CN108359728A - Nucleic acid sequence, kit and its detection method for detecting diabetes risk site - Google Patents

Nucleic acid sequence, kit and its detection method for detecting diabetes risk site Download PDF

Info

Publication number
CN108359728A
CN108359728A CN201810298890.7A CN201810298890A CN108359728A CN 108359728 A CN108359728 A CN 108359728A CN 201810298890 A CN201810298890 A CN 201810298890A CN 108359728 A CN108359728 A CN 108359728A
Authority
CN
China
Prior art keywords
seq
gene
site
nucleotide sequence
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810298890.7A
Other languages
Chinese (zh)
Inventor
周艳琳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Good Gene Biotechnology (wuhan) Co Ltd
Original Assignee
Good Gene Biotechnology (wuhan) Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Good Gene Biotechnology (wuhan) Co Ltd filed Critical Good Gene Biotechnology (wuhan) Co Ltd
Priority to CN201810298890.7A priority Critical patent/CN108359728A/en
Publication of CN108359728A publication Critical patent/CN108359728A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of nucleic acid sequences, kit and its detection method for detecting diabetes risk site.The nucleic acid sequence combination of the present invention is to be directed to 5 polymorphic site (rs228648 of diabetes, rs114202595, rs7754840, rs7756992 and rs7574865) propose, the sense primer and general reverse primer of sense primer, saltant type including each site wild type, using the kit in quick detection diabetes risk site prepared by nucleic acid sequence combination, it is easy to use, easy to operate, high degree of automation, reduce the pollution in operating process, detection result is good, has high sensitivity, high specific, the characteristics of high accuracy, pinpoint accuracy.The detection method of the present invention is operated using complete stopped pipe, the result of convenient and efficient acquisition detection by directly exploring fluorescence signal value during PCR, PCR post-processings or electrophoresis detection are not needed, overcome Standard PCR technology it is easy to pollute, there is the technical issues of false positive, non-specific amplification can be effectively avoided the occurrence of, high-volume pattern detection is suitble to.

Description

Nucleic acid sequence, kit and its detection method for detecting diabetes risk site
Technical field
The present invention relates to medicine and biotechnology more particularly to a kind of nucleic acid for detecting diabetes risk site Sequence, kit and its detection method.
Background technology
Diabetes are a kind of polygenic disease participating in interaction jointly by inherent cause and environmental factor, 1 type or 2 types sugar There is apparent genetic heterogeneity in urine disease.Type 1 diabetes (T1DM) are a kind of immune regulative diseases, are produced by immune disorder Raw inflammatory cytokine, caused by inducing pancreas islet generation inflammation.Diabetes B (T2DM) is due to insulin resistance and β cells Hyposecretion leads to a kind of complicated multigenic disease of hyperglycemia, and 90% or more is diabetes B in diabetic.
UST2 (rs228648) influences intracellular Ca after being combined with g protein coupled receptor GPR142+Interior stream, and then influence pancreas Island element paracrisis, therefore the serum UTS2 of T2DM patient is significantly higher than normal person, another aspect UTS2 may also suppress insulin Release, makes the insulin resistance degree of crowd deepen, and UST2rs228648 loci polymorphisms make UTS2 concentration change, and cause pancreas islet Element is resisted, and is played an important role in the generation of T2DM.
Transcription factor matches the transcription inhibitory factor that box 4 (PAX4) major function is pancreas development, in point of B cells of pancreas Change and plays a significant role in growth course, the insulin secretory cell and growth inhibition of PAX4 knock out mice pancreas maturation The complete hyperplasia of secretory cell, and secrete the B cell hyperplasia of glucagon.Japanese's result of study prompts rs114202595 more State property is related to Japanese population T2DM, and has an impact to the function of B cell.Another report display, carries The T2DM patient of rs114202595AA types lacks First-phase of insulin secretion, it is seen that PAX4 is as in the morbidity development of T2DM Important gene, mutation the morbidity of T2DM can be had an impact.
CDK5 regulator subunit associated protein 1s analog 1 (CDKAL1) is sent out in terms of protection β cell functions, reduction blood glucose Important role is waved, if CDKAL1 genes morph, inhibiting effect is lost to CDK5, influences the secretion work(of beta Cell of islet Can, so that the secretion of insulin is reduced, leads to the generation of T2DM.Studies show that, the sites rs7756992 and the sites rs7754840 Polymorphism is significantly correlated with the morbidity of T2DM in many East Asia crowds, therefore is helped to the detection of two kinds of SNP sites of CDKAL1 Diabetes risk is analyzed in analysis crowd.
Signal transduction and transcriptional activators (STAT4) participate in JAK/STAT signal pathways, regulate and control in the differentiation of Th1/Th2 And play a significant role in the various autoimmune diseases such as type 1 diabetes (T1DM) for initiation of therefore lacking of proper care, in Area of South China In Chinese Han Population, the morbidity strong correlation of STAT4rs7574865 loci polymorphisms and T1DM, therefore STAT4 loci polymorphisms exist It plays an important role in T1DM.
Currently, detection gene pleiomorphism and gene mutation method mainly have sanger PCR sequencing PCRs, gene chip hybridization method, PCR-RFLP methods and fluorescence quantitative PCR method.Sanger PCR sequencing PCRs are the goldstandards of mutation analysis, can find known and unknown mutation Site, but expensive equipment, sensitivity is low, complicated for operation, and the period is long, is easy pollution；Regular-PCR-RFLP method and technologies are easy, valence Lattice are cheap, and suitable for the test in laboratory of a small amount of sample, but being only capable of detection has the mutation of restriction enzyme site, no restriction enzyme site that cannot examine It surveys, there is the risk for leading to false positive by PCR product pollution；Biochip technology has high throughput, micromation, the spies such as automation Point is suitable for full genome mutated scanning, is not suitable for the mutational site detection of individual gene, and precision is low, expensive, these Disadvantage limits development and application of these three methods in actual clinical work, cannot be satisfied and quickly clinical assessment is instructed to want It asks.Therefore, a kind of quick, accurate and inexpensive novel detection method becomes the active demand of clinical examination.
Invention content
In order to overcome the above-mentioned deficiency of the prior art, the present invention to propose a kind of nucleic acid for detecting diabetes risk site Sequence, kit and its detection method.In order to achieve the above object, the present invention is achieved by the following technical solutions：
The nucleic acid sequence combination that present invention firstly provides a kind of for detecting diabetes risk site, the nucleic acid sequence Combination includes：
1) such as SEQ ID NO：The sites the UST2 gene rs228648 wild type sense primer of nucleotide sequence shown in 1, such as SEQ ID NO：The UST2 gene rs228648 site mutation type sense primers of nucleotide sequence shown in 2 and such as SEQ ID NO：3 The general reverse primer of the two of shown nucleotide sequence；
2) such as SEQ ID NO：The sites the PAX4 gene rs114202595 wild type sense primer of nucleotide sequence shown in 4, Such as SEQ ID NO：The PAX4 gene rs114202595 site mutation type sense primers of nucleotide sequence shown in 5 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 6；
3) such as SEQ ID NO：The sites the CDKAL1 gene rs7754840 wild type sense primer of nucleotide sequence shown in 7, Such as SEQ ID NO：The CDKAL1 gene rs7754840 site mutation type sense primers of nucleotide sequence shown in 8 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 9；
4) such as SEQ ID NO：Draw the sites the CDKAL1 gene rs7756992 wild type upstream of nucleotide sequence shown in 10 Object, such as SEQ ID NO：The CDKAL1 gene rs7756992 site mutation type sense primers of nucleotide sequence shown in 11 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 12；
5) such as SEQ ID NO：The sites the STAT4 gene rs7574865 wild type sense primer of nucleotide sequence shown in 13, Such as SEQ ID NO：The STAT4 gene rs7574865 site mutation type sense primers of nucleotide sequence shown in 14 and such as SEQ ID NO：15 show the general reverse primer of the two of nucleotide sequence.
Further, nucleic acid sequence combination further includes the wild-type positive control and mutation of 5 polymorphic sites The control of type positive control, the wherein sites UST2 genes rs228648 wild-type positive, UST2 gene rs228648 site mutation types Positive control, the control of the sites PAX4 gene rs114202595 wild-type positive, PAX4 gene rs114202595 site mutation types Positive control, the control of the sites CDKAL1 gene rs7754840 wild-type positive, CDKAL1 gene rs7754840 site mutation types Positive control, the control of the sites CDKAL1 gene rs7756992 wild-type positive, CDKAL1 gene rs7756992 site mutation types Positive control, the control of the sites STAT4 gene rs7574865 wild-type positive, STAT4 gene rs7574865 site mutations type sun Property control nucleotide sequence successively such as SEQ ID NO：15~SEQ ID NO：Shown in 25.
Further, the saltant type positive control of each polymorphic site includes that corresponding polymorphic site saltant type is positive Template sequence, the corresponding polymorphic site saltant type positive template sequence be by corresponding site saltant type sense primer with it is corresponding The PCR product that site common downstream primer amplification goes out.
Further, the wild-type positive control of each polymorphic site includes corresponding polymorphic site wild-type positive Template sequence, the corresponding polymorphic site wild-type positive template sequence be by corresponding site wild type sense primer with it is corresponding The PCR product that site common downstream primer amplification goes out.
It is a further object of the present invention to provide a kind of kit for detecting diabetes risk site, the kit packets It includes the nucleic acid sequence for detecting diabetes risk site to combine, the nucleic acid sequence combination includes：
1) such as SEQ ID NO：The sites the UST2 gene rs228648 wild type sense primer of nucleotide sequence shown in 1, such as SEQ ID NO：The UST2 gene rs228648 site mutation type sense primers of nucleotide sequence shown in 2 and such as SEQ ID NO：3 The general reverse primer of the two of shown nucleotide sequence；
2) such as SEQ ID NO：The sites the PAX4 gene rs114202595 wild type sense primer of nucleotide sequence shown in 4, Such as SEQ ID NO：The PAX4 gene rs114202595 site mutation type sense primers of nucleotide sequence shown in 5 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 6；
3) such as SEQ ID NO：The sites the CDKAL1 gene rs7754840 wild type sense primer of nucleotide sequence shown in 7, Such as SEQ ID NO：The CDKAL1 gene rs7754840 site mutation type sense primers of nucleotide sequence shown in 8 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 9；
4) such as SEQ ID NO：Draw the sites the CDKAL1 gene rs7756992 wild type upstream of nucleotide sequence shown in 10 Object, such as SEQ ID NO：The CDKAL1 gene rs7756992 site mutation type sense primers of nucleotide sequence shown in 11 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 12；
5) such as SEQ ID NO：The sites the STAT4 gene rs7574865 wild type sense primer of nucleotide sequence shown in 13, Such as SEQ ID NO：The STAT4 gene rs7574865 site mutation type sense primers of nucleotide sequence shown in 14 and such as SEQ ID NO：15 show the general reverse primer of the two of nucleotide sequence.
Further, the kit further includes that the sample processing reagent of DNA, PCR bufferings are extracted from sample to be detected At least one of liquid, archaeal dna polymerase, positive control, negative controls, colour reagent, DEPC water reagent.
The present invention finally proposes a kind of method of quick 5 polymorphic sites of detection diabetes, and this method includes following Step：
(1) genomic DNA of the sample from people is extracted；
(2) using the genomic DNA of sample as template, 5 polymorphic sites are carried out respectively using I dye methods of SYBRGreen Wild type reaction system and jump reaction system real-time fluorescent PCR amplification；
(3) Data acquisition and issuance：Threshold line is adjusted to more than background signal and negative amplification line, real-time fluorescence is passed through PCR instrument collecting signal calculates the Δ Ct values of the wild type reaction system and saltant type reaction system to determine the sample The genotype of DNA.
Further, step (2) includes 10 groups of PCR reaction solutions, the sites detection UST2 gene rs228648 wild type PCR reaction solution includes SEQ ID NO：1 and SEQ ID NO：3 primer, detection UST2 gene rs228648 site mutation types PCR reaction solution includes SEQ ID NO：2 and SEQ ID NO：3 primer；Detect the sites PAX4 gene rs114202595 wild type PCR reaction solution include SEQ ID NO：4 and SEQ ID NO：6 primer detects PAX4 gene rs114202595 site mutations The PCR reaction solution of type includes SEQ ID NO：5 and SEQ ID NO：6 primer；It is wild to detect the sites CDKAL1 gene rs7754840 The PCR reaction solution of raw type includes SEQ ID NO：7 and SEQ ID NO：9 primer, the sites detection CDKAL1 gene rs7754840 The PCR reaction solution of saltant type includes SEQ ID NO：8 and SEQ ID NO：9 primer；Detect CDKAL1 genes rs7756992 The PCR reaction solution of point wild type includes SEQ ID NO：10 and SEQ ID NO：12 primer detects CDKAL1 genes The PCR reaction solution of rs7756992 site mutation types includes SEQ ID NO：11 and SEQ ID NO：12 primer；Detect STAT4 The PCR reaction solution of the sites gene rs7574865 wild type includes SEQ ID NO：13 and SEQ ID NO：15 primer, detection The PCR reaction solution of STAT4 gene rs7574865 site mutation types includes SEQ ID NO：14 and SEQ ID NO：15 primer.
Further, amplification step includes in the step 2)：95℃10min；95 DEG C of 15s, 60 DEG C of 40s, 45 cycles, 60 DEG C of collection fluorescence signals；95 DEG C of 15s.60 DEG C of 1min, 95 DEG C of 30s, 60 DEG C of 15s.
Further, the genotype of the sample DNA is determined in the step 3) according to following criterion：
- 3≤Δ Ct=wild types Ct values-value≤3 saltant type Ct, are determined as heterozygous sample；
Δ Ct=saltant types Ct values-wild type Ct values ＞ 3, are determined as wild type sample；
Δ Ct=wild types Ct values-saltant type Ct values ＞ 3, are determined as saltant type sample.
Compared with prior art, the beneficial effects of the present invention are：
(1) nucleic acid sequence combination of the present invention for detecting diabetes risk site is to be directed to 5 polymorphic positions of diabetes What point proposed, using the kit in quick detection diabetes risk site prepared by nucleic acid sequence combination, easy to use, operation Simplicity, high degree of automation enormously simplify operating process, and reduce the pollution in operating process, and detection result is good, has The characteristics of high sensitivity, high specific, high accuracy, pinpoint accuracy.
(2) method of quick 5 polymorphic sites of detection diabetes provided by the invention is operated using complete stopped pipe, operation Simply, convenient and efficient acquisition detection by directly exploring fluorescence signal value during PCR result it is not necessary to which PCR is post-processed Or electrophoresis detection, overcome Standard PCR technology it is easy to pollute, there is the technical issues of false positive, can effectively avoid the occurrence of non-spy Specific amplification problem is suitble to the detection of high-volume sample.
Description of the drawings
Fig. 1 is the amplification curve that No. 9 sites sample UST2 gene rs228648 are detected in the present invention preferably kit；
Fig. 2 is that the amplification in No. 9 sites sample PAX4 gene rs114202595 of detection in the present invention preferably kit is bent Line；
Fig. 3 is that the amplification in No. 9 sites sample CDKAL1 gene rs7754840 of detection in the present invention preferably kit is bent Line；
Fig. 4 is that the amplification in No. 9 sites sample CDKAL1 gene rs7756992 of detection in the present invention preferably kit is bent Line；
Fig. 5 is the amplification curve that No. 9 sites sample STAT4 gene rs7574865 are detected in the present invention preferably kit.
Specific implementation mode
It shows that example illustrates certain embodiments of the present invention, and should not be construed as the model of the limitation present invention It encloses.Present disclosure can be improved from material, method and reaction condition simultaneously, all these improvement should all It falls within the spirit and scope of the present invention.No special explanation, reagent used in the embodiment of the present invention are commercial goods, this The database that inventive embodiments use is disclosed online database, and the source of gene order used is NCBI (US Nationals Biotechnology Information center).
Embodiment 1：5 polymorphic site primers of diabetes and validation template design
ARMS primers selected by the present invention be for 5 polymorphic sites of diabetes (rs228648, rs114202595, Rs7754840, rs7756992 and rs7574865) design.Selected ARMS primers are from one section of 3 ' end of sequence and its neighbouring people For addition mispairing mutational site a set of primer combination in, can distinguish drawing for single locus allele by filtering out Object ensure that the high degree of specificity of PCR amplification.
By verification experimental verification, the final specific detection primer for determining 5 polymorphic sites of diabetes, nucleotide sequence is such as Under：
UST2 gene rs228648 site wild type sense primers (DM1-F1), saltant type sense primer (DM1-F2) and public affairs With downstream primer (DM1-R1)
DM1-F1(SEQ ID NO:1)：5`-tgctcggactcataaatcctt-3`
DM1-F2(SEQ ID NO:2)：5`-tgctcggactcataaatcctc-3`
DM1-R1(SEQ ID NO:3)：5`-ataaatctggcaaaagaggcaa-3`
PAX4 gene rs114202595 site wild type sense primers (DM2-F1), saltant type sense primer (DM2-F2) With public downstream primer (DM2-R1)
DM2-F1(SEQ ID NO:4)：5`-ctggtcctcctgtaatgctca-3`
DM2-F2(SEQ ID NO:5)：5`-ctggtcctcctgtaatgctcg-3`
DM2-R1(SEQ ID NO:6)：5`-gatgggaaaaaggatattaaggg-3`
CDKAL1 gene rs7754840 site wild type sense primers (DM3-F1), saltant type sense primer (DM3-F2) With public downstream primer (DM8-R1)
DM3-F1(SEQ ID NO:7)：5`-gggaagaagtagtaatgttggaatc-3`
DM3-F2(SEQ ID NO:8)：5`-gggaagaagtagtaatgttggagag-3`
DM3-R1(SEQ ID NO:9)：5`-taactcaatgctgttcatcaggc-3`
CDKAL1 gene rs7756992 site wild type sense primers (DM4-F1), saltant type sense primer (DM4-F2) With public downstream primer (DM4-R1)
DM4-F1(SEQ ID NO:10)：5`-ttcccccctgtattttagttcta-3`
DM4-F2(SEQ ID NO:11)：5`-tcccccctgtattttagttgtg-3`
DM4-R1(SEQ ID NO:12)：5`-agaatccataatcccctcttgaa-3`
STAT4 gene rs7574865 site wild type sense primers (DM5-F1), saltant type sense primer (DM5-F2) and Public downstream primer (DM5-R1)
DM5-F1(SEQ ID NO:13)：5`-ttccactgaaataagataaccactactc-3`
DM5-F2(SEQ ID NO:14)：5`-ttccactgaaataagataaccactacta-3`
DM5-R1(SEQ ID NO:15)：5`-atggaggtaaggaaaaaagaagtg-3`
In addition, the nucleic acid sequence combination in detection diabetes risk site further includes the wild-type positive of 5 polymorphic sites The saltant type positive control of control and saltant type positive control, each polymorphic site includes corresponding polymorphic site saltant type sun Property template sequence, the corresponding polymorphic site saltant type positive template sequence be by corresponding site saltant type sense primer with it is right The PCR product for answering site common downstream primer amplification to go out；The wild-type positive control of each polymorphic site is polymorphic comprising correspondence Property site wild-type positive template sequence, the corresponding polymorphic site wild-type positive template sequence is wild by corresponding site The PCR product that type sense primer goes out with corresponding site common downstream primer amplification.Each site positive control sequence is as follows：
The sites UST2 gene rs228648 wild-type positive compares (SEQ ID NO：And saltant type positive control (SEQ 16) ID NO：17)
DM1-1(SEQ ID NO16):
5`-tttataaatctggcaaaagaggcaacttacagcaataaatcatgaattaaaggaaggcttggatat gagttgaagtggccaaagcaaagagacatggatttatgagtccgagcagaa-3`
DM1-2(SEQ ID NO：17):
5-tttataaatctggcaaaagaggcaacttacagcaataaatcatgaattaaaggaaggcttggatatg agttgaagtggccaaagcaaagagacatggatttatgagtccgagcagaa-3’
The sites PAX4 gene rs114202595 wild-type positive compares (SEQ ID NO：And saltant type positive control 18) (SEQ ID NO：19)
DM2-1(SEQ ID NO：18):
5-ctggtcctcctgtaatgcccacaggactcggttgatggaggagacctgggagtgtcagggtgttgag tggagagatggtgctcagactcagggctataccctgaggatgttgcccttaatatcctttttcccatc-3’
DM2-2(SEQ ID NO：19):
5-ctggtcctcctgtaatgcccgcaggactcggttgatggaggagacctgggagtgtcagggtgttgag tggagagatggtgctcagactcagggctataccctgaggatgttgcccttaatatcctttttcccatc-3’
The sites CDKAL1 gene rs7754840 wild-type positive compares (SEQ ID NO：And saltant type positive control 20) (SEQ ID NO：21)
DM3-1(SEQ ID NO：20):
5-tggggaagaagtagtaatgttggaaacgttgacttgatagaggattttgtaagatgagtgaaaaaga tctaaaaggacagtgatgtctctgttattgactgaggtatccttggtctctagaatagtgcctgatgaacagcattg agtta-3’
DM3-2(SEQ ID NO：21):
5-tggggaagaagtagtaatgttggaaaggttgacttgatagaggattttgtaagatgagtgaaaaaga tctaaaaggacagtgatgtctctgttattgactgaggtatccttggtctctagaatagtgcctgatgaacagcattg agtta-3’
The sites CDKAL1 gene rs7756992 wild-type positive compares (SEQ ID NO：And saltant type positive control 22) (SEQ ID NO：23)
DM4-1(SEQ ID NO：22):
5`-atattcccccctgtattttagttttagatctacagttatgtagcaatgagctcattatcagtcctt ttgctgaaatttccccagacctctcttggttgcatgaagctcatcctgttttatttagattcttcaagaggggatta tggattct-3`
DM4-2(SEQ ID NO：23):
5`-atattcccccctgtattttagttttggatctacagttatgtagcaatgagctcattatcagtcctt ttgctgaaatttccccagacctctcttggttgcatgaagctcatcctgttttatttagattcttcaagaggggatta tggattct-3`
The sites STAT4 gene rs7574865 wild-type positive compares (SEQ ID NO：And saltant type positive control 24) (SEQ ID NO：25)
DM5-1(SEQ ID NO：24):
5`-atggaggtaaggaaaaaagaagtgggataaaaagaagtttgtaattaaaaagctacatgtatatta tgatctactttatggaaaattacatgagtgtgtatgcagtaaaagtatgaaaagttggtgaccaaaatgtgaatagt ggttatcttatttcagtggaattt-3`
DM5-2(SEQ ID NO：25):
5`-atggaggtaaggaaaaaagaagtgggataaaaagaagtttgtaattaaaaagctacatgtatatta tgatctactttatggaaaattacatgagtgtgtatgcagtaaaagtatgaaaagttggtgaccaaaatgttaatagt ggttatcttatttcagtggaattt-3`
Embodiment 2：The preparation of 5 polymorphism kits of diabetes
It is directed to 5 polymorphic sites respectively, using the wild type sense primer designed in embodiment 1, saltant type upstream is drawn Object and common downstream primer are synthesized, while I dyestuffs of SYBR Green being selected to be dyed, which is that one kind is incorporated into The dyestuff for having green excitation wavelength in dsDNA minor grooves region, under free state, SYBR Green I send out faint Fluorescence, but once combined with double-stranded DNA, fluorescence greatly enhances, therefore the fluorescence intensity and double-stranded DNA of SYBR Green I Quantity it is related, therefore double-stranded DNA quantity existing for PCR system can be detected according to fluorescence signal.
Kit for detecting diabetes risk site, inside are right including 10 kinds of PCR reaction solutions, positive control, feminine gender According to product, colour reagent.
There are the 10 kinds of PCR reaction solutions, each reaction solution to be respectively in the present invention：
(1) detection UST2 gene rs228648 site wild type reaction solution 1-1：Contain SEQ ID NO：1、SEQ ID NO： 3 primer, dNTP, Taq enzyme, Fast masterpremix and DEPC water.Saltant type reaction solution 1-2：Contain SEQ ID NO：2、 SEQ ID NO：3 primer, dNTP, Taq enzyme, Fast master premix and DEPC water.
(2) detection PAX4 gene rs114202595 site wild type reaction solution 2-1：Contain SEQ ID NO：4、SEQ ID NO：6 primer, dNTP, Taq enzyme, Fast masterpremix and DEPC water.Saltant type reaction solution 2-2：Contain SEQ ID NO：5、SEQ ID NO：6 primer, dNTP, Taq enzyme, Fastmasterpremix and DEPC water.
(3) detection CDKAL1 gene rs7754840 site wild type reaction solution 3-1：Contain SEQ ID NO：7、SEQ ID NO：9 primer, dNTP, Taq enzyme, Fast masterpremix and DEPC water.Saltant type reaction solution 3-2：Contain SEQ ID NO：8、SEQ ID NO：9 primer, dNTP, Taq enzyme, Fastmasterpremix and DEPC water.
(4) detection CDKAL1 gene rs7756992 site wild type reaction solution 4-1：Contain SEQ ID NO：10、SEQ ID NO：12 primer, dNTP, Taq enzyme, Fast masterpremix and DEPC water.Saltant type reaction solution 4-2：Contain SEQ ID NO：11、SEQ ID NO：12 primer, dNTP, Taq enzyme, Fastmasterpremix and DEPC water.
(5) detection STAT4 gene rs7574865 site wild type reaction solution 5-1：Contain SEQ ID NO：13、SEQ ID NO：15 primer, dNTP, Taq enzyme, Fast masterpremix and DEPC water.Saltant type reaction solution 5-2：Contain SEQ ID NO：14、SEQ ID NO：15 primer, dNTP, Taq enzyme, Fastmasterpremix and DEPC water.
The wild primers pair and mutant primers pair designed using the present invention, the DNA profiling to detecting sample carry out glimmering Fluorescent Quantitative PCR augmentation detection, using wild type reaction system and saltant type reaction system, each PCR reaction solution by correspondence Upstream and downstream primer, dNTP, Taq enzyme, Fast masterpremix and DEPC water form 25 μ L reaction systems, each PCR reaction solution Configuration it is as shown in table 1.
Table 1.PCR reaction solutions configure
Further include a kind of positive control and a kind of negative control in the kit of the present embodiment.Positive control is positive matter Control, it is whether effective for ingredient in detection architecture.Positive control by containing SEQ ID NO respectively：16 to SEQ ID NO：25 sequences 10 kinds of recombinant plasmids of row form (by the synthesis of Shanghai life work), such as by with SEQ ID NO：The positive control template of 16 sequences and Carrier pUC57 constitutes the sites UST2 gene rs228648 wild-type positive control plasmid, by with SEQ ID NO：17 sequences Positive control template and carrier pUC57 constitute UST2 gene rs228648 site mutation type positive control plasmids.10 kinds of plasmids with 1：1 mixing, respective final concentration 1 × 103copies/μL；Whether negative control is negative Quality Control, be contaminated for detection architecture, Negative control is ddH2O。
Embodiment 3：5 polymorphic sites of diabetes are detected with kit prepared by the present invention
In order to measure genomic DNA, can using the substantially any biological sample containing genomic DNA, (such as impure is red Cell).For example, but not limit, genomic DNA can easily be obtained from blood, sperm, saliva, tear, urine, excreta, Sweat, Stomatocyte, skin or hair.In order to be measured using DNA, target nucleic acid must be obtained from expressing the cell or group of the target sequence It knits.
The measuring samples of the present embodiment are 10 buccal swabs collected from Wuhan Liang Pei gene biologicals Science and Technology Ltd. Middle extraction DNA, and it is quantified, the template as PCR detections.The main operational steps for extracting DNA refer to day with company Buccal swab DNA extraction kit, extract sample genomic dna.The genomic DNA of extraction is calculated through ultraviolet specrophotometer Its purity and concentration quantitative, 10 DNA samples are diluted to 5ng/ μ L in the present embodiment.
Detection method is as follows：
(1) 10 genomic DNA Sample Dilutions to 5ng/ μ L are placed in for use on ice；
(2) positive control, negative control object, 10 kinds of PCR reaction solutions are taken out from kit, shake mixing after defrosting, from Heart 30s is placed in for use on ice；
(3) according to 23 μ L of each PCR reaction volumes, it is multiplied by (required reaction tube number+1), calculates the amount of reagent, is added sterile In centrifuge tube, dispensed into eight connecting legs after vibrating mixing, per 23 μ L of hole；
(4) negative control, sample to be tested, positive control are separately added into 10 kinds of PCR reaction solutions, per hole template DNA2 μ L；
(5) PCR response procedures：95℃10min；95 DEG C of 15s, 60 DEG C of 40s, 45 cycles, 60 DEG C of collection fluorescence signals；95 DEG C 15s, 60 DEG C of 1min, 95 DEG C of 30s, 60 DEG C of 15s.
(6) interpretation of result：Threshold line is adjusted to background signal and negative amplification curve, further according to quantitative fluorescent PCR Instrument obtains positive control, the mutation Ct values and wild type Ct values of negative control and sample.Follow the steps below judgement：
1. first determine whether the Ct values of negative control and positive control, saltant type Ct and wild type the Ct value of negative control >= 40, show pollution-free in operating process, otherwise needs to re-start experiment；The saltant type Ct and wild type Ct values of positive control are equal ≤ 35, show that kit of the present invention is effective, otherwise needs to buy kit again and be verified.
2. the Δ Ct values of this step judgement sample could be carried out after meeting step 1., calculated according to following formula：
- 3≤Δ Ct=wild types Ct values-value≤3 saltant type Ct, are determined as heterozygous sample；
Δ Ct=saltant types Ct values-wild type Ct values ＞ 3, are determined as wild type sample；
Δ Ct=wild types Ct values-saltant type Ct values ＞ 3, are determined as saltant type sample；
Divide wild type and mutated genes sequence using the guiding regions ARMS, passes through the wild type and saltant type of reaction system The strong and weak difference of sybrgreen signals carrys out judging result.Pattern detection result judgement is shown in Table 2.
2. diabetes of table, 5 polymorphic site testing result judgements
It is detected using 10 sample genomic dnas of the method for the present invention pair, testing result such as the following table 3, table 4 and table 5, sample Amplification curve no longer all list herein, only list the amplification curve diagram of 1 representative sample, it is specific such as Fig. 1, figure 2, shown in Fig. 3, Fig. 4, Fig. 5, while 10 sample genomic dnas are subjected to sequencing detection using Sanger goldstandards, by the two Detectability be compared, the two testing result is consistent, and kit accuracy is high, and it is wide to be applicable in sample.
3 10 buccal swab fluorogenic quantitative detections of table and sanger sequencing results (rs228648, rs114202595)
4 10 buccal swab fluorogenic quantitative detections of table and sanger sequencing results (rs7754840, rs7756992)
5 10 buccal swab fluorogenic quantitative detections of table and sanger sequencing results (rs7574865)
The foregoing is only a preferred embodiment of the present invention, but scope of protection of the present invention is not limited thereto, Any one skilled in the art in the technical scope disclosed by the present invention, according to the technique and scheme of the present invention and its Inventive concept is subject to equivalent substitution or change, should be covered by the protection scope of the present invention.
Sequence table
<110>Good training gene biological science and technology（Wuhan）Co., Ltd
<120>Nucleic acid sequence, kit and its detection method for detecting diabetes risk site
<160> 25
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
tgctcggact cataaatcct t 21
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
tgctcggact cataaatcct c 21
<210> 3
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ataaatctgg caaaagaggc aa 22
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
ctggtcctcc tgtaatgctc a 21
<210> 5
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
ctggtcctcc tgtaatgctc g 21
<210> 6
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
gatgggaaaa aggatattaa ggg 23
<210> 7
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
gggaagaagt agtaatgttg gaatc 25
<210> 8
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
gggaagaagt agtaatgttg gagag 25
<210> 9
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
taactcaatg ctgttcatca ggc 23
<210> 10
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
ttcccccctg tattttagtt cta 23
<210> 11
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
tcccccctgt attttagttg tg 22
<210> 12
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
agaatccata atcccctctt gaa 23
<210> 13
<211> 28
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
ttccactgaa ataagataac cactactc 28
<210> 14
<211> 28
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
ttccactgaa ataagataac cactacta 28
<210> 15
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
atggaggtaa ggaaaaaaga agtg 24
<210> 16
<211> 117
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
tttataaatc tggcaaaaga ggcaacttac agcaataaat catgaattaa aggaaggctt 60
ggatatgagt tgaagtggcc aaagcaaaga gacatggatt tatgagtccg agcagaa 117
<210> 17
<211> 117
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
tttataaatc tggcaaaaga ggcaacttac agcaataaat catgaattaa aggaaggctt 60
ggatatgagt tgaagtggcc aaagcaaaga gacatggatt tatgagtccg agcagaa 117
<210> 18
<211> 135
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 18
ctggtcctcc tgtaatgccc acaggactcg gttgatggag gagacctggg agtgtcaggg 60
tgttgagtgg agagatggtg ctcagactca gggctatacc ctgaggatgt tgcccttaat 120
atcctttttc ccatc 135
<210> 19
<211> 135
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 19
ctggtcctcc tgtaatgccc gcaggactcg gttgatggag gagacctggg agtgtcaggg 60
tgttgagtgg agagatggtg ctcagactca gggctatacc ctgaggatgt tgcccttaat 120
atcctttttc ccatc 135
<210> 20
<211> 149
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 20
tggggaagaa gtagtaatgt tggaaacgtt gacttgatag aggattttgt aagatgagtg 60
aaaaagatct aaaaggacag tgatgtctct gttattgact gaggtatcct tggtctctag 120
aatagtgcct gatgaacagc attgagtta 149
<210> 21
<211> 149
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 21
tggggaagaa gtagtaatgt tggaaaggtt gacttgatag aggattttgt aagatgagtg 60
aaaaagatct aaaaggacag tgatgtctct gttattgact gaggtatcct tggtctctag 120
aatagtgcct gatgaacagc attgagtta 149
<210> 22
<211> 151
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 22
atattccccc ctgtatttta gttttagatc tacagttatg tagcaatgag ctcattatca 60
gtccttttgc tgaaatttcc ccagacctct cttggttgca tgaagctcat cctgttttat 120
ttagattctt caagagggga ttatggattc t 151
<210> 23
<211> 151
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 23
atattccccc ctgtatttta gttttggatc tacagttatg tagcaatgag ctcattatca 60
gtccttttgc tgaaatttcc ccagacctct cttggttgca tgaagctcat cctgttttat 120
ttagattctt caagagggga ttatggattc t 151
<210> 24
<211> 167
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 24
atggaggtaa ggaaaaaaga agtgggataa aaagaagttt gtaattaaaa agctacatgt 60
atattatgat ctactttatg gaaaattaca tgagtgtgta tgcagtaaaa gtatgaaaag 120
ttggtgacca aaatgtgaat agtggttatc ttatttcagt ggaattt 167
<210> 25
<211> 167
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 25
atggaggtaa ggaaaaaaga agtgggataa aaagaagttt gtaattaaaa agctacatgt 60
atattatgat ctactttatg gaaaattaca tgagtgtgta tgcagtaaaa gtatgaaaag 120
ttggtgacca aaatgttaat agtggttatc ttatttcagt ggaattt 167

Claims (10)

1. a kind of nucleic acid sequence combination for detecting diabetes risk site, which is characterized in that the nucleic acid sequence combination Including：
1) such as SEQ ID NO：The sites UST2 gene rs228648 wild type sense primer, such as SEQ of nucleotide sequence shown in 1 ID NO：The UST2 gene rs228648 site mutation type sense primers of nucleotide sequence shown in 2 and such as SEQ ID NO：Shown in 3 The general reverse primer of the two of nucleotide sequence；
2) such as SEQ ID NO：The sites the PAX4 gene rs114202595 wild type sense primer of nucleotide sequence shown in 4, such as SEQ ID NO：The PAX4 gene rs114202595 site mutation type sense primers of nucleotide sequence shown in 5 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 6；
3) such as SEQ ID NO：The sites the CDKAL1 gene rs7754840 wild type sense primer of nucleotide sequence shown in 7, such as SEQ ID NO：The CDKAL1 gene rs7754840 site mutation type sense primers of nucleotide sequence shown in 8 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 9；
4) such as SEQ ID NO：The sites the CDKAL1 gene rs7756992 wild type sense primer of nucleotide sequence shown in 10, such as SEQ ID NO：The CDKAL1 gene rs7756992 site mutation type sense primers of nucleotide sequence shown in 11 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 12；
5) such as SEQ ID NO：The sites the STAT4 gene rs7574865 wild type sense primer of nucleotide sequence shown in 13, such as SEQ ID NO：The STAT4 gene rs7574865 site mutation type sense primers of nucleotide sequence shown in 14 and such as SEQ ID NO：15 show the general reverse primer of the two of nucleotide sequence.
2. a kind of nucleic acid sequence combination for detecting diabetes risk site according to claim 1, which is characterized in that The nucleic acid sequence combination further includes wild-type positive control and the saltant type positive control of 5 polymorphic sites, wherein The wild-type positive control of the sites UST2 gene rs228648, UST2 gene rs228648 site mutation types positive control, PAX4 bases Because of the control of the sites rs114202595 wild-type positive, PAX4 gene rs114202595 site mutation types positive control, CDKAL1 The wild-type positive control of the sites gene rs7754840, CDKAL1 gene rs7754840 site mutation types positive control, CDKAL1 The wild-type positive control of the sites gene rs7756992, CDKAL1 gene rs7756992 site mutation types positive control, STAT4 bases Because of the control of the sites rs7574865 wild-type positive, STAT4 gene rs7574865 site mutation type positive control nucleotide sequences Successively such as SEQ ID NO：15~SEQ ID NO：Shown in 25.
3. a kind of nucleic acid sequence combination for detecting diabetes risk site according to claim 2, which is characterized in that The saltant type positive control of each polymorphic site includes corresponding polymorphic site saltant type positive template sequence, and the correspondence is more State property site mutation type positive template sequence is to be expanded by corresponding site saltant type sense primer and corresponding site common downstream primer Increase the PCR product.
4. a kind of nucleic acid sequence combination for detecting diabetes risk site according to claim 2, which is characterized in that The wild-type positive control of each polymorphic site includes corresponding polymorphic site wild-type positive template sequence, and the correspondence is more State property site wild-type positive template sequence is to be expanded by corresponding site wild type sense primer and corresponding site common downstream primer Increase the PCR product.
5. a kind of kit for detecting diabetes risk site, which is characterized in that the kit includes for detecting sugar The nucleic acid sequence combination in urine sick risk site, the nucleic acid sequence combination include：
1) such as SEQ ID NO：The sites UST2 gene rs228648 wild type sense primer, such as SEQ of nucleotide sequence shown in 1 ID NO：The UST2 gene rs228648 site mutation type sense primers of nucleotide sequence shown in 2 and such as SEQ ID NO：Shown in 3 The general reverse primer of the two of nucleotide sequence；
2) such as SEQ ID NO：The sites the PAX4 gene rs114202595 wild type sense primer of nucleotide sequence shown in 4, such as SEQ ID NO：The PAX4 gene rs114202595 site mutation type sense primers of nucleotide sequence shown in 5 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 6；
3) such as SEQ ID NO：The sites the CDKAL1 gene rs7754840 wild type sense primer of nucleotide sequence shown in 7, if any SEQ ID NO：The CDKAL1 gene rs7754840 site mutation type sense primers of nucleotide sequence shown in 8 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 9；
4) such as SEQ ID NO：The sites the CDKAL1 gene rs7756992 wild type sense primer of nucleotide sequence shown in 10, such as SEQ ID NO：The CDKAL1 gene rs7756992 site mutation type sense primers of nucleotide sequence shown in 11 and such as SEQ ID NO：The general reverse primer of the two of nucleotide sequence shown in 12；
5) such as SEQ ID NO：The sites the STAT4 gene rs7574865 wild type sense primer of nucleotide sequence shown in 13, such as SEQ ID NO：The STAT4 gene rs7574865 site mutation type sense primers of nucleotide sequence shown in 14 and such as SEQ ID NO：15 show the general reverse primer of the two of nucleotide sequence.
6. a kind of kit for detecting diabetes risk site according to claim 5, which is characterized in that the examination Agent box further include extracted from sample to be detected the sample processing reagent of DNA, PCR buffer solutions, archaeal dna polymerase, negative controls, At least one of positive reference substance, colour reagent, DEPC water reagent.
7. a kind of method of quick 5 polymorphic sites of detection diabetes, which is characterized in that this approach includes the following steps：
(1) genomic DNA of the sample from people is extracted；
(2) using the genomic DNA of sample as template, the open country of 5 polymorphic sites is carried out respectively using I dye methods of SYBRGreen The real-time fluorescent PCR amplification of raw type reaction system and jump reaction system；
(3) Data acquisition and issuance：Threshold line is adjusted to more than background signal and negative amplification line, real-time fluorescence PCR is passed through Instrument collecting signal calculates the Δ Ct values of the wild type reaction system and saltant type reaction system to determine the DNA of the sample Genotype.
8. a kind of method of quick 5 polymorphic sites of detection diabetes according to claim 7, which is characterized in that step Suddenly (2) include 10 groups of PCR reaction solutions, and the PCR reaction solution of the sites detection UST2 gene rs228648 wild type includes SEQ ID NO：1 and SEQ ID NO：The PCR reaction solution of 3 primer, detection UST2 gene rs228648 site mutation types includes SEQ ID NO：2 and SEQ ID NO：3 primer；The PCR reaction solution for detecting the sites PAX4 gene rs114202595 wild type includes SEQ ID NO：4 and SEQ ID NO：6 primer, the PCR reaction solution for detecting PAX4 gene rs114202595 site mutation types include SEQ ID NO：5 and SEQ ID NO：6 primer；Detect the PCR reaction solution packet of the sites CDKAL1 gene rs7754840 wild type Include SEQ ID NO：7 and SEQ ID NO：9 primer detects the PCR reaction solution of CDKAL1 gene rs7754840 site mutation types Including SEQ ID NO：8 and SEQ ID NO：9 primer；Detect the PCR reactions of the sites CDKAL1 gene rs7756992 wild type Liquid includes SEQ ID NO：10 and SEQ ID NO：12 primer detects the PCR of CDKAL1 gene rs7756992 site mutation types Reaction solution includes SEQ ID NO：11 and SEQ ID NO：12 primer；Detect the sites STAT4 gene rs7574865 wild type PCR reaction solution includes SEQ ID NO：13 and SEQ ID NO：15 primer detects STAT4 gene rs7574865 site mutations The PCR reaction solution of type includes SEQ ID NO：14 and SEQ ID NO：15 primer.
9. a kind of method of quick 5 polymorphic sites of detection diabetes according to claim 7, which is characterized in that institute Stating amplification step in step 2) includes：95℃10min；95 DEG C of 15s, 60 DEG C of 40s, 45 cycles, 60 DEG C of collection fluorescence signals；95 DEG C 15s.60 DEG C of 1min, 95 DEG C of 30s, 60 DEG C of 15s.
10. a kind of method of quick 5 polymorphic sites of detection diabetes according to claim 7, which is characterized in that institute State the genotype for determining the sample DNA in step 3) according to following criterion：
- 3≤Δ Ct=wild types Ct values-value≤3 saltant type Ct, are determined as heterozygous sample；
Δ Ct=saltant types Ct values-wild type Ct values ＞ 3, are determined as wild type sample；
Δ Ct=wild types Ct values-saltant type Ct values ＞ 3, are determined as saltant type sample.
CN201810298890.7A 2018-04-04 2018-04-04 Nucleic acid sequence, kit and its detection method for detecting diabetes risk site Pending CN108359728A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810298890.7A CN108359728A (en) 2018-04-04 2018-04-04 Nucleic acid sequence, kit and its detection method for detecting diabetes risk site

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810298890.7A CN108359728A (en) 2018-04-04 2018-04-04 Nucleic acid sequence, kit and its detection method for detecting diabetes risk site

Publications (1)

Publication Number Publication Date
CN108359728A true CN108359728A (en) 2018-08-03

Family

ID=63001662

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810298890.7A Pending CN108359728A (en) 2018-04-04 2018-04-04 Nucleic acid sequence, kit and its detection method for detecting diabetes risk site

Country Status (1)

Country Link
CN (1) CN108359728A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113249525A (en) * 2021-06-25 2021-08-13 山西大学 qRT-PCR method for identifying novel coronavirus Indian variety

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011004405A1 (en) * 2009-07-10 2011-01-13 Decode Genetics Ehf Genetic markers associated with risk of diabetes mellitus
CN102191337A (en) * 2011-06-09 2011-09-21 广州益善生物技术有限公司 Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene
WO2012109427A1 (en) * 2011-02-10 2012-08-16 Genqual Corporation Methods of prognosing and administering treatment for inflammatory disorders

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011004405A1 (en) * 2009-07-10 2011-01-13 Decode Genetics Ehf Genetic markers associated with risk of diabetes mellitus
WO2012109427A1 (en) * 2011-02-10 2012-08-16 Genqual Corporation Methods of prognosing and administering treatment for inflammatory disorders
CN102191337A (en) * 2011-06-09 2011-09-21 广州益善生物技术有限公司 Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHAOLIN LI等: "STAT4 rs7574865 polymorphism contributes to the risk of type 1 diabetes: a meta analysis", 《INT J CLIN EXP MED》 *
祝方等: "硬骨鱼紧张素Ⅱ基因多态性与中国人2型糖尿病遗传易感性的关系", 《中华医学杂志》 *
邓德耀等: "配对盒4基因Arg121Trg多态性与2型糖尿病的相关性", 《基础医学与临床》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113249525A (en) * 2021-06-25 2021-08-13 山西大学 qRT-PCR method for identifying novel coronavirus Indian variety

Similar Documents

Publication Publication Date Title
CN107058538B (en) Primer composition, kit composed of primer composition and application of kit
CN114085903B (en) Primer pair probe combination product for detecting mitochondria 3243A &amp; gtG mutation, kit and detection method thereof
CN104404164A (en) Hereditary deafness gene mutation detection kit
CN102776286B (en) Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation
CN111118138A (en) Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR
CN106834434B (en) Nucleic acid, kit and method for detecting COX-1, COX-2 and GPIIIa gene polymorphism
CN110699440A (en) Primer and method for detecting SNP (single nucleotide polymorphism) locus of gene related to metformin personalized medicine
CN104673891A (en) Detection method and kit for spinal muscular atrophy related gene mutation
CN108048565A (en) A kind of primer for detecting ApoE gene pleiomorphisms and its detection method and application
CN115948532A (en) SMA detection kit based on digital PCR technology
CN110846408A (en) Primer combination for detecting TTN gene mutation and application thereof
CN110846409A (en) Primer combination for detecting TNNI3K gene mutation and application thereof
CN1987462A (en) Probe for detecting matrilinear inheritance chondriosome deafness gene A1555G and its use
CN106755352A (en) Nucleic acid, kit and method for quick detection ABCB1 gene C 3435T polymorphisms
CN116445608B (en) Composition for detecting deafness-related gene mutation, kit and application
CN108359728A (en) Nucleic acid sequence, kit and its detection method for detecting diabetes risk site
CN104087672A (en) Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique
CN112143815B (en) Nucleic acid composition, kit and detection method for detecting fusion mutation of human FGFR2 gene
CN104087671A (en) Kit used for detecting number of human chromosomes 21
CN108359729A (en) Nucleic acid sequence, kit and its detection method for detecting risk of obesity site
CN112029851A (en) Method and kit for detecting gene polymorphism of clopidogrel medication and application of kit
CN111690736A (en) Warfarin medication gene detection kit and use method thereof
CN110951857A (en) Digital PCR-based noninvasive prenatal detection method and kit for trisomy 21, 18 and 13 syndromes of fetus
CN108676871A (en) Type-II diabetes diagnosis marker
CN114075598B (en) PCR detection kit for atrophic myotonic protein kinase gene CTG region and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20180803