CN108315475A - Rise's boot period cold tolerance gene qCT9.6X22Molecular labeling and application - Google Patents
Rise's boot period cold tolerance gene qCT9.6X22Molecular labeling and application Download PDFInfo
- Publication number
- CN108315475A CN108315475A CN201810409287.1A CN201810409287A CN108315475A CN 108315475 A CN108315475 A CN 108315475A CN 201810409287 A CN201810409287 A CN 201810409287A CN 108315475 A CN108315475 A CN 108315475A
- Authority
- CN
- China
- Prior art keywords
- cold
- rise
- seq
- primer pair
- boot
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 47
- 238000002372 labelling Methods 0.000 title claims abstract description 15
- 235000007164 Oryza sativa Nutrition 0.000 claims abstract description 24
- 235000009566 rice Nutrition 0.000 claims abstract description 24
- 238000009395 breeding Methods 0.000 claims abstract description 18
- 230000001488 breeding effect Effects 0.000 claims abstract description 18
- 239000000463 material Substances 0.000 claims abstract description 13
- 238000000034 method Methods 0.000 claims abstract description 12
- 239000008280 blood Substances 0.000 claims abstract description 5
- 210000004369 blood Anatomy 0.000 claims abstract description 5
- 241000209094 Oryza Species 0.000 claims description 23
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 238000001514 detection method Methods 0.000 claims description 3
- 239000012634 fragment Substances 0.000 claims description 3
- 239000002773 nucleotide Substances 0.000 claims description 3
- 125000003729 nucleotide group Chemical group 0.000 claims description 3
- 238000004519 manufacturing process Methods 0.000 claims description 2
- 108020004414 DNA Proteins 0.000 abstract description 11
- 230000008569 process Effects 0.000 abstract description 3
- 108091028043 Nucleic acid sequence Proteins 0.000 abstract description 2
- 230000009466 transformation Effects 0.000 abstract description 2
- 240000007594 Oryza sativa Species 0.000 abstract 1
- 241000196324 Embryophyta Species 0.000 description 20
- 239000003550 marker Substances 0.000 description 7
- 108700028369 Alleles Proteins 0.000 description 6
- 230000002068 genetic effect Effects 0.000 description 6
- 230000000694 effects Effects 0.000 description 5
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 4
- 230000002349 favourable effect Effects 0.000 description 4
- 238000000926 separation method Methods 0.000 description 4
- 240000008467 Oryza sativa Japonica Group Species 0.000 description 3
- 230000008645 cold stress Effects 0.000 description 3
- 230000004069 differentiation Effects 0.000 description 3
- 238000001962 electrophoresis Methods 0.000 description 3
- 238000005086 pumping Methods 0.000 description 3
- 238000012216 screening Methods 0.000 description 3
- 230000035882 stress Effects 0.000 description 3
- 238000012795 verification Methods 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- 239000002349 well water Substances 0.000 description 3
- 235000020681 well water Nutrition 0.000 description 3
- 238000007400 DNA extraction Methods 0.000 description 2
- 230000036579 abiotic stress Effects 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 230000008901 benefit Effects 0.000 description 2
- 239000007795 chemical reaction product Substances 0.000 description 2
- 101150006264 ctb-1 gene Proteins 0.000 description 2
- 230000007850 degeneration Effects 0.000 description 2
- 238000004043 dyeing Methods 0.000 description 2
- 238000011156 evaluation Methods 0.000 description 2
- 238000009396 hybridization Methods 0.000 description 2
- 238000013507 mapping Methods 0.000 description 2
- 229910052757 nitrogen Inorganic materials 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 229920002401 polyacrylamide Polymers 0.000 description 2
- 239000000047 product Substances 0.000 description 2
- 230000000306 recurrent effect Effects 0.000 description 2
- 150000003839 salts Chemical class 0.000 description 2
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 235000013339 cereals Nutrition 0.000 description 1
- 230000035601 cold sensitivity Effects 0.000 description 1
- 238000011960 computer-aided design Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 230000008641 drought stress Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 230000035784 germination Effects 0.000 description 1
- 238000003306 harvesting Methods 0.000 description 1
- 239000000017 hydrogel Substances 0.000 description 1
- 230000008676 import Effects 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 239000003147 molecular marker Substances 0.000 description 1
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 description 1
- 229920000058 polyacrylate Polymers 0.000 description 1
- 238000006116 polymerization reaction Methods 0.000 description 1
- 238000005215 recombination Methods 0.000 description 1
- 230000006798 recombination Effects 0.000 description 1
- 230000003252 repetitive effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses Rise's boot period cold tolerance gene qCT9.6X22Molecular labeling, for amplified by masterplate of the breeding material genomic DNA with rice variety X22 blood relationships using primer pair RM160 come 85bp nucleotide sequences；The forward primer sequence of primer pair RM160 is as shown in SEQ ID No.1, and the reverse primer sequences of primer pair RM160 are as shown in SEQ ID No.2.The molecular labeling of the present invention can be used for the genotype selection of boot stage breeding population, effectively differentiate the cold-resistant individual with the gene, convenient for timely hybridizing transformation, accelerate breeding process.
Description
Technical field
The invention belongs to molecular biology fields, and in particular to a kind of Rise's boot period cold tolerance gene qCT9.6X22Molecule
Label.
Background technology
It is one of the most important abiotic stress factor for causing Rice Yield Loss Caused, limitation Rice Cropping to be distributed to damage to plants caused by sudden drop in temperature.When
Before, frequent generation is damaged to plants caused by sudden drop in temperature, in Chinese up to 300-500 ten thousand tons of the annual loss caused by damaging to plants caused by sudden drop in temperature.Molecule genetics research shows
Rice is to the quantitative character that the resistance of low temperature is by controlled by multiple genes.Compared with the periods such as Germination period, seedling stage, rice is pregnant
Ear period (reproduction period) cold resistance is extremely important.So far, it is identified out to have 108 cold-resistant QTL of boot stage (reproduction period), can solve
The phenotypic variation rate released is from 0.8%to 37.8%.In this 108 QTL, only qCT8, qCTB7, qCTB3, qCT-3-2,
By finely positioning, two genes of only Ctb1 and CTB4a are cloned the minority such as qLTB3 and qCTB10-2.It is above-mentioned to promote rice pregnant
There is ear period the allele of cold resistance to be mainly derived from natural variation, and the positioning of these genes and clone contribute to us to understand
Rice is very deficient for the boot stage cold-resistant excellent genes that utilize to low-temperature resistance hereditary basis, but at present.Therefore, it excavates excellent
Different cold-resistant allele is of great significance.
Come in the past few decades, the linkage mapping based on parents this Derived Populations is the common strategy of gene location.But parents
The QTL that this Derived Populations navigates to, can only compare the allele effect between 2 parents of each gene loci, it is fubaritic go out
More preferably favorable allels present in germ plasm resource, the mutual disconnection of what is more important target group and breeding population,
Cause the QTL navigated in target group since there are Genetic Background Effects, is difficult application in practical breeding population.In recent years
Come, the height that is genetically mutually related is built using multiple parents and hands over system (multi-parents advanced for mutual
Generation inter-cross, MAGIC) group and different cultivars import the recombination selfing of same improved seeds background constructing
Be (Nested association mapping, NAM) or Backcross introgression system (Backcross introgression line,
BIL there are more and more application examples in) group in terms of QTL positioning and beneficial gene positioning.Multi-parent strain group overcomes parents
In-group can not excavate the defect of favorable allels, and can compare QTL different genetic backgrounds expression, simultaneously
It can preferably solve the problems, such as that QTL positioning disconnects with breeding population.
Carry out molecular genetic using extensive backcrossing strategy and be combined with molecular breeding study be this seminar advantage it
One.By the strategy, the germ plasm resource of separate sources is imported into improved seeds background by us, in conjunction with to abiotic stress such as
The stress such as drought, salt, cold cultivate degeneration-resistant extreme selection introgressive line group, and the QTL for degeneration-resistant objective trait is positioned.It is basic herein
On, according to target selection character phenotype and the QTL favorable allels information carried, carries out the polymerization of molecular labeling Computer Aided Design and educate
Kind, polymerizeing for different anti-drought genes, resistant gene of salt, resistance to low nitrogen gene and drought resisting and resistance to low nitrogen gene is realized, a batch is formulated out
The inverse rice germplasm material in the resistance to abiotic border of difference.Meanwhile it developing and utilizing the multiple extreme of the same objective trait of same background
Selection introgressive line group combines the method for inclined separation detection objective trait QTL, greatly reduces false positive, improves the inspection of QTL
Survey efficiency and reliability.
Invention content
The technical problems to be solved by the invention are：A kind of molecular labeling of Rise's boot period cold tolerance gene is provided.
The technical scheme is that：Rise's boot period cold tolerance gene qCT9.6X22Molecular labeling, to use primer pair
RM160 amplifies the 85bp nucleotide sequences come by masterplate of the breeding material genomic DNA with rice variety X22 blood relationships；
The forward primer sequence of primer pair RM160 is：Agctagcagctatagcttagctggagatcg (shown in SEQ ID No.1),
The reverse primer sequences of primer pair RM160 are：Tctcatcgccatgcgaggcctc (shown in SEQ ID No.2).
Rise's boot period cold tolerance gene qCT9.6X22Molecular labeling specific primer pair, the specific primer is to forward direction
Primer sequence is as shown in SEQ ID No.1, and reverse primer sequences are as shown in SEQ ID No.2.
Rise's boot period cold tolerance gene qCT9.6X22Molecular labeling specific primer to screening Rise's boot period it is resistance to
Cold gene qCT9.6X22On application.
Utilize Rise's boot period cold tolerance gene qCT9.6X22Molecular markers for identification, the method for breeding rice, using primer
PCR amplification is carried out by masterplate of the breeding material genomic DNA with rice variety X22 blood relationships to RM160, and detects amplification production
Object carrys out 85bp nucleotide fragments if can amplify, and there are Rise's boot period cold tolerance genes for the breeding material of Mark Detection
qCT9.6X22；The forward primer sequence of primer pair RM160 is as shown in SEQ ID No.1, the reverse primer sequences of primer pair RM160
As shown in SEQ ID No.2.
The present invention super excellent No. 1 using North Japonica Rice kind is recurrent parent, the Backcross introgression system prepared with 5 donor kinds
Random population is verified through boot stage cold-resistant screening and offspring, obtains cold-resistant introgressive line group, and binding molecule is marked in rice the 9th
The cold tolerance gene qCT9.6 of boot stage expression is navigated on chromosomeX22, identify with the PCR's of the cold tolerance gene close linkage
Applied economy phenotypic marker RM160 can effectively carry out the cold-resistant molecule assisted selection of Rise's boot period using it and study.
Compared with prior art, the invention has the advantages that：
1, the present invention identifies the boot stage cold-resistant new gene (qCT9.6 on the 9th chromosomeX22) and base can be carried out to it
The codominant marker differentiated by type.With influence cold tolerance gene qCT8, qCTB7, qCTB3, the qCT- reported at present
The genes such as 3-2, qLTB3, qCTB10-2, Ctb1 and CTB4a are different, qCT9.6X22It is derived from the rice variety X22's of Vietnam
The new gene site of one control Rise's boot period cold resistance is improved Rise's boot period cold resistance for molecular marker assisted selection and is carried
Resistance gene is supplied.
2, the screening marked by new gene can obtain the breeding for stress tolerance material of Cold Tolerance at Booting Stage raising.
3, molecular labeling of the invention can be used for the genotype selection of boot stage breeding population, effectively differentiates and carries the base
The cold-resistant individual of cause accelerates breeding process convenient for timely hybridizing transformation.
Description of the drawings
Informative populations of the Fig. 1 for boot stage cold-resistant QTL positioning and verification；
The cold-resistant introgressive line CT5 of backcross progeny of the super excellent No. 1/X22 of Fig. 2 (only carries qCT9.6X221 cold tolerance gene) with it is cold
The F of sensitive introgressive line CT12 (without any cold tolerance gene) hybridization2Pcr amplification product of the group through SSR marker RM160 exists
(1-37 is the F randomly selected to the banding pattern collection of illustrative plates of 5% polyacrylamide gel electrophoresis with the cold-resistant sex expression of corresponding single plant2Dai Dan
Strain；M is DNA Ladder；CT12 is cold sensitive introgressive line；CT5 is cold-resistant introgressive line；A is 130bp, b 85bp).
Specific implementation mode
Embodiment 1
(1) cold-resistant QTL positioning
1. the structure of material to be tested and target group
First to screen 3 rice variety X22, Doddi, rich short account for and 2 japonica rice variety Chhomrong, former No. 7 points of round-grained rice
Not super excellent No. 1 of the japonica rice not cold-resistant with northern China high yield and high quality hybridize, be returned and simple grain pass selfing, build 5 BC2F4At random
Introgressive line group.In rice institute of academy of agricultural sciences of Jilin Province, 450 BC are planted per group within 20082F4Single plant is used in panicle primordium dif ferentiation stage
19 DEG C of underground well waters of 20cm depths are irrigated 30 days, are irrigated until all fringes pumping restores normal water temperature after being fully drawn out, right after ripe
It is 24.8% according to super excellent No. 1 setting percentage, selects single plant of the setting percentage higher than 50% to harvest, obtain 162 plants of boot stage cold-resistant single plants
(Fig. 1).162 cold-resistant single plant kinds were identified that cold resistance, control were super excellent at strain under the conditions of same cold Stress treatment in 2009
No. 1 setting percentage is 35.1%, is selected in setting percentage in 132 plants of 40% or more cold-resistant single plant.2010 by 132 cold-resistant single plant kinds at
Strain, repetitive identified cold resistance under the conditions of same cold Stress treatment, it is cold-resistant that finishing screen selects 5 familys total 84 boot stages
Strain constitutes selection and use group (table 1).
15 selection and use Canopy structure information of table and cold resistance (setting percentage under cold stress) performance
2. genotype identification
With reference to the DNA extraction method of (2000) Temnykh etc., genomic DNA is extracted respectively to each single plant.With donor parent
This has genotype of the polymorphic SSR primers respectively to different cold-resistant strains and random population strain between super excellent No. 1 of recurrent parent
It is identified, the average polymorphic SSR primers of 5 groups are 113.Reaction product electrophoresis on 5% non-denaturing polyacrylamide,
It is read tape with genefinder dyeings.The mark position and genetic distance of each group are with reference to Cornell SSR maps
(Grammene,http://www.gramene.org), label covering gene group size from the 1 of super excellent No. 1/former round-grained rice 7,
The 1649.8cM of 125.0cM to super excellent No. 1/Chhomrong are differed, the average genetic between adjacent marker from 15.2cM to
23.7cM differ.
3. separation analyzing and positioning QTL partially
Since 84 strains are made of different 5 different familys, polymorphism mark has differences between different familys, therefore I
Developed the consistent genetic linkage maps of label first, in accordance with the method for Cui etc. (2015).And then using Cui etc.
(2015) what is provided is located separately the positioning that method carries out cold-resistant QTL partially.Using Wald values be 22.2 (P≤0.05) as judgement
The standard of QTL presence or absence.
5 familys are total to navigate to 17 boot stage cold-resistant QTL, including 3 that super excellent No. 1/X22 crowd surveillances arrive, surpasses
Detect 2 of excellent No. 1/former round-grained rice 7, super excellent No. 1/it is rich it is short account for 11 detected, super excellent No. 1/Chhomrong is detected
2 and super excellent No. 1/Doddi 4 (tables 2) detected.Wherein, qCT1.3, qCT6.7 and qCT9.6 are detected in 2 groups
It measures, qCT6.5 is detected (table 2) in 3 groups.QCT9.6 is that 1 larger main effect of phenotypic effect that new definition arrives is resistance to
Cold QTL, with RM160 close linkages, allele of the site from X22 improves Cold Tolerance at Booting Stage.
Table 2 navigates to influence boot stage cold-resistant main effect QTL using the single and inclined separation method of joint
1When P≤0.05 and 0.01, Wald values are respectively 22.2 and 28.0.A：X22, B：Former round-grained rice 7, C：It is rich it is short account for, D：
Chhomrong, E：Doddi.
(2) qCT9.6X22Verification
1. material to be tested
Utilize the original super excellent No. 1/X22 high generations backcrossing BC without Stress treatment2F460 strains of random population are used
In qCT9.6 cold tolerance gene of the verification from X22.
2. genotype identification
The genomic DNA of the super excellent random strains of No. 1/X22 is extracted using conventional CTAB methods.Closely connect using with qCT9.6
(forward primer sequence is agctagcagctatagcttagctggagatcg to the RM160 primers of lock, and reverse primer sequences are：
Tctcatcgccatgcgaggcctc the genotype of strain) is identified.It is expanded using the Standard PCR operating process of 20 μ l systems different
The template DNA of strain carries out the separation of PCR product with 5% polyacrylate hydrogel electrophoresis.
3. boot stage cold-resistant phenotypic assessment
60 BC are planted in rice institute of academy of agricultural sciences of Jilin Province, group within 20102F4Strain, in panicle primordium dif ferentiation stage 20cm depths
19 DEG C of underground well waters irrigate 30 days, irrigated until all fringes pumping restores normal water temperature after being fully drawn out, the knot after statistics is ripe
Real rate, using strain setting percentage as evaluation index.
3. One marker analysis
The genotype represented by amplified band is marked according to the RM160 of different strains, by 60 strains of each family point
At two groups, one group is that 13 strains carry super excellent No. 1 homozygous genotype, and average setting percentage is 3.2%, and another group is 16 strains
With donor X22 homozygous genotypes, average setting percentage is 11.2%, and cold lower two groups of the average strain setting percentage difference of drought stress reaches
To 8.0%, difference reaches the level of signifiance, and resistance favorable allels come from donor parents.This shows that qCT9.6 is one true
Existing boot stage cold-resistant QTL, at the same also indicate that RM160 really with qCT9.6 close linkages.
Table 3 utilizes super excellent No. 1/X22BC2F4Random population verifies boot stage cold-resistant QTL (qCT9.6)
(3) compliance test result cold-resistant with the molecular labeling RM160 assisted Selections of qC9.6 close linkages is utilized
1. material to be tested
Using the cold-resistant introgressive line CT5 of super excellent No. 1 background, qCT9.6 is only carriedX221 cold-resistant QTL, with super excellent No. 1
The cold sensitivity introgressive line CT12 (without any cold-resistant QTL, qCT9.6 allele is identical as super excellent No. 1) of background hybridizes, structure
240 plants of F2Segregating population is material to be tested.
2.DNA extractions, PCR amplification and gel electrophoresis
With reference to the extracting method and PCR amplification method of strain genomic DNA in (one), the genomic DNA of 240 plants of extraction is simultaneously
PCR amplification is carried out using the close linkage label RM160 of qCT9.6 genes, reaction product is on 5% non-denaturing polyacrylamide
Electrophoresis is read tape with genefinder dyeings.
3. boot stage cold-resistant phenotypic assessment
In rice institute of academy of agricultural sciences of Jilin Province, 240 F are planted within 20112Group, in panicle primordium dif ferentiation stage with 19 DEG C of 20cm depths
Underground well water is irrigated 30 days, is irrigated until all fringes pumping restores normal water temperature after being fully drawn out, the setting percentage after statistics is ripe, with
Strain setting percentage is as evaluation index.
4. One marker analysis
The genotype represented by amplified band is marked according to the RM160 of different single plants, the homozygosis of X22 banding patterns is carried in group
54 plants of genotype individuals, average setting percentage are 16.6%, luffing 10.7%-19.2%；Carry the homozygosis of super excellent No. 1 banding pattern
58 plants of genotype individuals, average setting percentage are 5.8%, luffing 3.3%-9.6%；128 plants of heterozygous genotypes individual, it is average
Setting percentage is 14.8%, luffing 12.4%-18.9%.Show to go out according to RM160 primer amplifications identical with X22 sizes pure
Conjunction or hybrid fragments can speculate that the single plant carries qCT9.6X22Cold-resistant allele, it is cold-resistant to show as boot stage, conversely, then
Not cold-resistant (Fig. 2).Table 4 is the genotype and cold resistance (setting percentage) of single plant corresponding with Fig. 2, is shown through M160 marker gene
Type identification can be very good to differentiate qCT9.6 genotype, predict the phenotype of qCT9.6 genes.Therefore, with qCT9.6 close linkages
Label RM160 may be directly applied to the cold-resistant molecule assisted selection of Rise's boot period.
Table 4 super excellent No. 1/X22 the cold-resistant introgressive line CT5 of backcross progeny (only carry qCT9.6X221 cold tolerance gene) with it is cold
The F of sensitive introgressive line CT12 (without any cold tolerance gene) hybridization2The labeled RM160 auxiliary identification different genotype of group
The cold resistance (setting percentage) of body shows
Sequence table
<110>Applicant's title
<120>The molecular labeling of Rise's boot period cold tolerance gene qCT9.6X22 and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
agctagcagc tatagcttag ctggagatcg 30
<210> 2
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
tctcatcgcc atgcgaggcc tc 22
Claims (4)
1. Rise's boot period cold tolerance gene qCT9.6X22Molecular labeling, which is characterized in that use primer pair RM160 to carry
The breeding material genomic DNA of rice variety X22 blood relationships amplifies the nucleotide sequence of the 85bp come for masterplate；Primer pair
The forward primer sequence of RM160 is as shown in SEQ ID No.1, the reverse primer sequences such as SEQ ID No.2 institutes of primer pair RM160
Show.
2. Rise's boot period cold tolerance gene qCT9.6 according to claim 1X22Molecular labeling specific primer pair,
It is characterized in that, the specific primer to forward primer sequence as shown in SEQ ID No.1, reverse primer sequences such as SEQ ID
Shown in No.2.
3. Rise's boot period cold tolerance gene qCT9.6 according to claim 2X22Molecular labeling specific primer to
Screen Rise's boot period cold tolerance gene qCT9.6X22On application.
4. utilizing Rise's boot period cold tolerance gene qCT9.6X22Molecular markers for identification, the method for breeding rice, which is characterized in that
It uses primer pair RM160 to carry out PCR amplification by masterplate of the breeding material genomic DNA with rice variety X22 blood relationships, and examines
Amplified production is surveyed, carrys out 85bp nucleotide fragments if can amplify, that there are Rise's boot periods is resistance to for the breeding material of Mark Detection
Cold gene qCT9.6X22；The forward primer sequence of primer pair RM160 as shown in SEQ ID No.1, draw by the reversed of primer pair RM160
Object sequence is as shown in SEQ ID No.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810409287.1A CN108315475A (en) | 2018-05-02 | 2018-05-02 | Rise's boot period cold tolerance gene qCT9.6X22Molecular labeling and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810409287.1A CN108315475A (en) | 2018-05-02 | 2018-05-02 | Rise's boot period cold tolerance gene qCT9.6X22Molecular labeling and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108315475A true CN108315475A (en) | 2018-07-24 |
Family
ID=62895531
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810409287.1A Pending CN108315475A (en) | 2018-05-02 | 2018-05-02 | Rise's boot period cold tolerance gene qCT9.6X22Molecular labeling and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108315475A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109251996A (en) * | 2018-11-12 | 2019-01-22 | 上海市农业科学院 | Detect dCAPS label and the application of the low temperature resistant gene C OLD1 genotype of rice |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040123343A1 (en) * | 2000-04-19 | 2004-06-24 | La Rosa Thomas J. | Rice nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
| CN103866026A (en) * | 2013-05-07 | 2014-06-18 | 广西大学 | Rice cold-resistant major gene identification method and special primer thereof |
| CN104611442A (en) * | 2015-02-05 | 2015-05-13 | 宁夏农林科学院 | Primer composition for identifying Ningxia rice varieties and application of primer composition |
| CN105505922A (en) * | 2015-12-16 | 2016-04-20 | 中农常乐（深圳）生物育种技术有限公司 | Cold-tolerance gene qCT-3-2HHZ for rice booting stage stable expression and molecular marking method thereof |
-
2018
- 2018-05-02 CN CN201810409287.1A patent/CN108315475A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040123343A1 (en) * | 2000-04-19 | 2004-06-24 | La Rosa Thomas J. | Rice nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
| CN103866026A (en) * | 2013-05-07 | 2014-06-18 | 广西大学 | Rice cold-resistant major gene identification method and special primer thereof |
| CN104611442A (en) * | 2015-02-05 | 2015-05-13 | 宁夏农林科学院 | Primer composition for identifying Ningxia rice varieties and application of primer composition |
| CN105505922A (en) * | 2015-12-16 | 2016-04-20 | 中农常乐（深圳）生物育种技术有限公司 | Cold-tolerance gene qCT-3-2HHZ for rice booting stage stable expression and molecular marking method thereof |
Non-Patent Citations (3)
| Title |
|---|
| DI CUI等: "Genetic structure and association mapping of cold tolerance in improved japonica rice germplasm at the booting stage", 《EUPHYTICA》 * |
| 刘化龙: "寒地粳稻品种骨干亲本遗传演变及耐冷性研究", 《中国博士学位论文全文数据库 农业科技辑》 * |
| 詹庆才: "利用水稻F_2分离群体进行苗期耐冷性数量性状基因定位", 《湖南农业大学学报(自然科学版)》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109251996A (en) * | 2018-11-12 | 2019-01-22 | 上海市农业科学院 | Detect dCAPS label and the application of the low temperature resistant gene C OLD1 genotype of rice |
| CN109251996B (en) * | 2018-11-12 | 2022-03-25 | 上海市农业科学院 | dCAPS marker for detecting low temperature resistant gene COLD1 genotype of rice and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110117673A (en) | The molecular labeling of the short bar character site of cabbage type rape and its application | |
| CN104313016B (en) | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance | |
| CN107475254A (en) | A kind of eary maturity of rice allele, its molecular labeling and application | |
| CN110684858A (en) | Molecular marker of rice long and thin grain type gene and application thereof | |
| CN102586239B (en) | Co-segregation SSR (Simple Sequence Repeat) codominant molecular marker of onion male sterility gene Ms site and application thereof | |
| CN111341384A (en) | Quantitative Trait Locus (QTL) sites of soybean and screening method thereof | |
| CN109486994B (en) | Molecular marker primer for controlling maize ear length QTL (quantitative trait locus) and application | |
| CN112048568B (en) | Acquisition of corn seedling stage stain-resistant main effect QTL qWT7.02 and development and application of molecular marker primer thereof | |
| CN110607382A (en) | SNP molecular marker of single ring weight major gene derived from Xinluzao 24 | |
| CN108315475A (en) | Rise's boot period cold tolerance gene qCT9.6X22Molecular labeling and application | |
| CN108570515A (en) | Rise's boot period cold tolerance gene qCT6.7DODMolecular labeling and application | |
| Ford et al. | Lentil | |
| US10314253B2 (en) | Methods and compositions for watermelon sex expression | |
| CN113846177B (en) | SNP molecular marker for number of secondary emulsion tubes of rubber tree and application of SNP molecular marker | |
| CN114875168A (en) | InDel marker for identifying existence of granuloma on surface of bitter gourd fruit as well as detection primer and application thereof | |
| Chahota et al. | Conventional genetic manipulations | |
| CN108315474A (en) | Rise's boot period cold tolerance gene qCT3.12FAZMolecular labeling and application | |
| CN104032018A (en) | SNP (single nucleotide polymorphism) molecular marker primers for pear peel smoothness main effect QTL (quantitative trait locus) site and application thereof | |
| Irzykowska et al. | Interval mapping of QTLs controlling some morphological traits in pea | |
| CN109486996B (en) | Recombinant nucleotide segment Rec78801 and Rec78802 and its detection primer and application | |
| CN111944920A (en) | InDel marker closely linked with melon epidemic disease resistance gene and application thereof | |
| CN106244716B (en) | The molecular labeling of the high vigor gene qSE3 of the strong salt tolerant of rice and its application | |
| CN110512019A (en) | A kind of molecular labeling and its application with cotton fiber length main effect QTL linkage | |
| CN108342506A (en) | The molecular labeling of cabbage type rape MI CMS system restoring genes Rfm and its application | |
| CN106148331B (en) | Molecular labeling and its application with Plant Height in Wheat main effect QTL compact linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20190628 Address after: 100081 No. 12 South Main Street, Haidian District, Beijing, Zhongguancun Applicant after: Institute of Crop Science, Chinese Academy of Agricultural Science Applicant after: AGRICULTURAL GENOMICS INSTITUTE OF SHENZHEN, CHINESE ACADEMY OF AGRICULTURAL SCIENCES Address before: 100081 No. 12 South Main Street, Haidian District, Beijing, Zhongguancun Applicant before: Institute of Crop Science, Chinese Academy of Agricultural Science Applicant before: SHENZHEN BIOLOGY BREEDING INNOVATION INSTITUTE, CHINESE ACADEMY OF AGRICULTURAL SCIENCES |
|
| TA01 | Transfer of patent application right | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180724 |
|
| RJ01 | Rejection of invention patent application after publication |