CN108300811A - The RT-PCR detection kit and its detection method of one boar Sai Nika paddy viruses - Google Patents
The RT-PCR detection kit and its detection method of one boar Sai Nika paddy viruses Download PDFInfo
- Publication number
- CN108300811A CN108300811A CN201810350095.8A CN201810350095A CN108300811A CN 108300811 A CN108300811 A CN 108300811A CN 201810350095 A CN201810350095 A CN 201810350095A CN 108300811 A CN108300811 A CN 108300811A
- Authority
- CN
- China
- Prior art keywords
- pcr amplification
- reagent
- sai nika
- nika paddy
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the RT PCR detection kits and its detection method of a boar Sai Nika paddy viruses, and the primer sets include primer S1, S2, wherein：S1:5’‑AACTTAGGCTAGCTTACCAT‑3’,S2：5 ' CAATAGCTGAGTCGACCTGTATG 3 ', S3：5’‑ATAAGCTGAGTCGACTGAT‑3’.The present invention designs specific primer S1, S2 and S3, can carry out specific amplification to pig Sai Nika paddy viruses.The dedicated kit of the present invention has very strong sensibility, specificity, and coincidence rate can be widely applied for the antidiastole of clinical pig Sai Nika paddy virus up to 100% compared with the methods of virus purification and IFA.
Description
Technical field
The present invention relates to veterinary biological virus detection techniques fields, and in particular to the RT-PCR of a boar Sai Nika paddy viruses
Detection kit and its detection method.
Background technology
2002, gene therapy company of the U.S. was accidentally from PER.C6 cells (the fetus retinoblast of conversion) culture medium
In find for the first time and be separated to a kind of new virus --- Sai Nika paddy virus (SenecaValley virus, SVV, it is another to claim
Seneca virus A, SVA), it is a kind of no cyst membrane, single-stranded, underlying stock RNA virus, belongs to Picornaviridae, it is 2015, international
The virus is divided to new Tobamovirus by the virus taxis committee (ICTV) --- Sai Nika Tobamovirus.
It is usually expressed as acute, self limiting blister symptom after pig infection.Clinical manifestation declines for feed intake, and nose is kissed later
Existing blister venereal disease becomes, it is seen that one or more not of uniform size, hydraulically full vesicas；Ulcer lesion is developed into after capsules rupture,
10-15d forms thick scab after infection.Blister and exedens lesion come across more split between coronet portion toe and coronary band around, cause
The loose necrosis of bordering epithelia, severe patient walk lamely, dysstasia.There is punctation in some sow abdomens and breast portion, or with
Fever and anorexia, or even fever (39.5-40.5 DEG C), the sow body temperature that part is walked lamely is up to 41.0 DEG C.Newborn piglet body
State is weak, drowsiness, is reluctant to inhale breast, and acute death occur, in the suppurative vesicle of hoof metacarpus visible part.
Occur the clinical manifestation of blister and infection aftosa (FMD), pig blisters (SVD), blister after pig infection SVV- I
Stomatitis (VS) etc. is very much like, is all mainly that bubble, limping, apocleisis, drowsiness, fever occur in nose and coronary band, and continue
Toxin expelling.The reverse transcription PCR diagnostic method and dedicated kit for establishing a boar Sai Nika paddy viruses can facilitate and occur in epidemic disease
Early stage fast and accurately diagnoses epidemic disease, and effective reference is provided for the prevention and control of epidemic disease.
Invention content
In view of this, the purpose of the present invention is to provide the RT-PCR detection kit of a boar Sai Nika paddy viruses and its
Detection method, the kit can quickly distinguish pig Sai Nika paddy viruses.
To achieve the goals above, the technical solution adopted in the present invention is：
The RT-PCR detection kit of one boar Sai Nika paddy viruses, the primer sets include primer S1, S2, S3,
In：
S1：5’-AACTTAGGCTAGCTTACCAT-3’；
S2：5’-CAATAGCTGAGTCGACCTGTATG-3’；
S3：5’-ATAAGCTGAGTCGACTGAT-3’.
Application of the primer sets in preparing for pig Sai Nika paddy virus differential diagnosis kits a kind of described in.
A kind of pig Sai Nika paddy virus differential diagnosis kits of the primer sets.
The kit further includes nucleic acid extracting reagent, Reverse Transcription, PCR amplification reagent, and/or Ago-Gel
Electrophoresis reagents.
The Reverse Transcription include 10 × M-MLV buffer solutions, dNTP, M-MLV reverse transcriptase, RNase enzyme inhibitors,
S2 primers.
The PCR amplification reagent includes 10 × PCR amplification buffer solution, dNTP, S1 primer, S2 primers, Taq DNA polymerizations
Enzyme and distilled water.
PCR amplification system constructed by the PCR amplification reagent is：10 × PCR amplification buffer solution, 5.0 μ L,
2.5mmol/L dNTP8.0 μ L, 1.0 μ L of 10mmol/L S1 primers, 1.0 μ L of 10mmol/L S2 primers, 5U/ μ L Taq DNA are poly-
1.0 μ L of synthase, 3.0 μ L of template, add distilled water to 50 μ L.
A kind of application method of the kit, including nucleic acid extraction, reverse transcription, PCR amplification and Ago-Gel electricity
Swimming.
The PCR amplification condition is：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C extend
90s, totally 35 recycle；Last 72 DEG C of extensions 10min.
Beneficial effects of the present invention：
The present invention designs specific primer S1, S2, S3 by the difference of comparison pig Sai Nika paddy viruses, can be to pig plug
Buddhist nun blocks paddy virus and carries out specific amplification；Dedicated kit is had developed on this basis, first extracts viral RNA, is reused S2 and is drawn
Object reverse transcription synthesizes cDNA, and differentiates detection pig Sai Nika paddy viruses using RT-PCR method.Compared with prior art, of the invention
Dedicated kit have very strong sensibility, specificity, to Porcine epidemic diarrhea virus (P-EDV) and porcine rotavirus
(PoRV) amplification is feminine gender, can be widely applied for the antidiastole of clinical pig Sai Nika paddy virus.
Specific implementation mode
To make the objectives, technical solutions, and advantages of the present invention clearer, below in conjunction with specific embodiment, to this hair
Bright to be described in further detail, the embodiment is only for explaining the present invention, is not intended to limit the scope of the present invention..
Experimental method used in following embodiments is the conventional method of this field unless otherwise specified, or according to institute of manufactory
It is recommended that condition and implementation steps.
The structure of embodiment 1, differential diagnostic method
1, design of primers
Two specific primers are designed, it is specific as follows:
S1：5’-AACTTAGGCTAGCTTACCAT-3’(SEQ ID NO.1)
S2：5’-CAATAGCTGAGTCGACCTGTATG-3’(SEQ ID NO.2)
S3：5’-ATAAGCTGAGTCGACTGAT-3’(SEQ ID NO.3)
PCR amplification is carried out using S1, S2 and S3, it is 768bp that SVV vaccine strains, which are expected amplified fragments size, and SVV now is detached
The expected amplified fragments size of strain is 378bp.
2, the extraction of viral RNA
Take SVV strain cell culture fluids, after multigelation 3 times, 5000g centrifuges 15min, takes supernatant spare.
(1) 0.2ml chloroforms are taken, isometric supernatant is added, acutely rocks 15s, are placed at room temperature for 3min, then 12,000g,
4 DEG C of centrifugation 5min.Be divided into 3 layers after centrifugation, it is nethermost it is red be phenol-chloroform phase, a middle layer, upper layer is colourless water
Phase, RNA are present in water phase；
(2) upper strata aqueous phase in step (1) is transferred in the clean EP pipes of another, the isopropyl of 0.5ml precoolings is added
Alcohol is stored at room temperature 10min, then 12,000g, 4 DEG C of centrifugation 10min；
(3) it outwells supernatant, 75% ethyl alcohol of 1ml volume fractions is added and washs RNA precipitate, after mixing, 7500g, 4 DEG C of centrifugations
5min；
(4) supernatant is outwelled, 10min is placed at room temperature for, is then added in right amount without RNAse water dissolutions RNA to get to total serum IgE.
3, reverse transcription
The RNA extracted using step 2 carries out reverse transcription as template, obtains cDNA, and reverse transcription reaction system is：
| Template ribonucleic acid | 4.9μL |
| S2 primers (10mmol/L) | 0.3μL |
| RTase enzyme inhibitors (40U/ μ L) | 0.3μL |
| M-MLV reverse transcriptase (200U/ μ L) | 0.5μL |
| dNTP(2.5mmol/L) | 2.0μL |
| 10 × M-MLV buffer solutions | 2.0μL |
Reaction condition is：42 DEG C of heat preservations 60min, 70 DEG C of 10min.
4, PCR (PCR)
4.1PCR reaction system
The cDNA obtained using step 3 carries out PCR amplification as template, and PCR reaction systems are：
4.2PCR reaction condition optimization
The PCR reaction conditions of SVV vaccine strains are optimized, respectively with annealing temperature be 54 DEG C, 55 DEG C, 56 DEG C, 57 DEG C,
58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C carry out PCR reaction amplification SVV vaccine strains, and reaction condition is：95 DEG C pre-
It is denaturalized 5min；94 DEG C of denaturation 30s, anneal 30s, 72 DEG C of extension 90s, totally 35 cycles；72 DEG C of extension 10min.It was found that in 57 Hes
62 DEG C of segments that can amplify 768bp sizes, it is in the same size with expection.
The PCR reaction conditions of existing the separation strains of SVV are optimized, be respectively 52 DEG C with annealing temperature, 53 DEG C, 54 DEG C,
55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C carry out PCR reaction amplification SVV now separation strains, reaction condition are：95
DEG C pre-degeneration 5min；94 DEG C of denaturation 30s, anneal 30s, 72 DEG C of extension 90s, totally 35 cycles；72 DEG C of extension 10min.It was found that
57 DEG C of segments for 378bp sizes occur, it is in the same size with expection.
In summary it reacts, the annealing temperature of composite PCR is finally set as 57 DEG C by the present invention, the reaction condition after optimization
For：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 90s, totally 35 recycle；Last 72 DEG C of extensions
10min.Pcr amplification product is placed in -20 DEG C of preservations.
5, electrophoresis
To PCR product into row agarose gel electrophoresis, voltage 100V, electrophoresis 40min, under DNA gel imaging system instrument
Observe result.
The dedicated kit of the present invention includes nucleic acid extracting reagent, Reverse Transcription, PCR used in above-mentioned detection method
Amplifing reagent, agarose gel electrophoresis reagent.
Embodiment 2, specificity experiments
It is respectively control strain with Porcine epidemic diarrhea virus (P-EDV) and porcine rotavirus (PoRV), with pig Sai Nika
For paddy virus as experiment strain, above 3 kinds of virus is to cause the encountered pathogenic of diarrhea, and diarrhea caused by this 3 kinds of viruses exists
On epidemiology, it is clinically extremely similar with pathological change etc., clinically be difficult distinguish.According to the method in embodiment 1
It is detected, the results showed that, only now separation strains can obtain amplified fragments for SVV vaccine strains and SVV, other viruses are without expansion
Increase band to generate.Experimental result confirms that primer of the invention and detection method have very high specificity.
Embodiment 4, sensitivity experiment
SVV is showed into ground separation strains virus liquid and carries out 10 times of gradient dilutions, it is 5.4 × 10 to make virus concentration4-5.4×10- 4Copies/ μ L, and be detected according to the method for embodiment 1, the results showed that, in the 8th swimming lane a concentration of 5.4 × 10- 3Copies/ μ L it is amplifiable go out expected segment, the minimum detection of nucleic acids amount of primer of the invention and detection method is 5.4 × 10- 3Copies/ μ L, but the 9th swimming lane 5.4 × 10-4Segments of the copies/ μ L without expected size, judges its sensitivity for 5.4 × 10- 3copies/μL。
SVV vaccine strain virus liquids are subjected to 10 times of gradient dilutions, it is 1.5 × 10 to make virus concentration4-1.0×10- 4Copies/ μ L, and be detected according to the method for embodiment 1, the results showed that, in the 8th swimming lane a concentration of 1.5 × 10- 3Copies/ μ L it is amplifiable go out expected segment, the minimum detection of nucleic acids amount of primer of the invention and detection method is 1.5 × 10- 3Copies/ μ L, but the 9th swimming lane 1.5 × 10-4Segments of the copies/ μ L without expected size, judges its sensitivity for 1.5 × 10- 3copies/μL。
The above is only presently preferred embodiments of the present invention, is not imposed any restrictions to the present invention, every according to the present invention
Technical spirit changes any simple modification, change and equivalent structure made by above example, still falls within skill of the present invention
In the protection domain of art scheme.
Sequence table
<110>Teng Jianfen
<120>The RT-PCR detection kit and its detection method of one boar Sai Nika paddy viruses
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
aacttaggct agcttaccat 20
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
caatagctga gtcgacctgt atg 23
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ataagctgag tcgactgat 19
Claims (9)
1. the RT-PCR detection kit of a boar Sai Nika paddy viruses, which is characterized in that the primer sets include S1, S2,
S3, wherein：
S1：5’-AACTTAGGCTAGCTTACCAT-3’；
S2：5’-CAATAGCTGAGTCGACCTGTATG-3’；
S3：5’-ATAAGCTGAGTCGACTGAT-3’.
2. a kind of primer sets as described in claim 1 answering in preparing for pig Sai Nika paddy virus differential diagnosis kits
With.
3. a kind of pig Sai Nika paddy virus differential diagnosis kits comprising primer sets as described in claim 1.
4. kit according to claim 3, which is characterized in that the kit further includes nucleic acid extracting reagent, anti-
Transcript reagent, PCR amplification reagent, and/or agarose gel electrophoresis reagent.
5. kit according to claim 4, which is characterized in that the Reverse Transcription is buffered including 10 × M-MLV
Liquid, dNTP, M-MLV reverse transcriptase, RNase enzyme inhibitors, S2 primers.
6. kit according to claim 4, which is characterized in that the PCR amplification reagent is slow including 10 × PCR amplification
Fliud flushing, dNTP, S1 primer, S2 primers, Taq archaeal dna polymerases and distilled water.
7. kit according to claim 6, which is characterized in that the PCR amplification body constructed by the PCR amplification reagent
System is：10 × PCR amplification buffer solution, 5.0 μ L, 2.5mmol/L dNTP8.0 μ L, 1.0 μ L of 10mmol/L S1 primers, 10mmol/L
1.0 μ L of S2 primers, 1.0 μ L of 5U/ μ L Taq archaeal dna polymerases, 3.0 μ L of template, add distilled water to 50 μ L.
8. a kind of application method such as claim 3-7 any one of them kits, which is characterized in that including nucleic acid extraction,
Reverse transcription, PCR amplification and agarose gel electrophoresis.
9. the application method of kit according to claim 8, which is characterized in that the PCR amplification condition is：95℃
Pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 90s, totally 35 recycle；Last 72 DEG C of extensions 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810350095.8A CN108300811A (en) | 2018-04-18 | 2018-04-18 | The RT-PCR detection kit and its detection method of one boar Sai Nika paddy viruses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810350095.8A CN108300811A (en) | 2018-04-18 | 2018-04-18 | The RT-PCR detection kit and its detection method of one boar Sai Nika paddy viruses |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108300811A true CN108300811A (en) | 2018-07-20 |
Family
ID=62847502
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810350095.8A Withdrawn CN108300811A (en) | 2018-04-18 | 2018-04-18 | The RT-PCR detection kit and its detection method of one boar Sai Nika paddy viruses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108300811A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110229933A (en) * | 2019-06-24 | 2019-09-13 | 派生特（福州）生物科技有限公司 | A kind of primer sets, kit and application for the viral RT-Nested PCR detection of pig card inside competition |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120034676A1 (en) * | 2003-09-26 | 2012-02-09 | Hallenbeck Paul L | Seneca valley virus based compositions and methods for treating disease |
| CN106916910A (en) * | 2017-05-10 | 2017-07-04 | 广东温氏食品集团股份有限公司 | Sai Nika paddy virus (PRRSV) TaqMan MGB fluorescence quantitative PCR detections primer, probe and detection method |
| CN107034313A (en) * | 2017-05-10 | 2017-08-11 | 广东温氏食品集团股份有限公司 | The RT PCR detection primers and RT PCR detection methods of a pair of Sai Nika paddy virus |
-
2018
- 2018-04-18 CN CN201810350095.8A patent/CN108300811A/en not_active Withdrawn
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120034676A1 (en) * | 2003-09-26 | 2012-02-09 | Hallenbeck Paul L | Seneca valley virus based compositions and methods for treating disease |
| CN106916910A (en) * | 2017-05-10 | 2017-07-04 | 广东温氏食品集团股份有限公司 | Sai Nika paddy virus (PRRSV) TaqMan MGB fluorescence quantitative PCR detections primer, probe and detection method |
| CN107034313A (en) * | 2017-05-10 | 2017-08-11 | 广东温氏食品集团股份有限公司 | The RT PCR detection primers and RT PCR detection methods of a pair of Sai Nika paddy virus |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110229933A (en) * | 2019-06-24 | 2019-09-13 | 派生特（福州）生物科技有限公司 | A kind of primer sets, kit and application for the viral RT-Nested PCR detection of pig card inside competition |
| CN110229933B (en) * | 2019-06-24 | 2022-06-07 | 派生特（福州）生物科技有限公司 | Primer group and kit for nested RT-PCR (reverse transcription-polymerase chain reaction) detection of porcine Saikovia virus and application of primer group and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2014210676B2 (en) | Methods of Using miRNA for Detection of In Vivo Cell Death | |
| EP3636769B1 (en) | Sample nucleic acid measurement test kit, reagent, and application thereof | |
| CN103602757B (en) | The foundation of foot and mouth disease, vesicular stomatitis and swine pox multi-fluorescence RT-PCR detection method and application thereof | |
| JP2000500342A (en) | Nucleic acid probes complementary to human papillomavirus nucleic acids and related methods and kits | |
| CN103468830B (en) | NASBA kit for detecting monkey pox virus and application thereof | |
| CN107326100A (en) | Aftosa and the double real-time fluorescence quantitative PCR detection kit of Sai Nika paddy virus | |
| CN105112559B (en) | A kind of kit and its application for being used to detect coronavirus | |
| CN106801109B (en) | RT-PCR detection specific primer, kit and detection method for swine atypical pestivirus | |
| CN105925728A (en) | Seneca valley virus real-time fluorescence quantification PCR detection primer and kit | |
| CN103725796B (en) | Mark parting fluorescence PCR detection kit and preparation thereof in a kind of bovine viral diarrhea virus | |
| Mamatha et al. | Molecular epidemiology and phylogenetic characterisation of Theileria luwenshuni in India: A first report | |
| WO2023025259A1 (en) | Method and kit for detecting microrna | |
| CN107937618A (en) | The droplet numeral RT PCR detection primers of A types Senecan virus and probe and its application | |
| CN108796086A (en) | A kind of circular rna circBCBM1 and its nondiagnostic fluorescence quantitative detecting method | |
| CN104630387B (en) | The LAMP detection kit of Porcine epidemic diarrhea virus | |
| CN108300811A (en) | The RT-PCR detection kit and its detection method of one boar Sai Nika paddy viruses | |
| CN107058618A (en) | Bovine viral diarrhea virus nano PCR detection kits and preparation method thereof | |
| CN105002169A (en) | DHAV-3 fluorescent quantitation RT-LAMP detection reagent kit and application and method thereof | |
| CN108060272A (en) | A kind of quick differentiation pig Delta coronavirus and the multiple PCR detection primer group and kit of pig ridge virus | |
| CN108251561A (en) | It is a kind of to be used for bovine viral diarrhea virus now separation strains and the primer sets and kit of vaccine strain antidiastole | |
| CN107475441A (en) | It is a kind of to predict reactive biomarker of the patient with breast cancer to AT scheme new adjuvant chemotherapies | |
| CN108950075A (en) | The RT-PCR detection kit and its detection method of one seed shrimp haemocyte irido virus | |
| CN108300812A (en) | A kind of RT-PCR detection kit and its detection method of Pigeon paramyxovirus type I | |
| CN106916886A (en) | A kind of gene primer of dynamin-related proteins 1 and its preparation method of cRNA in situ hybridization probes for FISH | |
| CN107475450A (en) | A kind of primer sets and kit for the strain of Porcine epidemic diarrhea virus novel variant and vaccine strain antidiastole |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20180720 |
|
| WW01 | Invention patent application withdrawn after publication |