CN106916886A - A kind of gene primer of dynamin-related proteins 1 and its preparation method of cRNA in situ hybridization probes for FISH - Google Patents
A kind of gene primer of dynamin-related proteins 1 and its preparation method of cRNA in situ hybridization probes for FISH Download PDFInfo
- Publication number
- CN106916886A CN106916886A CN201710033286.7A CN201710033286A CN106916886A CN 106916886 A CN106916886 A CN 106916886A CN 201710033286 A CN201710033286 A CN 201710033286A CN 106916886 A CN106916886 A CN 106916886A
- Authority
- CN
- China
- Prior art keywords
- drp1
- crna
- room temperature
- probe
- histotomy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
It is used for the preparation method of the probe of the primer and its cRNA in situ hybridizations of FISH the invention discloses a kind of dynamin-related proteins 1 (dynamin related protein 1, drp1) gene, in accordance with the following steps：(1) the Gene bank sequences according to drp1 genes, we devise 3 pairs of special primers of drp1, and amplify the corresponding sequence of drp1 genes to this primer respectively, used as the special probe sequence of drp1 albumen；(2) the probe plasmid of the cRNA in situ hybridizations of drp1 is built；After by probe plasmid transform bacteria, it is sequenced after Bacteria Culture；(3) the cRNA in situ hybridization probes of drp1 are prepared；(4) in situ hybridization of the cRNA probes of detection drp1.
Description
Technical field：
The invention belongs to biomedical sector, it is related to the three of gene kinds of probes and its methods for designing, it is especially a kind of
Probe of the gene cRNA in situ hybridizations of dynamin-related proteins 1 and preparation method thereof.
Background technology：
Neuron as nervous system basic structure and functional unit, with high degree of polarization cell, aixs cylinder and dendron, often
Big energy is needed to maintain normal neuronal loop.And mitochondria continues the place of energy supply as cell, in the development of neuron
And played a significant role in function.Wherein mitochondrial quantity, quality and distribution three directly determine the function of neuron.
Mitochondria shows that modal dynamics changes, in constantly fusion with fission process.It is mitochondrial to melt
The maintenance closed with the homeostasis process for dividing to normal intracellular stable state and physiological function is most important.Wherein power correlation egg
White 1 (dynamin-related protein 1, drp1) is the key protein for regulating and controlling chondriokinesis.In chondriokinesis mistake
Drp1 is transferred on mitochondrial outer membrane in journey, is assembled and oligomerization, and mitochondrial outer membrane is split into by GTP hydrolysises
Two parts.And divide albumen and be mainly by the binding to drp1 and raise promotion division.Research finds that the activity of Drp1 is also
It is closely coupled with various nerve degenerative diseases.Therefore, we will be helpful to the research of drp1 and deeply understands that mitochondria exists
Critical function meaning in nervous system, for the study of incident mechanism of disease provides new thinking, to search out new treatment
Target spot.
Fluorescence in situ hybridization technique is according to known special DNA sequence dna, design synthesis specific oligos probe, profit
With nucleotide hybridization complementary in fluorescence labeling and organism, accurate quantification positioning is carried out by fluorescence, detect organism center
The presence of thuja acid and gene expression abundance.And on rich using fluorescence in situ hybridization technique detection drp1 genes mRNA in living animal
Degree display still belongs to blank.
The content of the invention：
Shortcoming it is an object of the invention to overcome above-mentioned prior art, there is provided a kind of gene of dynamin-related proteins 1 is used for
The design and preparation method of the primer and probe of FISH.
The purpose of the present invention is solved by the following technical programs：
A kind of probe of the gene cRNA in situ hybridizations of dynamin-related proteins 1, same gene finds out three from centre respectively
Plant different size of fragment and design and synthesize primer.
The sequence of drp1 genetic fragments 1 is：
5'GCTCAGTGCTGGAAAGCCTAGTGGGCAGGGACCTTCTTCCCAGAGGAACTGGTGTGGTCACCCGGAG
ACCTCTCATTCTGCAGCTAGTCCACGTTTCACCAGAAGATAAAAGAAAAACAACAGGAGAAGAAAATGAAATTTCAG
AGCTGGAGAGTTGAAGCAGAAGAATGGGGTAAATTTCTTCACACCAAAAACAAGCTTTACACAGATTTTATGAAATT
CGACAAGAAATTGAAAATGAAACTGAAAGAATTTCAGGAAATAATAAGGGGGTAAGCCCTGAGCCAATCCATC3′
The sequence of drp1 genetic fragments 2 is：
5'TTCGTAAAAGGTTGCCCGTGACAAATGAAATGGTGCATAACTTAGTGGCAATTGAGCTAGCGTATAT
CAACACAAAACACCCCGACTTTGCTGATGCCTGTGGGCTAATGAACAATAATATAGAGGAACAAAGAAGAAACAGGC
TAGCAAGAGAGCTGCCTTCAGCTGGATCACGGGACAAGTTAATTCAGGACAACAGAAGAGAAACTAAAAATGTCCCA
TCTGCAGGTGGTGGGATTGGAGACGGTGGTCAGGAACCAACAACA3′
The sequence of drp1 genetic fragments 3 is：
5'CATCTGCAGGTGGTGGGATTGGAGACGGTGGTCAGGAACCAACAACAGGCAACTGGAGAGGAATGCT
GAAAACTTCAAAAGCTGAAGAATTACTTGCTGAAGAAAAATCAAAACCAATTCCAATTATGCCAGCAAGTCCACAGA
AAGGCCATGCTGTCAATTTGCTAGATGTGCCAGTTCCAGTTGCAA 3′
The preparation method of the probe：
(1) the Gene bank sequences according to drp1 genes we devise 3 pairs of special primers of drp1；
(2) the probe plasmid of the cRNA in situ hybridizations of drp1 genes is built；After probe plasmid transform bacteria, Bacteria Culture
After be sequenced；
(3) the cRNA in situ hybridization probes of drp1 genes are prepared；
(4) in situ hybridization of the cRNA probes of detection drp1 genes.
Step (1) the drp1 genes 3 are as follows to primer：
The step (2) is carried out in accordance with the following steps：
A the cDNA of mouse is entered performing PCR and expanded by () respectively with the special primer of 3 couple of drp1 genes；
B PCR primer is carried out glue reclaim by () with OMEGA glue reclaims kit；
C product after recovery is had T7, SP6 by () using TA cloning vector kits in room temperature and MCS two ends
The carrier of promoter is attached；
D plasmid conversion bacillus coli DH 5 alpha that () will connect, culture；
E () is sequenced after extracting probe plasmid with plasmid extraction kit using day；
The step (3) is carried out in accordance with the following steps：
A the bacterium for the arriving sequencing of () step (2) is correct after, the order through judging to confirm drp1 probe sequence insertion vectors is
Positive；
B () is template so that correct drp1 probes plasmid is sequenced, using T7, SP6 special primers enter performing PCR amplification；
C PCR primer is carried out glue reclaim by () with OMEGA glue reclaims kit；
D () carries out in-vitro transcription mark with T7-RNA polymerases/SP6-RNA polymerases to probe；
The step (4) is carried out in accordance with the following steps：
A () is drawn materials and fixed investing tissue and section；
The materials and fixed mode：By mouse with the deep fiber crops of 7% chloraldurate after, through left ventricle with 0.01mol/L's
DEPC-PBS gets removal blood express developed, then with the fixed 24h of 4%DEPC- paraformaldehydes perfusion；Tissue is shifted and is immersed in
It is dehydrated in 30% sucrose solution to sinking to the bottom 48h；
Described 0.01mol/L DEPC-PBS are 2.9g Na2HPO4·12H2O, 0.29g NaH2PO4·12H2O, 9.0g
NaCl ddH2After O is settled to 1L, add after the DEPC 1ml that percent by volume is 0.1% stand overnight, autoclaving system
Into phosphate buffer；
Described 4% paraformaldehyde is after 40g paraformaldehydes add the heating of 500ml distilled water to be allowed to depolymerization dissolving, then adds
The 0.2mol/L PB buffer solutions for entering 500ml are settled to 1000ml, the final concentration of 0.1mol/L of PB；
The 0.2mol/LPB buffer solutions are 29.01g Na2HPO4·12H2O, 2.965NaH2PO4·12H2O adds ddH2O
1000ml is settled to, is added after the DEPC 1ml that percent by volume is 0.1% stand overnight, the phosphate that autoclaving is made
Buffer solution；
Investing tissue's method：Fixed tissue embedding medium OTC is taken out to embed；Embedded tissue is cut
Piece：Tissue is cut into 25~30 μm of histotomies, and the section that will be cut is stored in the DEPC-PBS of 0.01mol/L, is put in 4
DEG C refrigerator is standby；
Through containing 2%H under the above-mentioned histotomy of (b) selection and room temperature condition2O20.1mol/L DEPC-PB treatment
10min is blocking endogenous peroxydase；
C () processes 20min with the 0.1mol/L DEPC-PB of 0.3%TritonX-100；
D () processes histotomy 10min with acetylation liquid；
E () is cut into slices 2 times with 0.1mol/L DEPC-PB cleansing tissues, each 10min；
Then f be put into tissue in prehybridization solution by (), 58-60 DEG C of prehybridization 1h is to close non-specific binding as point；
The prehybridization solution 1ml is by the deionized formamide of 500ul, the 20x SSC solution of 250ul, the 10% of 200 μ l
Blocking agent, 50ul 2% NLS solution, the 10% SDS solution of 10ul is formulated.
10% blocking agent is to be dissolved in the maleate buffer of 0.1M being formulated by the blocking agent of 4g；The 0.1M
Maleate buffer is 464mg maleic acids, and the NaCl of 351mg is dissolved in ddH2In O, PH is adjusted to 7.5 using NaOH, be settled to
40ml, autoclaving.
G () adds the final concentration of 1ng/ul of drp1 probes, the constant-temperature incubation in 58-60 DEG C of hybrid heater in prehybridization solution
16-20h；
The histotomy of hybridization, 58 DEG C, 2 times, each 20min are washed after (h) hybridization with wash buffer；
The wash buffer 10ml are by the deionized formamide of 5ml, the 20x SSC solution of 1ml, 500ul 2%
NLS be dissolved in ddH2O in be formulated；
L () washs above-mentioned histotomy with RNase buffer, be incubated at room temperature 5min；
The RNase buffer10ml are dissolved in ddH for 1M TRis-HCl, PH8.0,0.5M EDTA, 5M NaCl2In O
It is formulated；
J () adds the RNase A treatment of final concentration of 20ug/ml, 37 DEG C of constant-temperature incubation 30min are uncombined to digest
CRNA probes；
K () uses 2x SSC, 2%NLS washs above-mentioned histotomy, 37 DEG C of constant-temperature incubations 2 times, each 20min；
L () uses 0.2x SSC, 2%NLS washs above-mentioned histotomy, 37 DEG C of constant-temperature incubations 2 times, each 20min；
M be placed on histotomy in TS7.5 solution and be incubated at room temperature 5min by ()；The TS7.5 by 1M TRis-HCl,
PH8.0,5M NaCl are dissolved in ddH2It is formulated in O；
(n) room temperature closing 1h in TBS by histotomy；
The TBS is the TS7.5 solution containing 1% blocking agent；
O () adds DigiTAb in histotomy, potency is 1:100-1:1500, incubation at room temperature is overnight；
P () is by room temperature washing 2 times, each 10min in above-mentioned section TNT；
Q () will be cut into slices with 0.1mol/L PB room temperature washings 10min；
R () adds β-D-Glucose (200mg/ml) 1:100 dilutions, are incubated at room temperature 30min；
S () will be cut into slices with 0.1mol/L PB room temperature washings 10min；Room temperature washing 2 times in TNT, each 10min；
T () adds and contains FITC-avidin (1:500) TBS solution lucifuge incubation at room temperature 3h；
U () is by room temperature washing 3 times, each 10min in above-mentioned section TNT；
V () uses fluorescence mountant by above-mentioned histotomy mounting, fluorescence microscopy Microscopic observation.
The beneficial effects of the invention are as follows：The present invention is irrigated after model is set up to living animal, draws materials, cuts into slices, and passes through
There is specific combination in the cRNA probes of digoxigenin labeled, add fluorescence antibody with the mRNA of drp1 genes in tissue, conveniently,
Accurately observe the change of drp1 gene mRNA levels in tissue.The probe sequence of the dynamin-related proteins 1 that the present invention is used,
Clear and definite specificity is shown to the gene mRNA of dynamin-related proteins 1, is realized and the display of drp1 gene mRNA levels is made
With.
Brief description of the drawings：
Fig. 1 is that the primer 1 of drp1 of the invention is schemed in corticocerebral X60 times of distribution；
Fig. 2 is that the primer 2 of drp1 of the invention is schemed in corticocerebral X60 times of distribution；
Fig. 3 is that the primer 3 of drp1 of the invention is schemed in corticocerebral X60 times of distribution；
Specific embodiment：
The present invention is described in further detail below in conjunction with the accompanying drawings：
Referring to Fig. 1, Fig. 2 and Fig. 3, the preparation method of drp1 gene cRNA in situ hybridization probes, in accordance with the following steps
(1) the Gene bank sequences according to drp1 genes we design synthesis 3 pairs of primers of drp1 gene specifics, and
Amplification respectively prepares cRNA probes；
(2) the probe plasmid of the cRNA in situ hybridizations of drp1 genes is built；After probe plasmid transform bacteria, Bacteria Culture
After be sequenced；
(3) the cRNA in situ hybridization probes of drp1 genes are prepared；
(4) in situ hybridization of the cRNA probes of detection drp1 genes.
The design of probe：
We design the primer for having synthesized 3 pairs of drp1 gene specifics for Gene bank sequences according to drp1 genes, and point
CRNA probes Kuo Zeng not prepared；
3 pairs of special primers of drp1 genes are as follows：
The structure of the probe plasmid of the cRNA in situ hybridizations of drp1 genes：
1. the cDNA of mouse is entered into performing PCR respectively with three pairs of primers to expand；
2. PCR primer is carried out into glue reclaim with OMEGA glue reclaims kit；
3. the product after recovery had into T7, SP6 using TA cloning vector kits in room temperature and MCS two ends
The carrier of promoter is attached；
4. after the plasmid transform bacteria that will be connected, shake bacterium culture and extract plasmid and serve Hai Shenggong companies and be sequenced.
The preparation of the cRNA in situ hybridization probes of drp1 genes：
1. after being sequenced correctly, through judging to confirm that drp1 genes 3 are positive to the order of probe sequence insertion vector；
2. it is template so that correct drp1 probes plasmid is sequenced, using T7, SP6 special primers enter performing PCR amplification；
3. PCR primer is carried out into glue reclaim with OMEGA glue reclaims kit.
4. in-vitro transcription mark, the kit of in-vitro transcription are carried out to probe with T7-RNA polymerases/SP6-RNA polymerases
(Ambion MEGAscript) is the product of Ambion companies.
The in situ hybridization detection of the cRNA probes of drp1 genes：
1. draw materials and fixed investing tissue and section；
The method of drawing material：By mouse with the deep fiber crops of 7% chloraldurate after, through the left ventricle DEPC-PBS of 0.01mol/L
Get removal blood express developed, then with the fixed 24h of 4%DEPC- paraformaldehydes perfusion；
The fixing organization method：Tissue is shifted and is immersed in 30% sucrose solution and is dehydrated to sinking to the bottom 48h；
Investing tissue's method：Fixed tissue embedding medium OTC is taken out to embed；Embedded tissue is cut
Piece：Tissue is cut into 25~30 μm of histotomies, and the section that will be cut is stored in the DEPC-PBS of 0.01mol/L, is put in 4
DEG C refrigerator is standby；
2. choose under above-mentioned histotomy and room temperature condition through containing 2%H2O20.1mol/L DEPC-PB treatment 10min
To block endogenous peroxydase；
3. 20min is processed with the 0.1mol/L DEPC-PB of 0.3%TritonX-100；
4. histotomy 10min is processed with acetylation liquid；
5. cut into slices 2 times with 0.1mol/L DEPC-PB cleansing tissues, each 10min；
6. then tissue is put into prehybridization solution, 58-60 DEG C of prehybridization 1h is to close non-specific binding as point；
7. drp1 probes final concentration of 1ng/ul, the constant-temperature incubation 16- in 58-60 DEG C of hybrid heater are added in prehybridization solution
20h；
8. the histotomy of hybridization, 58 DEG C, 2 times, each 20min are washed after hybridizing with wash buffer；
9. above-mentioned histotomy is washed with RNase buffer, 5min is incubated at room temperature；
10. the RNase A treatment of final concentration of 20ug/ml is added, and 37 DEG C of constant-temperature incubation 30min are uncombined to digest
CRNA probes；
11. use 2x SSC, and 2%NLS washs above-mentioned histotomy, 37 DEG C of constant-temperature incubations 2 times, each 20min；
12 use 02x SSC, and 2%NLS washs above-mentioned histotomy, 37 DEG C of constant-temperature incubations 2 times, each 20min；
Histotomy is placed in TS7.5 solution and is incubated at room temperature 5min by 13.；The TS7.5 by 1M TRis-HCl,
PH8.0,5M NaCl are dissolved in ddH2It is formulated in O；
14. by histotomy in TBS room temperature closing 1h；
15. add DigiTAb in histotomy, and potency is 1:100-1:1500, incubation at room temperature is overnight；
16. by room temperature washing 2 times, each 10min in above-mentioned section TNT；
17. will cut into slices with 0.1mol/L PB room temperature washings 10min；
18. add β-D-Glucose (200mg/ml) 1:100 dilutions, are incubated at room temperature 30min；
19. will cut into slices with 0.1mol/L PB room temperature washings 10min；By room temperature washing 2 times in above-mentioned section TNT, every time
10min；
20. add containing FITC-avidin (1:500) TBS solution lucifuge incubation at room temperature 3h；
21. by room temperature washing 3 times, each 10min in above-mentioned section TNT；
22. use fluorescence mountant by above-mentioned histotomy mounting, fluorescence microscopy Microscopic observation.
Agents useful for same：
OMEGA glue reclaim kits, company：OMEGA, article No.：D2500-01
Plasmid extraction kit, company：It is with article No.：DP103-02
TA Cloning Kits, company：Invitrogen, article No.：450640
Two ends have T7, the carrier of SP6 promoters, company：Invitrogen article No.s：AM1322
T7 rna polymerase kit, company：ROCHE article No.s：11685619910
SP6RNA polymerase kits, company：ROCHE article No.s：11685619910
20x SSC companies：Invitrogen, article No.：AM9763
Anti-Digoxigenin-POD, company：ROCHE, article No.：11207733910
Anti-Fluorescein-POD, company：ROCHE, article No.：11426346910
Lab VisionTMLiquid Fast-Red Substrate System, company：Thermo ScientificTM
TA-060-AL
The above, is only presently preferred embodiments of the present invention, and any formal limitation is not made to the present invention, though
So the present invention is disclosed above with preferred embodiment, but is not limited to the present invention, any to be familiar with this professional technology people
Member, without departing from the scope of the present invention, when using the method and technology contents of the disclosure above make it is a little more
Move or be modified to the Equivalent embodiments of equivalent variations, as long as being the content without departing from technical solution of the present invention, according to of the invention
Any simple modification, equivalent variations and modification that technical spirit is made to above example, still fall within technical solution of the present invention
In the range of.
Claims (5)
1. the preparation method of the cRNA in situ hybridization probes of a kind of gene of dynamin-related proteins 1 for FISH, its
It is characterised by, in accordance with the following steps：
(1) the Gene bank sequences according to drp1 genes, design three pairs of special primers of drp1, and this is specifically drawn respectively
Thing amplifies the corresponding sequence of drp1 genes, and the sequence is used as the special probe sequence of drp1 albumen；
(2) the probe plasmid of the cRNA in situ hybridizations of drp1 is built；After by probe plasmid transform bacteria, surveyed after Bacteria Culture
Sequence；
(3) the cRNA in situ hybridization probes of drp1 are prepared；
(4) in situ hybridization of the cRNA probes of detection drp1.
2. the preparation method based on cRNA in situ hybridizations probe described in claim 1, it is characterised in that the probe sequence is：
The sequence of drp1 genetic fragments 1 is：
5'GCTCAGTGCTGGAAAGCCTAGTGGGCAGGGACCTTCTTCCCAGAGGAACTGGTGTGGTCACCCGGAGACCT
CTCATTCTGCAGCTAGTCCACGTTTCACCAGAAGATAAAAGAAAAACAACAGGAGAAGAAAATGAAATTTCAGAGCT
GGAGAGTTGAAGCAGAAGAATGGGGTAAATTTCTTCACACCAAAAACAAGCTTTACACAGATTTTATGAAATTCGAC
AAGAAATTGAAAATGAAACTGAAAGAATTTCAGGAAATAATAAGGGGGTAAGCCCTGAGCCAATCCATC3′
The sequence of drp1 genetic fragments 2 is：
5'TTCGTAAAAGGTTGCCCGTGACAAATGAAATGGTGCATAACTTAGTGGCAATTGAGCTAGCGTATATCAAC
ACAAAACACCCCGACTTTGCTGATGCCTGTGGGCTAATGAACAATAATATAGAGGAACAAAGAAGAAACAGGCTAGC
AAGAGAGCTGCCTTCAGCTGGATCACGGGACAAGTTAATTCAGGACAACAGAAGAGAAACTAAAAATGTCCCATCTG
CAGGTGGTGGGATTGGAGACGGTGGTCAGGAACCAACAACA3′
The sequence of drp1 genetic fragments 3 is：
5'CATCTGCAGGTGGTGGGATTGGAGACGGTGGTCAGGAACCAACAACAGGCAACTGGAGAGGAATGCTGAAA
ACTTCAAAAGCTGAAGAATTACTTGCTGAAGAAAAATCAAAACCAATTCCAATTATGCCAGCAAGTCCACAGAAAGG
CCATGCTGTCAATTTGCTAGATGTGCCAGTTCCAGTTGCAA3′。
3. based on cRNA in situ hybridizations probe described in claim 1 preparation method, it is characterised in that the step (2) according to
Following steps are carried out：
A the cDNA of mouse is entered performing PCR and expanded by () respectively with the special primer of 3 couple of drp1 genes；
B PCR primer is carried out glue reclaim by () with OMEGA glue reclaims kit；
C product after recovery in room temperature and MCS two ends there is T7, SP6 to start by () using TA cloning vector kits
The carrier of son is attached；
D plasmid conversion bacillus coli DH 5 alpha that () will connect, culture；
E () is sequenced after extracting probe plasmid with plasmid extraction kit using day.
4. based on cRNA in situ hybridizations probe described in claim 1 preparation method, it is characterised in that the step (3) according to
Following steps are carried out：
A the bacterium for the arriving sequencing of () step (2) is correct after, through judging that the order for confirming drp1 probe sequence insertion vectors is positive
's；
B () is template so that correct drp1 probes plasmid is sequenced, using T7, SP6 special primers enter performing PCR amplification；
C PCR primer is carried out glue reclaim by () with OMEGA glue reclaims kit；
D () carries out in-vitro transcription mark with T7-RNA polymerases/SP6-RNA polymerases to probe.
5. based on cRNA in situ hybridizations probe described in claim 1 preparation method, it is characterised in that the step (4) according to
Following steps are carried out：
A () is drawn materials and fixed investing tissue and section；
The materials and fixed mode：By mouse with the deep fiber crops of 7% chloraldurate after, through the left ventricle DEPC- of 0.01mol/L
PBS gets removal blood express developed, then with the fixed 24h of 4%DEPC- paraformaldehydes perfusion；Tissue is shifted and 30% sugarcane is immersed in
It is dehydrated in sugar juice to sinking to the bottom 48h；
Described 0.01mol/L DEPC-PBS are 2.9g Na2HPO4·12H2O, 0.29g NaH2PO4·12H2O, 9.0g
NaCl ddH2After O is settled to 1L, add after the DEPC 1ml that percent by volume is 0.1% stand overnight, autoclaving system
Into phosphate buffer；
Described 4% paraformaldehyde is after 40g paraformaldehydes add the heating of 500ml distilled water to be allowed to depolymerization dissolving, to add
The 0.2mol/L PB buffer solutions of 500ml are settled to 1000ml, the final concentration of 0.1mol/L of PB；
The 0.2mol/LPB buffer solutions are 29.01g Na2HPO4·12H2O, 2.965NaH2PO4·12H2O adds ddH2O is settled to
1000ml, adds after the DEPC 1ml that percent by volume is 0.1% stand overnight, the phosphate-buffered that autoclaving is made
Liquid；
Investing tissue's method：Fixed tissue embedding medium OTC is taken out to embed；Embedded tissue is cut into slices：Will
Tissue is cut into 25~30 μm of histotomies, and the section that will be cut is stored in the DEPC-PBS of 0.01mol/L, is put in 4 DEG C of ice
Case is standby；
Through containing 2%H under the above-mentioned histotomy of (b) selection and room temperature condition2O20.1mol/L DEPC-PB treatment 10min with
Blocking endogenous peroxydase；
C () processes 20min with the 0.1mol/L DEPC-PB of 0.3%TritonX-100；
D () processes histotomy 10min with acetylation liquid；
E () is cut into slices 2 times with 0.1mol/L DEPC-PB cleansing tissues, each 10min；
Then f be put into tissue in prehybridization solution by (), 58-60 DEG C of prehybridization 1h is to close non-specific binding as point；
The prehybridization solution 1ml is by the deionized formamide of 500ul, the 20x SSC solution of 250ul, 10% blocking of 200 μ l
Agent, 50ul 2% NLS solution, the 10% SDS solution of 10ul is formulated.
10% blocking agent is to be dissolved in the maleate buffer of 0.1M being formulated by the blocking agent of 4g；
The 0.1M maleate buffers are 464mg maleic acids, and the NaCl of 351mg is dissolved in ddH2In O, using NaOH adjust PH to
7.5, it is settled to 40ml, autoclaving.
G () adds drp1 probes final concentration of 1ng/ul, the constant-temperature incubation 16- in 58-60 DEG C of hybrid heater in prehybridization solution
20h；
The histotomy of hybridization, 58 DEG C, 2 times, each 20min are washed after (h) hybridization with wash buffer；
The wash buffer 10ml are by the deionized formamide of 5ml, the 20x SSC solution of 1ml, the NLS of 500ul2%
It is dissolved in ddH2O and is formulated；
I () washs above-mentioned histotomy with RNase buffer, be incubated at room temperature 5min；
The RNase buffer10ml are prepared for 1M TRis-HCl, PH8.0,0.5M EDTA, 5M NaCl are dissolved in ddH2O
Form；
J () adds the RNase A treatment of final concentration of 20ug/ml, 37 DEG C of constant-temperature incubation 30min, to digest uncombined cRNA
Probe；
K () uses 2x SSC, 2%NLS washs above-mentioned histotomy, 37 DEG C of constant-temperature incubations 2 times, each 20min；
L () uses 0.2x SSC, 2%NLS washs above-mentioned histotomy, 37 DEG C of constant-temperature incubations 2 times, each 20min；
M be placed on histotomy in TS7.5 solution and be incubated at room temperature 5min by ()；The TS7.5 is by 1MTRis-HCl, PH8.0,5M
NaCl is dissolved in ddH2It is formulated in O；
(n) room temperature closing 1h in TBS by histotomy；The TBS is the TS7.5 solution containing 1% blocking agent；
O () adds DigiTAb in histotomy, potency is 1:100-1:1500, incubation at room temperature is overnight；
P () is by room temperature washing 2 times, each 10min in above-mentioned section TNT；
Q () will be cut into slices with 0.1mol/L PB room temperature washings 10min；
R () adds β-D-Glucose (200mg/ml) 1:100 dilutions, are incubated at room temperature 30min；
S () will be cut into slices with 0.1mol/L PB room temperature washings 10min；Room temperature washing 2 times in TNT, each 10min；
T () adds and contains FITC-avidin (1:500) TBS solution lucifuge incubation at room temperature 3h；
U () is by room temperature washing 3 times, each 10min in above-mentioned section TNT；
V () uses fluorescence mountant by above-mentioned histotomy mounting, fluorescence microscopy Microscopic observation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710033286.7A CN106916886A (en) | 2017-01-18 | 2017-01-18 | A kind of gene primer of dynamin-related proteins 1 and its preparation method of cRNA in situ hybridization probes for FISH |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710033286.7A CN106916886A (en) | 2017-01-18 | 2017-01-18 | A kind of gene primer of dynamin-related proteins 1 and its preparation method of cRNA in situ hybridization probes for FISH |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106916886A true CN106916886A (en) | 2017-07-04 |
Family
ID=59453424
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710033286.7A Pending CN106916886A (en) | 2017-01-18 | 2017-01-18 | A kind of gene primer of dynamin-related proteins 1 and its preparation method of cRNA in situ hybridization probes for FISH |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106916886A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107574228A (en) * | 2017-09-18 | 2018-01-12 | 中国人民解放军第四军医大学 | The gene cRNA probes of mouse Shank 3 and in situ hybridization coloration method |
| CN109988846A (en) * | 2019-03-11 | 2019-07-09 | 浙江省淡水水产研究所 | A method of suitable for red claw crayfish gonadal tissue mRNA paraffin section in situ hybridization |
| CN116716424A (en) * | 2022-11-18 | 2023-09-08 | 黑龙江省林业科学研究所 | Fluorescent in-situ hybridization identification probe and identification method for Cephalosporium falciparum |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321766A (en) * | 2011-09-16 | 2012-01-18 | 中国人民解放军第四军医大学 | Fluorescence in situ two-hybridization method |
| CN102559904A (en) * | 2012-02-01 | 2012-07-11 | 中国人民解放军第四军医大学 | Excitatory amino-acid transporter-3 gene cRNA in-situ hybridization probes and preparation method thereof |
-
2017
- 2017-01-18 CN CN201710033286.7A patent/CN106916886A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321766A (en) * | 2011-09-16 | 2012-01-18 | 中国人民解放军第四军医大学 | Fluorescence in situ two-hybridization method |
| CN102559904A (en) * | 2012-02-01 | 2012-07-11 | 中国人民解放军第四军医大学 | Excitatory amino-acid transporter-3 gene cRNA in-situ hybridization probes and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| CHOI SY等: "Drp1-mediated mitochondrial dynamics and survival of developing chick motoneurons during the period of normal programmed cell death", 《FASEB JOURNAL》 * |
| 武晓敏等: "小鼠Brd2基因探针的制备及其在荧光原位杂交实验中的应用", 《神经解剖学杂志》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107574228A (en) * | 2017-09-18 | 2018-01-12 | 中国人民解放军第四军医大学 | The gene cRNA probes of mouse Shank 3 and in situ hybridization coloration method |
| CN107574228B (en) * | 2017-09-18 | 2020-06-09 | 中国人民解放军第四军医大学 | Mouse Shank3 gene cRNA probe and in-situ hybridization color development method |
| CN109988846A (en) * | 2019-03-11 | 2019-07-09 | 浙江省淡水水产研究所 | A method of suitable for red claw crayfish gonadal tissue mRNA paraffin section in situ hybridization |
| CN109988846B (en) * | 2019-03-11 | 2023-05-26 | 浙江省淡水水产研究所 | Method suitable for in situ hybridization of red swamp crayfish gonad tissue mRNA paraffin section |
| CN116716424A (en) * | 2022-11-18 | 2023-09-08 | 黑龙江省林业科学研究所 | Fluorescent in-situ hybridization identification probe and identification method for Cephalosporium falciparum |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230340596A1 (en) | Method for transposase-mediated spatial tagging and analyzing genomic dna in a biological sample | |
| US20200407781A1 (en) | Method for transposase-mediated spatial tagging and analyzing genomic dna in a biological sample | |
| Urbanek et al. | Small RNA detection by in situ hybridization methods | |
| Qiu et al. | A targeted, self-delivered, and photocontrolled molecular beacon for mRNA detection in living cells | |
| CN106916886A (en) | A kind of gene primer of dynamin-related proteins 1 and its preparation method of cRNA in situ hybridization probes for FISH | |
| Huang et al. | Catalytic-hairpin-assembly-assisted DNA tetrahedron nanoprobe for intracellular microRNA imaging | |
| Kimura et al. | Orphan G protein-coupled receptor, GPR41, induces apoptosis via a p53/Bax pathway during ischemic hypoxia and reoxygenation | |
| CN106434982B (en) | The relevant molecular marked compound of cerebral arterial thrombosis and its application | |
| CN1918305B (en) | Method of detecting nucleic acid and utilization therof | |
| CN109468382A (en) | Application of the lncRNA in adenocarcinoma of lung diagnosis and treatment | |
| Song et al. | Intracellular Logic Computation with Framework Nucleic Acid‐Based Circuits for mRNA Imaging | |
| CN102041316A (en) | Application of micro ribonucleic acid (miRNA)-219 compound as marker of brain glioma | |
| MXPA05011404A (en) | Preservation of rna in a biological sample. | |
| CN104878011B (en) | Applications of the long-chain non-coding RNA AFAP1-AS1 on preparing breast cancer real time fluorescent quantitative auxiliary diagnosis preparation | |
| CN113817845A (en) | miRNA (micro ribonucleic acid) molecule related to porcine luminal ovarian follicle atresia and application thereof | |
| CN1732271B (en) | Methods and compositions for detecting telomerase activity | |
| Li et al. | Transfection of molecular beacons in microchannels for single-cell gene-expression analysis | |
| CN106480196B (en) | A kind of application of long-chain non-coding RNA LINC00152 | |
| CN105506154A (en) | Application of long non-coding RNA LOC284454 reagent in in-situ hybridization detection of nasopharyngeal carcinoma tissues | |
| Rogachev et al. | Qualitative and quantitative characteristics of the extracellular DNA delivered to the nucleus of a living cell | |
| Simmons et al. | In situ hybridization (both radioactive and nonradioactive) and spatiotemporal gene expression analysis | |
| Dutta et al. | Development of a rapid RNA extraction procedure from urediniospores of the leaf rust fungus, Puccinia triticina | |
| CN107029238B (en) | Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis | |
| CN105506126A (en) | Small annular nucleotide probe with large tension and preparation method and application thereof | |
| CN108300811A (en) | The RT-PCR detection kit and its detection method of one boar Sai Nika paddy viruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170704 |