Pro Ala Gln Ala Arg Thr Val Thr Leu Lys Ser Ala Ser

195 200 205

Ser Val Val Gly Gly Ser Ser Ala Ala Leu Thr Ala Ser Ser Asn Gly

210 215 220

Asp Gly Lys Arg Ala Thr Arg Met Thr Ser Ala Pro Ser Ala Val Asn

225 230 235 240

Ser Ser Asn Ser Ser Ala Ala Gln Pro Thr Gln Gln Gln His Arg Ser

245 250 255

His Arg Thr Lys Thr Gln Arg Leu Pro Thr Thr Ile Ser Leu Glu Asn

260 265 270

Glu Leu Ser His Gly Leu Asp Val Leu Glu Ala Leu Leu Cys Gly His

275 280 285

Ser Ala Thr Gly Ser Ser Ser Leu Ile Arg Asn His Val Val Phe Arg

290 295 300

Pro IleGly Ala Leu Asn Gly Val Leu Arg Ser Ile Gly Thr Asp Ser

305 310 315 320

Gly Ser Gly Lys Gln Tyr Ala Arg Ala Ser Val Val Leu Pro Val Ser

325 330 335

Ser Glu Val Ala Ala Ile Leu Leu Ala Asp His Gly Arg Arg Ala Glu

340 345 350

Trp Asp Leu Gln Phe Pro Gln Ser Ser His Val Ala Thr Phe Asp Asp

355 360 365

Ala Thr Asp Leu Val His Leu Ser Ser Gly Ser Phe Ala Gln Ile Gln

370 375 380

Arg Thr Lys Pro Phe Val Ala Pro His Met Ala Ala Ala Ala Cys Ala

385 390 395 400

Leu Cys Ala Ala Leu Phe Ser Gly Ala Ser Ser Trp Glu Ala Leu Leu

405 410 415

Thr Ala Met Val Tyr Ala Ala Ala Ile Gly Gly Ile Val Asn Ser Ile

420 425 430

Asp Tyr Ser Ala Leu Thr Lys Pro Arg Asp Leu Val Leu Leu Arg His

435 440 445

Val Arg Glu Ser Ala Ala Pro Asp Ser Gln Asp Ser Gly Asp Asp Lys

450 455 460

Ser Val Asp GluMet Gly Gln Ser Val Val Leu Ile Leu Glu Lys Ser

465 470 475 480

Val Val Asn Glu Leu Lys Pro Val Ala Thr Gly Ala Val Arg Ala His

485 490 495

Val Gly Leu Ser Gly Trp Leu Leu Glu Pro Val Asp Ser Gly His Ala

500 505 510

Thr Leu Ala Thr Tyr Ile Thr Asp Leu Asp Met Lys Gly Trp Leu Ser

515 520 525

Pro Thr Thr Arg Gln Ser Phe Leu Leu Ser Arg Leu Asp Cys Val Ser

530 535 540

Val Leu Ser Glu Tyr Val Asn Gln Ala Gln Leu Cys Gly Ser Glu Leu

545 550 555 560

Gly Phe Gly Gly Gly Leu Asp Glu Asp Gly Glu Gly Glu Tyr Glu Thr

565 570 575

Arg Ser Ile Gly Tyr Glu Asp Thr Ser Glu Gly Ser Gly Leu Gly Glu

580 585 590

Val Val Asp Gly Glu Ser Pro Ala Ile Phe His Pro Lys Thr Tyr Met

595 600 605

Arg Gly Met Met Pro Leu Pro Ser Gly Gly Leu Lys Leu Ile Asp Lys

610 615 620

Glu Val Ala Lys Lys GlnSer Gly Val Val Lys Asp Val Ile Lys Ser

625 630 635 640

Ala Gly Ala Lys Ile Leu Glu Gly Lys Ser Ala Val Ser Leu Ser Leu

645 650 655

Pro Val Arg Ile Phe Glu Pro Arg Thr Asn Leu Glu Arg Val Cys Asp

660 665 670

Leu Met Leu Tyr Ala Pro Thr Phe Leu Asn Val Ala Tyr Ala Gln Asn

675 680 685

Asp Ala Leu Glu Arg Phe Lys Tyr Val Met Ala Phe Ala Val Ala Gly

690 695 700

Leu His His Ser Ile Gly Gln Leu Lys Pro Phe Asn Pro Ile Leu Gly

705 710 715 720

Glu Thr Phe Gln Ser Thr Leu Asn Asp Gly Thr Asp Val Ser Cys Glu

725 730 735

His Thr Ser His His Pro Pro Ile Ser Asn Phe Gln Phe Thr Gly Asp

740 745 750

Lys Tyr Ser Ile Ala Gly Phe Val Leu Trp His Ala Ser Met Ser Val

755 760 765

Lys Ser Asn Ala Met Leu Asn Thr Lys Gly Pro Val Arg Val Thr Phe

770 775 780

Pro Asp Thr Glu Gly Leu Ala GlyThr Thr Ile Glu Tyr Asn Leu Pro

785 790 795 800

Tyr Leu Gln Ile Gly Gly Leu Leu Trp Gly Asp Arg Thr Val Asp Ile

805 810 815

Met Gly Asn Met Met Phe Asp Asp Lys Lys Asn His Leu Gln Cys Glu

820 825 830

Leu Arg Leu Asn Pro Asp Ala Lys Ser Gly Met Gly Gly Met Phe Ser

835 840 845

Ser Ser Lys Thr Pro Thr Asp Ser Leu Arg Gly Val Ile Leu Asp Thr

850 855 860

Ser Val Ser Pro Pro Arg Glu Ile Cys Asp Val Ser Gly Ser Trp Leu

865 870 875 880

His Asp Leu Val Phe Gly Ser Lys Thr Tyr Trp Ser Ile Asn Lys His

885 890 895

Gln Ser Gly Tyr Met Val Pro Tyr Pro Glu Asp Lys Ile Leu Ala Ser

900 905 910

Asp Ser Arg Phe Arg Glu Asp Leu His Tyr Leu Ala Ala Gly Asp Leu

915 920 925

Asp Glu Ser Gln Glu Trp Lys Val Lys Leu Glu Val Leu Gln Arg Ala

930 935 940

Asp Arg Lys Ala Arg Leu Glu Gly Arg ArgPro Asn His Trp Ser Phe

945 950 955 960

Arg Ala Ala Ala Gly His

965

<210>3

<211>1000

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>3

gatcccagtt attgcaacgt caacgtacgc gcttgttgag ctcctcgatg gtcttgatga 60

gctcggcgtt cttcttcttg agctcctcgt tctcggcccg cagcgcgtcc acgtcgatgc 120

ccgtgggggc gcccatgaag cgcttgacgt agtccacggc gttcgggggt ttgtccgcct 180

cctcgtagag ccccacgagc actttggtga gcgcgtccac cacgccgctc ttctcgaggt 240

acttgcggaa ctcctccttc ttcgagtcgg gcgtctggta cgtggcggcg ctcattggat 300

cgtctcttgg aattgacacg tcagtcgatg gatacacaca gcagcgcaga gagaagcgag 360

cttcctgcgg ccttggagag ctcgagagcg cgtcggctgt tgtagtatcc tgctgggggc 420

aacacgacgc gacgctaaag cggactcgtg cctcttcgcg atcatggttg ccacttgggg 480

ggcttcaact aacagacccg agatacacga tatctccata aacaatatct tggtgctaga 540

gctgtctaaa ctacgtaaca cagttaatac aaattcagct ttttttccat tgctacctct 600

ttatctcatg aatcagtgta taaagctaca tgcgatgata caggttagtt gcacgttcgt 660

gacgcgtctc cgccggctgt ccaatcacca agtgccacgc acgaaggcgg cttgtatcgc 720

taatcgggca cttccgcccg gacagcctgg ttccccacct ggctcttccg gcctcaatcc 780

gcagcttctg cgcacgtggc cccgagcttg ggggcacaac cagctcagct cagctctctc 840

ttgtcggcgg cttcctctct ccgctgccac tccgcctctt tgcaccgcgc gcgcgagagg 900

ccccggcagc aagacgaagg accagagcgc gcaccgacac gcactcggca gcgccagcgg 960

cggcgaggca gcggcgcgcg aacgcaagcg ggaccgagcc 1000

<210>4

<211>500

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>4

taacaaggag cgaatgagtt agacgtatcg acggttggct tgttttgtac tacgaggcag 60

aaacactcgc ccagttaact tctgcgataa cctagcaaag caagcgtata tttcctgttg 120

tcattgcgcg ttttgtctcc tgaatagggt gccggtaact ccaagtgtac catttctgat 180

tggccttcca aaatctacat agaaaggttt tatcattagg ggtaggggga ttaaacaact 240

attaaacgcg atgataaaac acaattgttt cgtgggatca aaaagtcctc cgaccaaaca 300

attcataaaa ccaatttggt cgcccgttta atccccccta atctattgtg aaaaccgctt 360

catttaccta ttttgctcgt aaatcgattg attagcaccc tgatttagat cgatcgattt 420

gtaaatcgat cgcgcccctg cgatgcatat gtgagtggat gtgcagatta gacgatcgtt 480

ttatggagac caagtcgata 500

Claims

1. The fluorine thiazole pyrithylone resistance related protein is a protein consisting of an amino acid residue sequence of SEQ ID NO.2 in a sequence table.

2. The gene encoding a fluorothiazolepyrithylone resistance-associated protein according to claim 1.

3. The encoding gene of claim 2, wherein: the cDNA nucleotide sequence of the coding gene is shown as SEQ ID NO: 1.

4. An expression cassette, recombinant expression vector or transgenic recombinant bacterium comprising the coding gene of claim 2 or 3.

5. The recombinant expression vector according to claim 4, wherein the recombinant expression vector is obtained by introducing an expression cassette for expressing the protein according to claim 1 into a eukaryotic expression vector.

6. The recombinant expression vector according to claim 5, wherein the expression cassette for expressing the protein of claim 1 consists of a promoter, the gene encoding the oxathiapiprolin resistance-related protein of claim 2 or 3, and a terminator, which are connected in sequence.

7. The recombinant expression vector according to claim 6, wherein the promoter is a DNA molecule of 1) or 2) below:

1) a DNA molecule as shown in SEQ ID NO. 3;

2) a DNA molecule which has more than 90% of homology with the DNA sequence limited by 1) and has a promoter function;

the terminator can be the following DNA molecules of 1) or 2):

1) a DNA molecule as shown in SEQ ID NO. 4;

2) a DNA molecule which has more than 90% of homology with the DNA sequence limited by 1) and has a promoter function.

8. The recombinant expression vector of claim 6, wherein the eukaryotic expression vector is selected from the group consisting of pBluescript II SK⁺Vector or pEASY-T1 vector.

9. A protein according to claim 1 or a gene encoding a protein according to any one of claims 2 to 3, wherein the protein is of Phytophthora sojae (Phytophthora sojae), (PhytopPhytophthoara sojae) The application of the strain P6497 in genetic transformation and selection marking.

10. Use according to claim 9,

the application specifically comprises the following steps: use of the recombinant expression vector of any one of claims 4 to 7 in Phytophthora sojae (A.sojae) (B.sojae)) (Phytophthoara sojae) Strain P6497 genetic transformation, and selecting transformants with a medium containing 0.005-0.05. mu.g/ml fluorothiazolepyrithylone.

11. The use according to claim 10, wherein the method for selecting transformants is:

regenerating protoplast for 1 day at 18 ℃ in the dark, carrying out first screening of transformants by using a culture medium containing 0.005-0.05 mu g/ml fluorothiazolepyrithylone, culturing for 3 days at 25 ℃ in the dark, carrying out second screening by using a culture medium containing 0.005-0.05 mu g/ml fluorothiazolepyrithylone, continuously culturing for 2-3 days at 25 ℃ in the dark, transferring bacterial colonies to a V8 culture medium plate containing 0.005-0.05 mu g/ml fluorothiazolepyrithylone after the bacterial colonies grow out, and carrying out third screening.

12. Phytophthora sojae strainPhytophthoara sojae) The strain is prepared from Phytophthora sojae (A)Phytophthoara sojae) A mutant strain obtained by deleting amino acid-asparagine at position 777 in oxysterol binding protein 1 of the strain P6497; wherein, the protein after the 777 th amino acid-asparagine of the oxysterol binding protein 1 is deleted is the related protein of the fluorothiazole pyrithylone resistance which consists of the amino acid residue sequence of SEQ ID NO.2 in a sequence table.