CN108251561A - It is a kind of to be used for bovine viral diarrhea virus now separation strains and the primer sets and kit of vaccine strain antidiastole - Google Patents
It is a kind of to be used for bovine viral diarrhea virus now separation strains and the primer sets and kit of vaccine strain antidiastole Download PDFInfo
- Publication number
- CN108251561A CN108251561A CN201810296198.0A CN201810296198A CN108251561A CN 108251561 A CN108251561 A CN 108251561A CN 201810296198 A CN201810296198 A CN 201810296198A CN 108251561 A CN108251561 A CN 108251561A
- Authority
- CN
- China
- Prior art keywords
- bovine viral
- diarrhea virus
- viral diarrhea
- separation strains
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a kind of primer sets and kit for bovine viral diarrhea virus now separation strains and vaccine strain antidiastole, the primer sets include primer S1, S2, wherein：S1:5’‑ACTTAGCCTAGCACCACAT‑3’,S2：5’‑CAATAAGCTTAGTCGACTGTATG‑3’.The present invention is according to existing the difference between separation strains and vaccine strain of bovine viral diarrhea virus, i.e. now there are the missings of 612 nucleotide for separation strains for bovine viral diarrhoea, specific primer S1, S2 are designed, it can now separation strains and vaccine strain carry out specific amplification to bovine viral diarrhea virus.The dedicated kit of the present invention has very strong sensibility, specificity, and coincidence rate up to 100%, can be widely applied for clinical bovine viral diarrhea virus vaccines and now the antidiastole of separation strains compared with the methods of virus purification and IFA.
Description
Technical field
The present invention relates to veterinary biological virus detection techniques fields, and in particular to one kind shows for bovine viral diarrhea virus
Ground separation strains and the primer sets and kit of vaccine strain antidiastole.
Background technology
Bovine viral diarrhoea (mucosal disease) is by bovine viral diarrhea virus (Bovine Viral Diarrhea Virus
Write a Chinese character in simplified form BVDV and belong to flaviviridae pestivirus) caused by infectious disease, the ox at various ages all easy infection, with young age ox neurological susceptibility
Highest, the disease are mainly shown as ox vomiting, watery diarrhea and dehydration, huge economic loss are brought to aquaculture, is to endanger at present
One of important epidemic disease of evil world's cattle-raising.With being successfully separated BVDV for the first time within 1986, which is widely present in me in China
In the vaccary of state, the economic benefit of cattle-raising has been seriously affected.In recent years find that BVDV is morphing under immune pressure,
The method of original antidiastole BVDV vaccine strains and separation strains is difficult to meet actual demand, thus establish one kind can be fast
Speed distinguishes bovine ephemeral diarrhea vaccine strain and the multiplex PCR and dedicated kit of now separation strains, can facilitate
Occur fast and accurately to diagnose epidemic disease in early days in epidemic disease, the prevention and control for epidemic disease provide effective reference.
Invention content
In view of this, the purpose of the present invention is to provide one kind to be used for bovine viral diarrhea virus now separation strains and vaccine
The primer sets and kit of strain antidiastole, the kit can quickly distinguish bovine viral diarrhea virus now separation strains and epidemic disease
Miao Zhu.
To achieve these goals, the technical solution adopted in the present invention is：
It is a kind of to be used for bovine viral diarrhea virus now separation strains and the primer sets of vaccine strain antidiastole, the primer
Group includes primer S1, S2, wherein：
S1：5’-ACTTAGCCTAGCACCACAT-3’；
S2：5’-CAATAAGCTTAGTCGACTGTATG-3’.
A kind of primer sets are being prepared for bovine viral diarrhea virus now separation strains and vaccine strain antidiastole
Application in kit.
A kind of bovine viral diarrhea virus of the primer sets now separation strains and vaccine strain differential diagnosis kit.
The kit further includes nucleic acid extracting reagent, Reverse Transcription, PCR amplification reagent, and/or Ago-Gel
Electrophoresis reagents.
The Reverse Transcription includes 10 × M-MLV buffer solutions, dNTP, M-MLV reverse transcriptase, RNase enzymes and inhibits
Agent, S2 primers.
The PCR amplification reagent includes 10 × PCR amplification buffer solution, dNTP, S1 primer, S2 primers, Taq DNA and gathers
Synthase and distilled water.
PCR amplification system constructed by the PCR amplification reagent is：10 × PCR amplification buffer solution, 5.0 μ L,
2.5mmol/L dNTP8.0 μ L, 1.0 μ L of 10mmol/L S1 primers, 1.0 μ L of 10mmol/L S2 primers, 5U/ μ L Taq DNA
1.0 μ L of polymerase, 3.0 μ L of template, add distilled water to 50 μ L.
A kind of application method of the kit, including nucleic acid extraction, reverse transcription, PCR amplification and Ago-Gel electricity
Swimming.
It further includes and the result of agarose gel electrophoresis is analyzed：When amplified fragments are 1472bp, then the ox in sample
Viral diarrhea virus is vaccine strain；When amplified fragments size is 824bp, then the bovine viral diarrhea virus in sample is now
Separation strains.
The PCR amplification condition is：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C extend
90s, totally 35 recycle；Last 72 DEG C of extensions 10min.
Beneficial effects of the present invention：
The present invention has found bovine ephemeral abdomen by comparing bovine viral diarrhea virus now separation strains and the difference of vaccine strain
Missing of the existing ground separation strains there are nucleotide is rushed down, specific primer S1, S2 is designed, bovine viral diarrhea virus can now be divided
Specific amplification is carried out from strain and vaccine strain；Dedicated kit is had developed on this basis, first extracts viral RNA, reuses S2
Primed reverse transcription synthesizes cDNA, and differentiates detection bovine viral diarrhea virus vaccines strain and now separation strains using PCR method, expands
It is 1472bp to increase vaccine strain to be expected amplified fragments size, and amplification now separation strains expection clip size is 824bp.With existing skill
Art is compared, dedicated kit of the invention tool by very strong sensibility, specificity, to hostis pecoris, ox blue tongue virus,
Ox Akabane Disease is viral, the amplification of ox protein virus is feminine gender, can be widely applied for clinical bovine viral diarrhea virus vaccines
The antidiastole of strain and now separation strains.
Specific embodiment
To make the objectives, technical solutions, and advantages of the present invention clearer, below in conjunction with specific embodiment, to this hair
Bright to be described in further detail, which is only used for explaining the present invention, is not intended to limit the scope of the present invention..
Experimental method used in following embodiments is the conventional method of this field or according to institute of manufactory unless otherwise specified
It is recommended that condition and implementation steps.
The structure of embodiment 1, differential diagnostic method
1st, design of primers
Two specific primers are designed, it is specific as follows:
S1：5’-ACTTAGCCTAGCACCACAT-3’(SEQ ID NO.1)
S2：5’-CAATAAGCTTAGTCGACTGTATG-3’(SEQ ID NO.2)
PCR amplification is carried out using S1 and S2, it is 1472bp that BVDV vaccine strains, which are expected amplified fragments size, and BVDV now divides
It is 824bp to be expected amplified fragments size from strain.
2nd, the extraction of viral RNA
Take BVDV strain cell culture fluids, after multigelation 3 times, 5000g centrifugation 15min take supernatant spare.
(1) 0.2ml chloroforms are taken, isometric supernatant is added in, acutely rocks 15s, are placed at room temperature for 3min, then 12,000g,
4 DEG C of centrifugation 5min.It is divided into 3 layers after centrifugation, nethermost red is phenol-chloroform phase, and a middle layer, upper strata is colourless water
Phase, RNA are present in water phase；
(2) upper strata aqueous phase in step (1) is transferred in the clean EP pipes of another, adds in the isopropyl of 0.5ml precoolings
Alcohol is stored at room temperature 10min, then 12,000g, 4 DEG C of centrifugation 10min；
(3) it outwells supernatant, adds in 75% ethyl alcohol washing RNA precipitate of 1ml volume fractions, after mixing, 7500g, 4 DEG C of centrifugations
5min；
(4) supernatant is outwelled, is placed at room temperature for 10min, is then added in right amount without RNAse water dissolutions RNA to get to total serum IgE.
3rd, reverse transcription
The RNA extracted using step 2 carries out reverse transcription as template, obtains cDNA, and reverse transcription reaction system is：
| Template ribonucleic acid | 4.9μL |
| S2 primers (10mmol/L) | 0.3μL |
| RTase enzyme inhibitors (40U/ μ L) | 0.3μL |
| M-MLV reverse transcriptase (200U/ μ L) | 0.5μL |
| dNTP(2.5mmol/L) | 2.0μL |
| 10 × M-MLV buffer solutions | 2.0μL |
Reaction condition is：42 DEG C of heat preservations 60min, 70 DEG C of 10min.
4th, PCR (PCR)
4.1 PCR reaction systems
The cDNA obtained using step 3 carries out PCR amplification as template, and PCR reaction systems are：
4.2 PCR reaction condition optimizations
The PCR reaction conditions of BVDV vaccine strains are optimized, respectively using annealing temperature as 54 DEG C, 55 DEG C, 56 DEG C, 57
DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C carry out PCR reaction amplification BVDV vaccine strains, reaction condition is：95
DEG C pre-degeneration 5min；94 DEG C of denaturation 30s, anneal 30s, 72 DEG C of extension 90s, totally 35 cycles；72 DEG C of extension 10min.It was found that
57 and 62 DEG C of segments that can amplify 1472bp sizes, it is in the same size with expection.
The PCR reaction conditions of existing the separation strains of BVDV are optimized, respectively using annealing temperature as 52 DEG C, 53 DEG C, 54
DEG C, 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C carry out existing the separation strains of PCR reaction amplification BVDV, reaction condition
For：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, anneal 30s, 72 DEG C of extension 90s, totally 35 cycles；72 DEG C of extension 10min.
It was found that occur the segment of 824bp sizes at 57 DEG C, it is in the same size with expection.
Summary reacts, and most the annealing temperature of composite PCR is set as 57 DEG C to the present invention at last, the reaction condition after optimization
For：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 90s, totally 35 recycle；Last 72 DEG C of extensions
10min.Pcr amplification product is placed in -20 DEG C of preservations.
5th, electrophoresis
To PCR product into row agarose gel electrophoresis, voltage 100V, electrophoresis 40min, under DNA gel imaging system instrument
Observe result.
The dedicated kit of the present invention includes nucleic acid extracting reagent, Reverse Transcription, PCR used in above-mentioned detection method
Amplifing reagent, agarose gel electrophoresis reagent.
The differential diagnostic method of existing the separation strains sample of embodiment 2, BVDV vaccine strains and BVDV
Using BVDV vaccine strains and BVDV, now separation strains as sample, are detected according to the method in embodiment 1 respectively, knot
Fruit shows that BVDV vaccine strains can obtain about 1472bp segments, and now separation strains amplified fragments size is 824bp segments to BVDV,
It is consistent with expection.
Embodiment 3, specificity experiments
Respectively using hostis pecoris, ox blue tongue virus, ox Akabane Disease virus, ox protein virus as control strain, with ox
Viral diarrhea virus is detected as experiment strain according to the method in embodiment 1, the results showed that, only BVDV vaccines
Now separation strains can respectively obtain 1472bp and 824bp segments with BVDV for strain, other viruses are generated without amplified band.It is real
It tests as a result, it was confirmed that the primer and detection method of the present invention have very high specificity.
Embodiment 4, sensitivity experiment
BVDV is showed into ground separation strains virus liquid and carries out 10 times of gradient dilutions, it is 5.4 × 10 to make virus concentration4-5.4 ×10- 4Copies/ μ L, and be detected according to the method for embodiment 1, the results showed that, in the 8th swimming lane a concentration of 5.4 × 10- 3Copies/ μ L it is amplifiable go out expected segment, the minimum detection of nucleic acids amount of primer of the invention and detection method is 5.4 × 10- 3Copies/ μ L, but the 9th swimming lane 5.4 × 10-4Segments of the copies/ μ L without expected size, judges its sensitivity for 5.4 × 10- 3copies/μL。
BVDV vaccine strains virus liquid is subjected to 10 times of gradient dilutions, it is 1.5 × 10 to make virus concentration4-1.0× 10- 4Copies/ μ L, and be detected according to the method for embodiment 1, the results showed that, in the 8th swimming lane a concentration of 1.5 × 10- 3Copies/ μ L it is amplifiable go out expected segment, the minimum detection of nucleic acids amount of primer of the invention and detection method is 1.5 × 10- 3Copies/ μ L, but the 9th swimming lane 1.5 × 10-4Segments of the copies/ μ L without expected size, judges its sensitivity for 1.5 × 10- 3copies/μL。
The above is only presently preferred embodiments of the present invention, not the present invention is imposed any restrictions, every according to the present invention
Any simple modification, change and the equivalent structure that technical spirit makees above example change, and still fall within skill of the present invention
In the protection domain of art scheme.
Sequence table
<110>Jia Yunyun, Chu Haixia, Zhao Chonghong, Guo Fan
<120>It is a kind of to be used for bovine viral diarrhea virus now separation strains and the primer sets and kit of vaccine strain antidiastole
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
acttagccta gcaccacat 19
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
caataagctt agtcgactgt atg 23
Claims (10)
1. a kind of be used for bovine viral diarrhea virus now separation strains and the primer sets of vaccine strain antidiastole, which is characterized in that
The primer sets include S1, S2, wherein：
S1：5’-ACTTAGCCTAGCACCACAT-3’；
S1：5’-CAATAAGCTTAGTCGACTGTATG-3’.
2. a kind of primer sets as described in claim 1 are used for bovine viral diarrhea virus now separation strains and vaccine strain in preparation
Application in differential diagnosis kit.
Now 3. separation strains differentiate a kind of bovine viral diarrhea virus comprising primer sets as described in claim 1 with vaccine strain
Diagnostic kit.
4. kit according to claim 3, which is characterized in that the kit further includes nucleic acid extracting reagent, anti-
Transcript reagent, PCR amplification reagent, and/or agarose gel electrophoresis reagent.
5. kit according to claim 4, which is characterized in that the Reverse Transcription is buffered including 10 × M-MLV
Liquid, dNTP, M-MLV reverse transcriptase, RNase enzyme inhibitors, S2 primers.
6. kit according to claim 4, which is characterized in that the PCR amplification reagent delays including 10 × PCR amplification
Fliud flushing, dNTP, S1 primer, S2 primers, Taq archaeal dna polymerases and distilled water.
7. kit according to claim 6, which is characterized in that the PCR amplification body constructed by the PCR amplification reagent
It is to be：10 × PCR amplification buffer solution, 5.0 μ L, 2.5mmol/L dNTP8.0 μ L, 1.0 μ L of 10mmol/L S1 primers, 10mmol/L
1.0 μ L of S2 primers, 1.0 μ L of 5U/ μ L Taq archaeal dna polymerases, 3.0 μ L of template, add distilled water to 50 μ L.
8. a kind of application method such as claim 3-7 any one of them kits, which is characterized in that including nucleic acid extraction,
Reverse transcription, PCR amplification and agarose gel electrophoresis.
9. the application method of kit according to claim 8, which is characterized in that further include to agarose gel electrophoresis
As a result it is analyzed：When amplified fragments are 1472bp, then the bovine viral diarrhea virus in sample is vaccine strain；Work as amplified fragments
Size is 824bp, then the bovine viral diarrhea virus in sample is now separation strains.
10. the application method of kit according to claim 8, which is characterized in that the PCR amplification condition is：95
DEG C pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 90s, totally 35 recycle；Last 72 DEG C of extensions
10min。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810296198.0A CN108251561A (en) | 2018-04-04 | 2018-04-04 | It is a kind of to be used for bovine viral diarrhea virus now separation strains and the primer sets and kit of vaccine strain antidiastole |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810296198.0A CN108251561A (en) | 2018-04-04 | 2018-04-04 | It is a kind of to be used for bovine viral diarrhea virus now separation strains and the primer sets and kit of vaccine strain antidiastole |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108251561A true CN108251561A (en) | 2018-07-06 |
Family
ID=62748045
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810296198.0A Withdrawn CN108251561A (en) | 2018-04-04 | 2018-04-04 | It is a kind of to be used for bovine viral diarrhea virus now separation strains and the primer sets and kit of vaccine strain antidiastole |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108251561A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108315498A (en) * | 2018-05-02 | 2018-07-24 | 郭庆君 | A kind of primer sets and kit of H3N2 hypotypes swine influenza virus strain and vaccine strain antidiastole |
| CN113174446A (en) * | 2021-01-19 | 2021-07-27 | 开江县动物疫病预防控制中心 | One-step double RT-PCR detection method for bovine viral diarrhea virus typing |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060286551A1 (en) * | 2005-06-17 | 2006-12-21 | Animal Health Research Institute, Council Of Agriculture, Executive Yuan | RT-PCR detection for differential diagnosis of field isolates or lapinized vaccine strain of classical swine fever virus (CSFV) in samples |
| CN102268488A (en) * | 2011-07-25 | 2011-12-07 | 武汉中博生物股份有限公司 | Fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit for detecting bovine viral diarrhea virus and application of kit |
| WO2013049822A2 (en) * | 2011-10-01 | 2013-04-04 | Life Technologies Corporation | Diagnostic method for determining animals persistently infected (pi) with bovine viral diarrhea virus (bvdv) |
| CN103343170A (en) * | 2013-07-26 | 2013-10-09 | 中国兽医药品监察所 | RT-PCR (reverse transcription-polymerase chain reaction) detection kit for bovine viral diarrhea viruses |
-
2018
- 2018-04-04 CN CN201810296198.0A patent/CN108251561A/en not_active Withdrawn
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060286551A1 (en) * | 2005-06-17 | 2006-12-21 | Animal Health Research Institute, Council Of Agriculture, Executive Yuan | RT-PCR detection for differential diagnosis of field isolates or lapinized vaccine strain of classical swine fever virus (CSFV) in samples |
| CN102268488A (en) * | 2011-07-25 | 2011-12-07 | 武汉中博生物股份有限公司 | Fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit for detecting bovine viral diarrhea virus and application of kit |
| WO2013049822A2 (en) * | 2011-10-01 | 2013-04-04 | Life Technologies Corporation | Diagnostic method for determining animals persistently infected (pi) with bovine viral diarrhea virus (bvdv) |
| CN103343170A (en) * | 2013-07-26 | 2013-10-09 | 中国兽医药品监察所 | RT-PCR (reverse transcription-polymerase chain reaction) detection kit for bovine viral diarrhea viruses |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108315498A (en) * | 2018-05-02 | 2018-07-24 | 郭庆君 | A kind of primer sets and kit of H3N2 hypotypes swine influenza virus strain and vaccine strain antidiastole |
| CN113174446A (en) * | 2021-01-19 | 2021-07-27 | 开江县动物疫病预防控制中心 | One-step double RT-PCR detection method for bovine viral diarrhea virus typing |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3636769B1 (en) | Sample nucleic acid measurement test kit, reagent, and application thereof | |
| CN103602757B (en) | The foundation of foot and mouth disease, vesicular stomatitis and swine pox multi-fluorescence RT-PCR detection method and application thereof | |
| CN103397107B (en) | Bovine viral diarrhea virus (BVDV) fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit | |
| CN106801109B (en) | RT-PCR detection specific primer, kit and detection method for swine atypical pestivirus | |
| CN108456747A (en) | A kind of multiple PCR detection kit differentiating pig circular ring virus | |
| Mamatha et al. | Molecular epidemiology and phylogenetic characterisation of Theileria luwenshuni in India: A first report | |
| CN110791592A (en) | Primer and kit for rapidly detecting African swine fever virus | |
| CN113025726A (en) | Primer, probe, kit and method for visual rapid detection of schistosoma japonicum nucleic acid by LFD-RPA | |
| CN110669870A (en) | Real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer, probe and detection kit for serotype of Palima serogroup virus | |
| CN108251561A (en) | It is a kind of to be used for bovine viral diarrhea virus now separation strains and the primer sets and kit of vaccine strain antidiastole | |
| CN102676698A (en) | PRV, PCV-2, PPV multiple PCR (Polymerase Chain Reaction) detection kit | |
| CN105986044B (en) | Avian influenza virus nucleic acid General rapid detection method | |
| CN103820580A (en) | Loop-mediated isothermal amplification (LAMP) diagnostic kit for porcine circovirus type 2 | |
| CN103276099A (en) | Primer and kit for fluorescent quatititive PCR (polymerase chain reaction) detection of helicobacter pylori | |
| CN101220397A (en) | Reagent kit special for testing high pathogenicity pig replication and syndrome virus variation strain | |
| CN102876813B (en) | Real-time fluorescence RT-HDA (Reverse Transcriptase-Helicase-Dependent Isothermal Amplification) kit and primer for detecting avian influenza virus | |
| CN107475450A (en) | A kind of primer sets and kit for the strain of Porcine epidemic diarrhea virus novel variant and vaccine strain antidiastole | |
| CN101487064A (en) | Method and special reagent kit for detecting five zoonosis virus | |
| CN101875974A (en) | Primer group for detecting Bordetella pertussis, detection test kit and detection method | |
| CN105002169A (en) | Fluorescent quantitative RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection kit for duck hepatitis virus type 3 and application and method thereof | |
| CN108060272A (en) | A kind of quick differentiation pig Delta coronavirus and the multiple PCR detection primer group and kit of pig ridge virus | |
| EP1583556A1 (en) | Sequences diagnostic for foot and mouth disease | |
| CN104293981A (en) | Gene chip and kit for detecting swine epidemic encephalitis B viruses (SEEBVs) and/or swine fever viruses (SFVs) | |
| ES2717793T3 (en) | Method for the specific detection of the virus of the classic swine fever | |
| CN111235289A (en) | Specific PCR primer for detecting mycoplasma capricolum goat pneumonia subspecies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20180706 |