CN102586239B

CN102586239B - Co-segregation SSR (Simple Sequence Repeat) codominant molecular marker of onion male sterility gene Ms site and application thereof

Info

Publication number: CN102586239B
Application number: CN 201210042457
Authority: CN
Inventors: 吴雄; 霍雨猛; 杨妍妍; 刘冰江; 缪军
Original assignee: Vegetable Research Institute of Shandong Academy of Agricultural Sciences
Current assignee: Vegetable Research Institute of Shandong Academy of Agricultural Sciences
Priority date: 2012-02-23
Filing date: 2012-02-23
Publication date: 2013-09-04
Anticipated expiration: 2032-02-23
Also published as: CN102586239A

Abstract

The invention discloses a co-segregation SSR (Simple Sequence Repeat) codominant molecular marker WH-SSR-1 of an onion male sterility gene Ms site. Nucleotide sequences of primers used for developing the marker are shown as SEQ ID NO. 3 and SEQ ID NO. 4, and nucleotide sequences of primers used for detecting an onion sample by applying the marker are shown as SEQ ID NO. 1 and SEQ ID NO. 2. The co-segregation SSR codominant molecular marker of the onion male sterility gene Ms site and the primers can be used for identifying the genotype of the onion male sterility gene Ms site by the followingsteps of: extracting leaf total DNA of the onion sample to be detected, amplifying with the primers through PCR, and detecting the size of the amplified product. By adopting the molecular marker provided by the invention, defects of the traditional molecular marker are overcome, a fussy screening process in the traditional method is avoided, and 4-6 years for crossing and test crossing as well asa great deal of manpower and material resource consumption in the process can be saved, therefore, the operation process is simpler and more efficient.

Description

A kind of onion male sterility gene Ms site be divided into from SSR codominance molecule marker and application thereof

Technical field

The present invention relates to a kind of onion male sterility gene Ms site be divided into from SSR codominance molecule marker, the exploitation of this mark can directly apply to the onion molecular mark, belongs to biological technical field.

Background technology

Onion (Allium cepa.L) claims round onions, onion again, Liliaceae, allium, biennial plant, the cultivation history in existing more than 5000 year.According to FAO statistics in 2009, have 175 country cultivation onions at least.3,700,000 hectares of world's onion cultivated areas, 7,230 ten thousand tons of output, in all vegetable crops, its cultivated area occupies second, and output occupies the 3rd; Wherein, China has onion the biggest in the world and produces area and output, produces area and surpasses 1,000,000 hectares, and 2,107 ten thousand tons of ultimate productions account for 30% of worldwide production.Onion have the laudatory title of protective foods, not only can eat raw, is used for processing also in a large number, has and reduces and the prevention thrombosis, and the effect of reducing blood-fat, hypotensive, arteriosclerosis, prevention myocardial infarction is well received by consumers.

China's onion cultivation history is shorter, and variety source is deficient, and the kind of plantation can be divided into red skin, Calusena lansium and silver skin onion at present, and Cultivar is based on conventional variety.Adjustment along with agricultural structure, demand to the onion improved seeds increases day by day, but mainly plant seed selection based on import cross-fertilize seed and some routines on producing at present, lack the first-filial generation kind with independent intellectual property right, need a large amount of foreign exchange of cost from external import seed, make foreign exchange earning vegetables production cost high.In order to change the backward situation of China on onion breeding field, develop the onion cross-fertilize seed with China's independent intellectual property right as early as possible, solve when its key is extensively to collect variety source the long problem of onion breeding cycle (for the 2-4 of common vegetable crop Chinese cabbage, radish doubly).Accelerate the research that molecular marker assisted selection and male sterile line utilize, walk the road that modern molecular biology combines with conventional breeding; The evaluation work of accelerating the fertility material has become a difficult problem that needs to be resolved hurrily at present, is the key link of onion cross-breeding seed selection.

At present, in the male sterile evaluation of onion, the molecule marking research that tenuigenin is identified has been obtained significant progress.But on nucleus is identified, because onion genomic dna huge (17.9pg), Nucleotide on per 1 karyomit(e) has 15,290Mbp, be 6 times of the corn gene group, 16 times of tomato, 107 times of [King JJ of Arabidopis thaliana, Bradeen J M, Bark O, et al.A low-density genetic map of onion reveals a role for tandem duplication in the evolution of an extremely large diploid genome.Theoretical and Applied Genetics, 1998.52:52-62.].

With Havey in the onion colonies of two open pollinations [

AF, J McCallum, Y Sato and MJ Havey.Molecular tagging of the Ms locus in onion.Journal of the American Society for Horticultural Science, 2002,127,576-582.], be labeled as auxiliary means with AOB272 (0.9cM), attempt selecting maintenance line, but find that this mark does not almost have related with maintenance line, the author thinks it may is because under permanent open pollination environment, carried out sufficient karyomit(e) exchange between AOB272 mark and the Ms site, therefore only can't select maintenance line exactly with this molecule marker.In the research before us, developed a cDNA molecule marker (WHR240) relevant with the male sterile fertility restorer gene, and this is marked in a plurality of onion materials and is verified, but because this mark is that the specific period with reverse transcription, the cDNA of particular organization are template, therefore have certain limitation (precondition and single dominant markers such as the extraction of RNA, reverse transcription) in operation and concrete the utilization, in large-scale breeding material evaluation work, also exist certain limitation.In addition, green onion research centre, Vegetable Research Institute, Shandong Academy of Agricultural Sciences (hereinafter to be referred as: the research centre) obtaining breakthrough aspect the molecule marker in onion male sterility gene site, developed with onion male sterility gene ms and fertility restorer gene Ms is closely linked is divided into from dna molecular marker, use this mark can accurately judge Ms or ms gene whether pure, but owing to be not the codominant marker, can not once increase to finish genotypic judgement, after must increasing with sterile gene linked marker and fertility restorer gene mark respectively, result according to twice acquisition comprehensively judges genotype, but also has the possibility that the amplification failure is had misjudgement.

And a kind of codominant dna marker can be judged the genotype (MsMs, Msms, msms) in male sterile site exactly by the result of single checking.Therefore, a kind of exploitation of codominance dna molecular marker will become the effective means of auxiliary onion sterile hybrid seed selection.SSR (Simple Sequence Repeat) simple sequence repeats also to claim microsatellite DNA, the core sequence that series connection repeats is 1-6bp, wherein the most common is that dinucleotide repeats, namely (CA) n is identical with the core sequence structure of each microsatellite DNA of (TG) n, the number 10-60 of repeating unit, its height polymorphism is mainly derived from serial number purpose difference, is a kind of codominance molecule marker.The ultimate principle of SSR mark is according to microsatellite sequence two ends complementary sequence design primer, by the little satellite fragment of PCR reaction amplification, core sequence series connection repetition number difference, thereby the method for the enough PCR of energy amplifies the PCR product of different lengths, amplified production is carried out gel electrophoresis, determine genotype and calculate gene frequency according to the size of isolated fragment.ESTs (expressed sequence tags) refer to from the cDNA library of different tissue sources random choose clone carry out 5 ' or the order-checking of 3 ' end after the expressed sequence fragment that is about 300-400bp that obtains.Utilize multiple bioinformatic analysis software, sequence is carried out pre-treatment, design the SSR primer then, the size of electrophoretic analysis amplified fragments.The exploitation of SSR mark also can be applicable to foundation, the germ plasm resource Study on Diversity of construction of genetic atlas, dna fingerprinting.

Therefore, the exploitation of a kind of codominance DNA nuclear mark not only can reduce the time of the workload of identifying filial generation, experimentation cost, maintenance line seed selection, and can directly just can directly identify sample in the genotype (MsMs, Msms, msms) in Ms site by single test.Obtain onion nucleus fertility mark, for screening onion male sterile line and supporting maintenance line, seed selection onion cross-fertilize seed is met the need of market, and fills up the blank on the onion cross-breeding field, and is significant.

Summary of the invention

The onion AFLP fragment sequence that the present invention has checked order according to the research centre, two ends design primer [AFLP-U:5 ' TTAACGTCATCAACCGTTCAT 3 '; AFLP-D:5 ' GGGACAAAAGAATAGCAATATG 3 '] increase respectively and can educate gene pool and sterile gene pond, order-checking back is compared sequence difference between the difference clone of two gene pools respectively with DNAMAN software, utilize misa software search SSR site and primer3 design the SSR primer [USSR-1:5 ' TTAACGTCATCAACCGTTCAT 3 '; DSSR-1:5 ' TTGGCTTCATCTCCRCTTC 3 '], PCR test, polyacrylamide gel electrophoresis equimolecular biological experimental method have been developed a codominance SSR molecule marker WH-SSR-1[USSR-1:5 ' TTAACGTCATCAACCGTTCAT3 ' that can distinguish onion nuclear gene Ms site; DSSR-1:5 ' TTGGCTTCATCTC CRCTTC 3 '], the exploitation of this mark is accelerated the seed selection process of onion cross-fertilize seed to accurate, the Rapid identification of onion male sterility gene Ms loci gene type (MsMs, Msms, msms), and is significant.

A kind of onion male sterility gene Ms site be divided into from SSR codominance molecule marker WH-SSR-1, the primer nucleotides sequence is classified as:

USSR-1:5 ' TTAACGTCATCAACCGTTCAT 3 ' is shown in SEQ ID NO.1;

DSSR-1:5 ' TTGGCTTCATCTCCRCTTC 3 ' is shown in SEQ ID NO.2;

Develop the nucleotide sequence of the used upstream primer AFLP-U of this mark shown in SEQ ID NO.3, the nucleotide sequence of downstream primer AFLP-D is shown in SEQ ID NO.4:

AFLP-U：5′TTAACGTCATCAACCGTTCAT 3；

AFLP-D：5′GGGACAAAAGAATAGCAATATG 3′。

Described onion male sterility gene Ms site be divided into from SSR codominance molecule marker and primer can be used for differentiate onion male sterility gene Ms loci gene type, step is as follows during application: the total DNA of blade that extracts onion sample to be detected, through primer [USSR-1, DSSR-1] behind the pcr amplification, whether detect has amplified production, if have only the amplified band of a 102bp, then the Ms loci gene type is the dominance of isozygotying (MsMs), if have only the amplified band of 1 99bp, then the Ms loci gene type is the recessiveness of isozygotying (msms), if 102bp is arranged, two amplifications of 99bp, then the Ms loci gene type is heterozygosis (Msms).

The total DNA of the blade of described extraction onion sample to be detected adopts the CTAB method to extract [Sambrook, J., Fritsch, E.F., and Maniatis, T., in Molecular Cloning:A Laboratory Manual.Cold Spring Harbor Laboratory Press, NY, Vol.1,2,3 (1989)].

The reaction system of described pcr amplification is: 25 μ L systems, wherein 2.5 μ L, 10 * PCR Buffer with Mg ²⁺4.0 μ L dNTPs of each 2.5mM; Each 1 μ L, 10 μ mol/L of Primer[USSR-1 and DSSR-1]; 0.5 μ L Taq DNA polymerase (5u/ μ L); 1 μ L Onion DNA Template; 15 μ L ddH ₂O.

Response procedures is: 94 ℃ of pre-sex change 4min, [72 ℃ are extended 30sec for 94 ℃ of sex change 30sec, 58 ℃ of annealing 30sec], and 30 circulations, 72 ℃ are extended 5min, 4 ℃ of preservations;

The consumption of the template used DNA of above-mentioned pcr amplification system is 20ng～100ng.

Whether described detection has the method for amplified production to be: the product that will obtain through pcr amplification is in 6% polyacrylamide gel electrophoresis, and silver dyes and detects the amplification segment, and digital camera is taken pictures.

Aforesaid operations step and operational condition are all undertaken by this area routine operation step and operational condition if no special instructions.

The present invention has obtained one of onion nuclear gene Ms site SSR molecule marker, called after WH-SSR-1, and this is marked at the BC of 239 strains ₁In the segregating population, all can be educated, and (Msms) all amplifies two bands in the strain, and only amplified a band in sterile strain (msms), and (table 1, Fig. 3), The above results illustrates this mark and Ms site close linkage not observe the appearance of karyomit(e) exchange strain.In order to verify feasibility and the use range that originally is marked at actual breeding work, we use the material of the known Ms loci gene type of the different genetic backgrounds in source, male sterile line (msms), and male parent self-mating system (MsMs) import cross-fertilize seed (Msms) is verified.Checking is the result show, the material of all dominance of isozygotying all has only the amplification of 1 treaty 102bp band, and the recessive material that isozygotys all has only the amplification of 1 99bp band, and there is the amplification of two bands in hybrid material, the checking result conform to fully with actual phenotype (table 2, Fig. 5).

The foundation that is developed as onion molecular marker assisted selection breeding system of SSR molecule marker of the present invention is laid a good foundation, and compares with present technology, and its advantage is:

(1) mark is stable: the SSR molecule marker WH-SSR-1 that the present invention develops, in [118 * (118 * 12-12)] colony, labeling pattern and the phenotype of all material are in full accord, be that sterile strain only has a band (＜100bp) amplification, and can educate amplification (one band＜100bp, the band＞100bp) that strain has two bands; At the material identification of 15 different sourcess, heterozygote has all amplified 2 bands, and the Ms that isozygotys has only amplified band bigger than normal, and the ms that isozygotys has all amplified 1 band less than normal, qualification result and genotype and phenotype in full accord (table 2, Fig. 5).

(2) codominant marker: WH-SSR-1 is labeled as a kind of codominance dna marker, can directly identify the individual genotype (MsMs, Msms or msms) in the Ms site of surveying.The exploitation of this mark is first on male sterility gene Ms site, with male sterility gene (ms) and fertility restorer gene (Ms) be divided into from the codominant marker, also do not see report in this respect both at home and abroad as yet.Be characterized in that the codominant marker can finish the accurate evaluation of three kinds of different genotype by once increasing.The paper of reporting in the Ms site at present has AOB272 mark and WHR240 mark.If adopt the AOB272 mark to carry out the evaluation of maintenance line, can not accurately identify the individual genotype of surveying owing to exist with the crossover value (0.9cM) in Ms site.And therefore the WHR240 mark, not only is subjected to the restriction of qualification time, and need carries out pre-treatment to the RNA sample because its expert evidence is the RNA of young flower bud, has increased complexity and the cost identified, is not suitable for identifying on a large scale work.The exploitation of this center other two with 201110247512.4) and OMS-SCAR (number of patent application: 2011110226231.4) mark the closely linked dna molecular marker OSG-SCAR in Ms site (number of patent application:, though can accurately identify three kinds of different genotype, but must finish by twice amplification, because it is the dominant marker, can't directly identify the genotype of sample, in identifying implementation process, increased the possibility of the evaluation mistake that causes owing to experimental implementation.

(3) molecular marker assisted selection is easy and simple to handle, and save cost: onion is 2 years living plants, and the 2-4 that its breeding time limit is the vegetable breeding time limits such as Chinese cabbage, radish times, conventional selection, the cycle is long, cost height, time-consuming effort again.By the present invention, only need the total DNA of onion, carrying out pcr amplification, polyacrylamide gel electrophoresis and silver dyes, get final product the genotype in effective expert evidence nucleus Ms site, but also can just can distinguish heterozygote and homozygote genotype by disposable amplification, this point is that so far other marking method is irreplaceable.The WH-SSR-1 molecule marker is a kind of codominance molecule marker in onion nuclear Ms site, not only overcome the deficiency of molecule marker in the past, and avoided the loaded down with trivial details screening process of ordinary method, can also save a large amount of human and material resources consumption in 4-6 hybridization test cross time and this process, thereby make its operating process simpler, effective.

Description of drawings

Fig. 1: onion blade total DNA extraction result.

Fig. 2: the AFLP segment is in the variance analysis in Ms site, and wherein, shade partly is the SSR repeatable position, and underscore is the primer part.

Fig. 3: WH-SSR-1 is marked at the linkage analysis in the backcross population, wherein, and 1-25: can educate individual plant (Msms); 26-50: sterile individual plant (msms); M:Marker.

The amplification of Fig. 4: WH-SSR-1 in three kinds of different genotype onion materials, wherein, 1: fertile homozygous body genotype individual plant (MsMs); 2: can educate heterozygote genotype individual plant (Msms); 3: sterile homozygote genotype individual plant (msms); M:Marker.

Fig. 5: the WH-SSR-1 mark is to the amplification in 15 parts of materials of different sources genetic background, 1-9: be the onion cross-fertilize seed S (Msms) of Japan Long well seedling Co., Ltd., wherein, 1-3:

One ボ; 4-6: ネオア one ス; 7-9: アト Application; 10-12: sterile line 118S (msms); 13-24 is the onion cross-fertilize seed of Japanese Sapporo seedling Co., Ltd., wherein, and 13-15: No. 3, も body じ; 16-18: One ザ Application; 19-21: ア De バ Application ス; 22-24: sweet 70; M:Marker; 25-36: fertility restorer line S/N (MsMs), wherein, 25-27:PR146; 28-30:PR149; 31-33:PR153; 34-36:PR156; 37-45 is sterile line S (msms), wherein, and 37-39:PF502; 40-42:PF10-8; 43-45:PF17-5.

Embodiment

The present invention is further illustrated below in conjunction with embodiment and accompanying drawing, and the experimental technique among the embodiment if no special instructions, is ordinary method.

Embodiment 1

(1) materials and methods

1. vegetable material

Serve as maternal and male parent self-mating system 12-12S (MsMs) hybridization with onion male sterile line 118S (msms), the F1 that obtains backcrosses for male parent and maternal sterile line 118S (msms) for S (Msms), obtain two backcross progeny segregating populations, make up with the first backcross generation segregating population then and can educate gene pool S (Msms) and sterile gene pond S (msms).

Mark feasibility checking material: the dissimilar sterile line PF502 (Calusena lansium, precocity) of this center seed selection, PF10-8 (Calusena lansium, in ripe), PF17-5 (red skin, in late-maturing); Japan Long well seedling Co., Ltd. cross-fertilize seed ( One ボ, ネオア one ス, アト Application), the cross-fertilize seed of Japanese Sapporo seedling Co., Ltd. (No. 3, も body じ, Sapporo be sweet 70, One ザ Application, ア De バ Application ス); Fertility restorer homozygote material (PR146, PR149, PR153, PR156), derive from Japanese different onion kinds (cross-fertilize seed), the nuclear gene type is MsMs, form by test cross, the method seed selection of backcrossing, selection is referring to [Pike, L.M.1986.Onion breeding.In:Basset, M.J. (ed.) Breeding Vegetable Crops.AVI Publishing Co., Connecticut, pp, 357-394].

2. extraction and the detection of total DNA

Genome DNA extracting method adopts modified CTAB method, and agarose gel electrophoresis and spectrophotometer detect.

3. sequential analysis and primer design

According to the AFLP fragment sequence that order-checking obtains, the design gene-specific primer:

AFLP-U：5′TTAACGTCATCAACCGTTCAT 3′；

AFLP-D：5′GGGACAAAAGAATAGCAATATG 3′。

Respectively the educated gene pool in the backcross population and sterile gene pond are carried out pcr amplification, the clone reclaims amplified fragments, mono-clonal is checked order, can educate gene pool 20 clones of picking at random, the sterile gene pond is 10 clones of picking at random, utilize DNAMAN software to the AFLP order-checking segment between the difference clone, compare.Under the perl operating environment, carry out the misa.pl order, search SSR site; Utilize primer3 software design SSR primer:

USSR-1：5′TTAACGTCATCAACCGTTCAT 3′；

DSSR-1：5′TTGGCTTCATCTCCRCTTC 3′。

Give birth to worker Bioisystech Co., Ltd by Shanghai and synthesize the PAGE purifying.

4.PCR amplification and detection

Pcr amplification carries out at U.S. Bole's TC-XP-D type gene-amplificative instrament, 25 μ L systems, wherein 2.5 μ L, 10 * PCR Buffer with Mg ²⁺4.0 μ L dNTPs of each 2.5mM; Each 1 μ L, 10 μ mol/L of Primer[USSR-1 and DSSR-1]; 0.5 μ L Taq DNA polymerase (5u/ μ L); 1 μ L Onion DNA Template; 15 μ L ddH ₂O.The consumption of the template used DNA of pcr amplification system is 1 μ L (about 20ng).Response procedures is 94 ℃ of pre-sex change 4min, [72 ℃ are extended 30sec for 94 ℃ of sex change 30sec, 58 ℃ of annealing 30sec], 30 circulations, 72 ℃ are extended 5min, 4 ℃ of preservations; The PCR product is in 6% polyacrylamide gel electrophoresis, and silver dyes detection amplification segment digital camera and takes pictures.

5. individual plant checking

By observing the fertility of judging each strain in the segregating population of field, the genotype in WH-SSR-1 mark identification of M s site, reaction system, program and detection method reference 4.

6.WH-SSR-1 be marked at the checking in the known section bar material of other different genetic backgrounds of originating

Utilize the WH-SSR-1 labeled primer that the other materials (table 2) of known type different sources is verified, to confirm the relation between phenotype and the genes identified type, reaction system, program and detection method are with reference to 4.

(2) result and analysis

1. onion blade total DNA extraction is analyzed

As seen from Figure 1, the DNA band that extracts is clear, no conditions of streaking, and no RNA is residual, proves that it does not have degraded substantially; And the point sample hole is clear, proves inclusion-free residual (Fig. 1).Spectrophotometer detects to be analyzed, and the DNAOD260/OD280 that extracts all between 1.8-2.0, can satisfy the requirement of follow-up test.

2. sequential analysis and design of primers

According to the acquired AFLP sequencing sequence in this research centre, after can educating gene pool and sterile gene pond pcr amplification in the backcross population, discovery can educated insertion/disappearance (IN/DEL) marker site (Fig. 2) of existence between gene pool and the sterile gene pond, this marker site (10 clones) in the sterile gene pond all shows as disappearance TCT, insert the TCT sequence and there are 9 clones to show as in can educating 20 clones of gene pool, 11 clones show as disappearance TCT sequence.Find that behind the misa software analysis this insertion disappearance is labeled as SSR marker site (WH-SSR-1), its repeating unit is that TCT repeats, be 4 repetitions in recessiveness (msms) colony is isozygotied in the Ms site, multiplicity has two kinds in heterozygous state (Msms) colony, and a kind of is 4 repetitions; A kind of is 5 repetitions, and the segregation ratio of two kinds of repetitions is fit to 1: 1 segregation ratio, and we infer that this site is Ms and ms difference site, and wherein ms is that 4 TCT repeat, and Ms is 5 TCT repetitions.Based on this, we developed 1 pair of SSR primer [USSR-1:5 ' TTAACGTCATCAACCGTTCAT 3 '; DSSR-1:5 ' TTGGCTTCATCTCCRCTTC 3 '] be used for to distinguish the type in this site, the big or small ms of its expection amplification isozygoty for 99bp, Ms isozygoty for 102bp, Msms heterozygosis be 99bp and 102bp2 band.

3.WH-SSR-1 be marked at the linkage analysis in [118 * (118 * the 12-12)] segregating population of backcrossing

WH-SSR-1 is marked at the BC of 239 strains ₁In the segregating population, all can educate strain (Msms) all amplified two bands (one band＜100bp, a band＞100bp), and sterile strain (msms) only amplified a band (＜100bp), no crossover value (table 1, Fig. 3).Therefore we analyze, the WH-SSR-1 mark may with Ms site close linkage.

Table 1WH-SSR-1 mark and onion male nuclear sterile gene (Ms, ms) linkage analysis

4.WH-SSR-1 be marked at the feasibility checking in the different genetic background known section bar material in source

In to sterile line 118S (msms), male parent 12-12S/N (msms) and first backcross generation segregating population, can educate in the checking of three kinds of genotype materials of strain (heterozygote) S (Msms), sterile line 118 only amplified a band (＜100bp), 2 bands (one band＜100bp has increased in the heterozygote, one band＞100bp), male parent 12-12 has amplified a band greater than 100bp (Fig. 4).

5.WH-SSR-1 be marked at the feasibility checking in the molecular mark

The WH-SSR-1 mark is identified the material of 15 different sourcess, amplification shows that heterozygote has all amplified 2 bands, and the Ms genotype of isozygotying only amplified band bigger than normal (band＞100bp), the ms genotype of isozygotying all amplified a band less than normal (＜100bp).Molecular Identification as a result phenotype and genotype in full accord (table 2, Fig. 5).The above results explanation, WH-SSR-1 mark be with Ms site close linkage be divided into from the codominant marker.

The different genetic background known of table 2 onion section bar material list strain checking result

+ ms represents to have one (ms) band; ++ represent two bands; + Ms represents to have one (Ms) band

The development and utilization of this mark, first: not only can reduce the time of the workload of identifying filial generation, experimentation cost, maintenance line seed selection, and can directly just can identify sample in the genotype (MsMs, Msms, msms) in Ms site by once increasing; The second, can be directly and be widely used in screening in the molecular mark of the different genetic background materials of onion male sterile line and supporting maintenance line; The 3rd, can greatly improve efficiency of selection, accelerate the breeding hybridized process of onion, fill up the blank on the onion cross-breeding field, significant.

Claims

An onion male sterility gene Ms site be divided into from the primer of SSR codominance molecule marker, it is characterized in that: nucleotide sequence is shown in SEQ ID NO.1 and SEQ ID NO.2.
The described a kind of onion male sterility gene Ms of claim 1 site be divided into from the primer of SSR codominance molecule marker, it is characterized in that: develop the nucleotide sequence of the used upstream primer AFLP-U of this molecule marker shown in SEQ ID NO.3, the nucleotide sequence of downstream primer AFLP-D is shown in SEQ ID NO.4.
The described a kind of onion male sterility gene Ms of claim 1 site be divided into from the application of primer in differentiating onion male sterility gene Ms loci gene type of SSR codominance molecule marker.
4. application according to claim 3, it is characterized in that: applying step is: the total DNA of blade that extracts onion sample to be detected, after the primer PCR amplification, whether electrophoresis detection has amplified production, if having only the amplified band of a 102bp, then genotype is the dominance of isozygotying, if have only the amplified band of 1 99bp, then genotype is the recessiveness of isozygotying, if two amplifications of 102bp, 99bp are arranged, then genotype is heterozygosis.
5. application according to claim 4 is characterized in that: the reaction system of described pcr amplification is: 25 μ L systems, wherein 2.5 μ L10 * PCR Buffer with Mg ²⁺4.0 μ L dNTPs of each2.5mM; Each 1 μ L10 μ mol/L of Primer USSR-1 and DSSR-1; 0.5 μ L Taq DNA polymerase, 5u/ μ L; 1 μ L Onion DNA Template; 15 μ L ddH ₂O;

The sequence of described USSR-1 is shown in SEQ ID NO.1;

The sequence of described DSSR-1 is shown in SEQ ID NO.2.
6. application according to claim 4 is characterized in that: the response procedures of described pcr amplification is: 94 ℃ of pre-sex change 4min, and 94 ℃ of sex change 30sec, 58 ℃ of annealing 30sec, 72 ℃ are extended 30sec, 30 circulations, 72 ℃ are extended 5min, 4 ℃ of preservations; The consumption of the template used DNA of pcr amplification system is 20ng～100ng.
7. application according to claim 4 is characterized in that: whether described detection has the method for amplified production to be: the product that will obtain through pcr amplification is in 6% polyacrylamide gel electrophoresis, and silver dyes and detects the amplification segment, and digital camera is taken pictures.