CN110229933B - Primer group and kit for nested RT-PCR (reverse transcription-polymerase chain reaction) detection of porcine Saikovia virus and application of primer group and kit - Google Patents
Primer group and kit for nested RT-PCR (reverse transcription-polymerase chain reaction) detection of porcine Saikovia virus and application of primer group and kit Download PDFInfo
- Publication number
- CN110229933B CN110229933B CN201910547702.4A CN201910547702A CN110229933B CN 110229933 B CN110229933 B CN 110229933B CN 201910547702 A CN201910547702 A CN 201910547702A CN 110229933 B CN110229933 B CN 110229933B
- Authority
- CN
- China
- Prior art keywords
- porcine
- virus
- pcr
- primer
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer group for nested RT-PCR detection of porcine Sayboard virus, a kit and application, and belongs to the technical field of virus molecular biology detection. The invention designs 2 pairs of specific primers according to the gene sequence of the porcine Sayboard virus, performs a first RT-PCR amplification reaction by taking cDNA reverse transcribed from the extracted RNA as a template, performs a second RT-PCR amplification reaction by taking the first RT-PCR amplification product as a template, detects the amplification product through agarose gel electrophoresis, and judges the detected virus to be the porcine Sayboard virus if a specific target fragment with the size of 523bp appears. The method utilizes the nested RT-PCR technology to detect the porcine Sakavirus, has the advantages of strong specificity, high sensitivity and short detection time, can meet the requirements of enterprise production research and development and agricultural production, and provides a new idea for monitoring, preventing and controlling the porcine Sakavirus.
Description
Technical Field
The invention relates to the technical field of virus molecular biology detection, in particular to a primer group, a kit and application for nested RT-PCR detection of porcine Sai-endocavirus.
Background
Porcine Sai-Canavirus (SVV) belongs to the family picornaviridae, a member of the genus porcine Sai-Canavirus, and was first found on embryonic retinal cells (PER. c 6). SVV viruses are icosahedral, 30nm in diameter, have a genome of about 7.2kb and encode 4 structural proteins (VP1-4) and 7 non-structural proteins (2A-C, 3A-D). SVV has a narrow host range and mainly infects pigs. After the virus infects pigs, various symptoms can be generated, typical symptoms comprise rhinoscope, oral cavity and hoof blisters or ulcer and the like, the normal growth of the pigs is damaged, and the economic benefit of a farm is influenced. Pig SVV epidemic is confirmed in several countries around the world.
At present, establishing a rapid and effective detection method has important significance for preventing and controlling the virus. Aiming at SVV, the currently applicable detection methods mainly comprise electron microscope observation, serology and molecular biology detection methods. The electron microscope observation not only needs a large amount of virus strain materials to purify the virus, but also has complicated operation and long time. Serological methods are used on the premise that antibodies against the virus are required, and SVV has not been commercialized to date. Therefore, electron microscope observation and serology detection methods are not suitable for enterprise production research and development and rapid detection of agricultural production. The RT-PCR molecular detection method based on the nucleic acid level can overcome the defects and has the advantages of strong specificity, high sensitivity, short detection time and the like. However, so far, no nested RT-PCR detection method special for SVV detection exists, and no nested RT-PCR detection kit special for virus detection exists.
Disclosure of Invention
The invention aims to provide a primer group, a kit and application for nested RT-PCR detection of porcine Saka virus, so as to quickly and accurately detect the porcine Saka virus.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a primer group for nested RT-PCR detection of porcine Saikovia virus, which comprises an outer upstream primer, an outer downstream primer, an inner upstream primer and an inner downstream primer; the nucleotide sequences of the outer upstream primer, the outer downstream primer, the inner upstream primer and the inner downstream primer are respectively shown in SEQ ID NO: 1 to SEQ ID NO: 4, respectively.
The invention also provides a kit for nested RT-PCR detection of porcine Saka virus, which comprises the primer group in the scheme.
Preferably, the kit further comprises RT Buffer, RNase inhibitor, reverse transcriptase, MgCl2PCR Buffer, dNTPs and Taq DNA polymerase.
Preferably, the kit further comprises a positive control and a negative control.
Preferably, the positive control comprises porcine Saika virus; the negative control comprises DEPC water.
The invention also provides application of the primer group or the kit in the scheme in nested RT-PCR detection of non-diagnostic porcine Saka virus, which comprises the following steps:
1) extracting total RNA of a sample to be detected, and carrying out reverse transcription reaction by taking the total RNA of the sample to be detected as a template to obtain cDNA of the sample to be detected;
2) taking cDNA of a sample to be detected as a template, and carrying out a first round of RT-PCR amplification reaction by using the outer upstream primer and the outer downstream primer in the scheme to obtain a first round of RT-PCR amplification product;
3) taking the first round of RT-PCR amplification product as a template, and carrying out a second round of RT-PCR amplification reaction by using the inner side upstream primer and the inner side downstream primer in the scheme to obtain a second round of RT-PCR amplification product;
4) detecting the second RT-PCR amplification product by agarose gel electrophoresis, wherein an amplification band appears at 523bp to indicate that the sample to be detected contains the porcine Sayboard virus; the absence of amplified band at 523bp indicates that the sample to be tested does not contain porcine Saikoviruses.
Preferably, the reaction system used in the first round of RT-PCR amplification reaction in step 2) comprises 25 μ L: mu.L of cDNA of a sample to be detected, 0.5 mu.L of Taq DNA polymerase with the concentration of 2.5U/mu.L, 0.5 mu.L of dNTPs with the concentration of 10mmol/L, 2.5 mu.L of 10 XPCR Buffer and 25mmol/L MgCl22μL2. mu.L of the outer forward primer at a concentration of 10. mu. mol/L, 2. mu.L of the outer reverse primer at a concentration of 10. mu. mol/L, and 11.5. mu.L of DEPC water.
Preferably, the procedure of the first round of RT-PCR amplification reaction in the step 2) is as follows: 5min at 95 deg.C, [94 deg.C 1min, 55 deg.C 1min, 72 deg.C 1min, 30 cycles ], 7min at 72 deg.C, and the reaction is finished.
Preferably, the reaction system used in the second round of RT-PCR amplification reaction in step 3) comprises 25 μ L: 0.2 mul of the first round RT-PCR amplification product, 0.5 mul of Taq DNA polymerase with the concentration of 2.5U/mul, 0.5 mul of dNTPs with the concentration of 10mmol/L, 2.5 mul of 10 XPCR Buffer and MgCl with the concentration of 25mmol/L 22 μ L of the inner forward primer at a concentration of 10 μmol/L, 1 μ L of the inner reverse primer at a concentration of 10 μmol/L, and 17.3 μ L of DEPC water.
Preferably, the procedure of the second round of RT-PCR amplification reaction in step 3) is: 5min at 95 deg.C, [94 deg.C for 1min, 52 deg.C for 1min, 72 deg.C for 1min, 30 cycles ], 7min at 72 deg.C, and the reaction is finished.
The invention has the beneficial effects that: the invention provides a primer group for nested RT-PCR detection of porcine Sayboard virus, a kit and application, wherein the primer group comprises an outer upstream primer, an outer downstream primer, an inner upstream primer and an inner downstream primer; the nucleotide sequences of the outer upstream primer, the outer downstream primer, the inner upstream primer and the inner downstream primer are respectively shown as SEQ ID NO: 1 to SEQ ID NO: 4, respectively. The nested RT-PCR detection kit and the detection method for the porcine Saikovia virus provided by the invention have the beneficial effects that: 1) the specificity is strong: because 2 pairs of specific primers on the outer side and the inner side are used, the specificity of RT-PCR amplification is greatly improved, and amplification of non-target fragments is effectively avoided; the invention can amplify specific target fragments with the size of 523bp from a sample infected with porcine Seneca virus, and does not amplify corresponding target fragments from other virus samples; 2) the sensitivity is high: compared with the common RT-PCR, the invention has the advantage that the detection sensitivity is obviously improved through 2 rounds of RT-PCR reaction. The invention improves the whole RT-PCR detection sensitivity by 104Doubling (the lower detection limits of the first round and the second round of RT-PCR are 10 respectively-8And 10-4Double-diluted cDNA), the pairThe detection of the sample with low porcine Saka virus content has extremely important significance; 3) the detection time is short: the method has the advantages of short detection time, capability of overcoming the defects of electron microscope observation and serological detection methods, and realization of quick, accurate and efficient detection of the porcine Sayboard virus. Therefore, the nested RT-PCR technology is used for detecting the porcine Sayboard virus, the nested RT-PCR technology has the advantages of strong specificity, high sensitivity and short detection time, can meet the requirements of enterprise production, research and development and agricultural production, and provides a new idea for monitoring, preventing and controlling the porcine Sayboard virus.
Drawings
FIG. 1 shows the detection results of porcine Saka virus according to example 2; wherein M: DNA molecular weight standard (2000 bp); 1: a positive control; 2: a sample carrying porcine Saika virus; 3: negative control; 4: blank control;
FIG. 2 shows the results of the specificity assay of example 3; wherein M: DNA molecular weight standard (2000 bp); 1: porcine seneca virus (SVV); 2: negative control; 3: a foot-and-mouth disease virus (FMDV) positive control sample in a foot-and-mouth disease virus multiplex RT-PCR detection kit of Lanzhou veterinary research institute of Chinese agricultural academy of sciences; 4: blank control; 5: classical Swine Fever Virus (CSFV) samples in a classical swine fever live vaccine; 6: a Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) sample;
FIG. 3 shows the results of the first round RT-PCR sensitivity assay of example 4; wherein M: DNA molecular weight standard (2000 bp); 1: cDNA stock solution; 2: 10-2Diluting; 3: 10-4Diluting; 4: 10-6Diluting; 5: 10-8Diluting; 6: 10-10Diluting; 7: 10-12Diluting; 8: negative control; 9: blank control;
FIG. 4 shows the results of the second round RT-PCR sensitivity assay of example 4; wherein M: DNA molecular weight standard (2000 bp); 1: cDNA stock solution; 2: 10-2Diluting; 3: 10-4Diluting; 4: 10-6Diluting; 5: 10-8Diluting; 6: 10-10Diluting; 7: 10-12Diluting; 8: 10-14Diluting; 9: blank control; 10: and (5) negative control.
Detailed Description
The invention provides a primer group for nested RT-PCR detection of porcine Saikovia virus, which comprises an outer upstream primer, an outer downstream primer, an inner upstream primer and an inner downstream primer; the nucleotide sequences of the outer upstream primer, the outer downstream primer, the inner upstream primer and the inner downstream primer are respectively shown as SEQ ID NO: 1 to SEQ ID NO: 4 is shown in the specification; the nucleotide sequence of SEQ ID NO: 1 is specifically as follows: 5'-CGAGACCGGGGTTATTGAGG-3', respectively; the amino acid sequence of SEQ ID NO: 2 is specifically as follows: 5'-TACCGAATGTACACGGCCAC-3', respectively; the nucleotide sequence of SEQ ID NO: 3 is specifically as follows: 5'-CGGGTAACACTGACACCGAT-3', respectively; the nucleotide sequence of SEQ ID NO: 4 is specifically shown as follows: 5'-GAGTTCCAAGGGAGCACGAA-3' is added.
The primer group is designed according to a gene sequence of the porcine Saika virus; the porcine Saka virus gene is obtained from NCBI, see [ Seneca valley virus isolate SVV-001polyprotein gene, complete cds; GenBank: DQ 641257.1; https:// www.ncbi.nlm.nih.gov/nuccore/DQ641257.1 ].
The invention also provides a reagent kit for nested RT-PCR detection of porcine Saka virus, which comprises the primer group in the scheme; preferably, the kit further comprises RT Buffer, RNase inhibitor, reverse transcriptase, MgCl2PCR Buffer, dNTPs and Taq DNA polymerase.
In the present invention, the use concentration of the outer upstream primer and the outer downstream primer in the primer set is preferably 10 μmol/L independently; the use concentration of the inside forward primer and the inside reverse primer in the primer set is preferably 10. mu. mol/L independently. In the specific implementation process of the invention, the primers in the primer set are all synthesized by biological engineering (Shanghai) GmbH.
In the present invention, the RT Buffer is preferably a 10 × RT Buffer; the concentration of the RNase inhibitor is preferably 40U/. mu.L; the use concentration of the reverse transcriptase is preferably 200U/. mu.L; said MgCl2The use concentration of (A) is preferably 25 mmol/L; the PCR Buffer is preferably 10 multiplied PCR Buffer; the dNTPs are preferably used at a concentration10 mmol/L; the Taq DNA polymerase is preferably used at a concentration of 2.5U/. mu.L.
In the present invention, the kit preferably further comprises a positive control and a negative control; the positive control comprises porcine Saikovia virus; the negative control comprises DEPC water.
The invention also provides application of the primer group or the kit in the scheme in nested RT-PCR detection of non-diagnostic porcine Saka virus, which comprises the following steps:
1) extracting total RNA of a sample to be detected, and carrying out reverse transcription reaction by taking the total RNA of the sample to be detected as a template to obtain cDNA of the sample to be detected;
2) taking cDNA of a sample to be detected as a template, and carrying out a first round of RT-PCR amplification reaction by using the outer upstream primer and the outer downstream primer in the scheme to obtain a first round of RT-PCR amplification product;
3) taking the first round of RT-PCR amplification product as a template, and carrying out a second round of RT-PCR amplification reaction by using the inner side upstream primer and the inner side downstream primer in the scheme to obtain a second round of RT-PCR amplification product;
4) detecting the second RT-PCR amplification product by agarose gel electrophoresis, wherein an amplification band appears at 523bp to indicate that the sample to be detected contains the porcine Sayboard virus; the absence of amplified band at 523bp indicates that the sample to be tested does not contain porcine Saikoviruses.
Firstly, extracting total RNA of a sample to be detected, and carrying out reverse transcription reaction by taking the total RNA of the sample to be detected as a template to obtain cDNA of the sample to be detected; the invention has no special limitation on the extraction method of the total RNA of the sample to be detected, and the conventional extraction method in the field is adopted; in the specific implementation process of the invention, the total RNA of the sample to be detected is extracted by a virus RNA extraction kit (DP315-R) of Tiangen Biochemical technology (Beijing) Co., Ltd; the reaction system used in the reverse transcription reaction comprises 2 mu L of total RNA of a sample to be detected, 0.5 mu L of outer downstream primer with the concentration of 10 mu mol/L and 8.5 mu L of DEPC water with the concentration of 25mmol/L MgCl by 20 mu L 24 mu L of the solution; 2. mu.L of 10 XTRT buffer, 2. mu.L of dNTPs at a concentration of 10mmol/L, 0.5. mu.L of reverse transcriptase at a concentration of 200U/. mu.L, 40U/. mu.LRNase inhibitor 0.5. mu.L; the nucleotide sequence of the outer downstream primer is shown as SEQ ID NO: shown at 5, specifically 5'-TACCGAATGTACACGGCCAC-3'; the procedure of the reverse transcription reaction was: 10min at 25 ℃, 15min at 42 ℃ and 15min at 70 ℃.
After obtaining the cDNA of a sample to be detected, carrying out a first round of RT-PCR amplification reaction by using the outer upstream primer and the outer downstream primer in the scheme by using the cDNA of the sample to be detected as a template to obtain a first round of RT-PCR amplification product; the reaction system used in the first round of RT-PCR amplification reaction comprises 25 μ L: mu.L of cDNA of a sample to be detected, 0.5 mu.L of Taq DNA polymerase with the concentration of 2.5U/mu.L, 0.5 mu.L of dNTPs with the concentration of 10mmol/L, 2.5 mu.L of 10 XPCR Buffer and 25mmol/L MgCl 22 mu L of outer upstream primer with the concentration of 10 mu mol/L, 2 mu L of outer downstream primer with the concentration of 10 mu mol/L and 11.5 mu L of DEPC water; the procedure of the first round of RT-PCR amplification reaction is as follows: 95 deg.C for 5min, [94 deg.C for 1min, [ 55 deg.C for 1min, [ 72 deg.C for 1min ], 30 cycles]The reaction was completed at 72 ℃ for 7 min.
After obtaining a first round of RT-PCR amplification product, carrying out a second round of RT-PCR amplification reaction by using the inner side upstream primer and the inner side downstream primer in the scheme by using the first round of RT-PCR amplification product as a template to obtain a second round of RT-PCR amplification product; the reaction system used in the second round of RT-PCR amplification reaction comprises 25 μ L: 0.2 mul of the first round RT-PCR amplification product, 0.5 mul of Taq DNA polymerase with the concentration of 2.5U/mul, 0.5 mul of dNTPs with the concentration of 10mmol/L, 2.5 mul of 10 XPCR Buffer and MgCl with the concentration of 25mmol/L 22 mu L of inner upstream primer with the concentration of 10 mu mol/L, 1 mu L of inner downstream primer with the concentration of 10 mu mol/L and 17.3 mu L of DEPC water; the procedure of the second round of RT-PCR amplification reaction is as follows: 95 deg.C for 5min, [94 deg.C for 1min, [ 52 deg.C for 1min, [ 72 deg.C for 1min ], 30 cycles]The reaction was completed at 72 ℃ for 7 min.
After obtaining a second round of RT-PCR amplification product, detecting the second round of RT-PCR amplification product by agarose gel electrophoresis, and indicating that a sample to be detected contains the porcine Sayboard virus when an amplification strip appears at 523 bp; the absence of an amplification band at 523bp indicates that the sample to be detected does not contain the porcine Saikovia virus; the 523bp corresponding nucleotide sequence is shown as SEQ ID NO: 6, specifically:
CGGGTAACACTGACACCGATTTCTCTGGTGAACTGGCGGCTCCTGGCTCTAACCACACTAATGTCAAGTTCCTGTTTGATCGATCTCGATTATTGAATGTAATCAAGGTACTGGAGAAGGACGCCGTTTTCCCCCGCCCTTTCCCTACACAAGAAGGTGCGCAGCAGGATGATGGTTACTTTTGTCTTCTGACCCCCCGCCCAACAGTCGCTTCCCGACCCGCCACTCGTTTCGGCCTGTACGCCAATCCGTCCGGCAGTGGTGTTCTTGCTAACACTTCACTGGACTTCAATTTTTATAGCTTGGCCTGTTTCACTTACTTTAGATCGGACCTTGAGGTTACGGTGGTCTCACTAGAGCCGGATCTGGAATTTGCTGTAGGGTGGTTTCCTTCTGGCAGTGAATACCAGGCTTCCAGCTTTGTCTACGACCAGCTGCATGTGCCCTTCCACTTTACTGGGCGCACTCCCCGCGCTTTCGCTAGCAAGGGTGGGAAGGTATCTTTCGTGCTCCCTTGGAACTC。
the technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1 configuration of nested RT-PCR detection kit for porcine Sayboard Virus (10 measurements)
1) RT Buffer: 10 ×, 1 tube (30 μ L);
2) rnase inhibitor: 40U/. mu.L, 1 tube (20. mu.L);
3) reverse transcriptase: 200U/. mu.L, 1 tube (20. mu.L);
4)MgCl2: 25mmol/L, 1 tube (60. mu.L);
5) DEPC water: 1 tube (1 mL);
6) PCRBuffer: 10 ×, 1 tube (30 μ L);
7) an outer upstream primer: 10. mu. mol/L, 1 tube (30. mu.L);
8) outer downstream primer: 10. mu. mol/L, 1 tube (30. mu.L);
9) an inner upstream primer: 10. mu. mol/L, 1 tube (30. mu.L);
10) inner downstream primer: 10. mu. mol/L, 1 tube (30. mu.L);
11) taq DNA polymerase: 2.5U/. mu.L, 1 tube (10. mu.L);
12) dNTPs: 10mmol/L, 1 tube (20. mu.L);
13) positive control sample of porcine racecadovirus, 1 tube (5 μ L);
14) negative control sample, 1 tube (50 μ L) without porcine racecadovirus.
Example 2 detection method of nested RT-PCR detection kit for porcine Sayboard Virus
The detection method of the nested RT-PCR detection kit for the porcine Saka virus comprises the following steps:
1) reverse transcription reaction: adding 2 mu L of total RNA of a sample to be detected, 0.5 mu L of outer downstream primer with the concentration of 10 mu mol/L and 8.5 mu L of DEPC water into a PCR tube, wherein the concentration of the outer downstream primer is 25mmol/L MgCl 24 mu L of the solution; 2 μ L of 10 XTRT buffer, 2 μ L of dNTPs with a concentration of 10mmol/L, 0.5 μ L of reverse transcriptase with a concentration of 200U/μ L, and 0.5 μ L of RNase inhibitor with a concentration of 40U/μ L, incubating the reaction at 25 ℃ for 10min, then reverse transcribing at 42 ℃ for 15min, and extending at 70 ℃ for 15min to synthesize cDNA.
2) First round of RT-PCR reaction: adding 4 μ L of sample cDNA to be detected into PCR tube, adding 0.5 μ L Taq DNA polymerase with concentration of 2.5U/μ L, 0.5 μ L dNTPs with concentration of 10mmol/L, 2.5 μ L10 XPCR Buffer, and MgCl with concentration of 25mmol/L2mu.L of outer forward primer 2. mu.L at a concentration of 10. mu. mol/L and outer reverse primer 2. mu. L, DEPC at a concentration of 10. mu. mol/L, and 11.5. mu.L of water, so that the total reaction volume is 25. mu.L; pre-denaturing the mixed reaction solution at 95 ℃ for 5min, then denaturing at 94 ℃ for 1min, annealing at 55 ℃ for 1min, and extending at 72 ℃ for 1min, so as to complete 30 cycles, continuing to extend at 72 ℃ for 7min after the last cycle is finished, and finishing the reaction;
3) second round of RT-PCR reaction: taking 0.2 mu L of the first RT-PCR reaction product, adding 0.5 mu L of Taq DNA polymerase with the concentration of 2.5U/mu L, 0.5 mu L of dNTPs with the concentration of 10mmol/L, 2.5 mu L of 10 XPCR Buffer and MgCl with the concentration of 25mmol/L into each tube 22 mu L of inner upstream primer with concentration of 10 mu mol/L and 17.3 mu L of water with concentration of inner downstream primer with concentration of 10 mu mol/L and 1 mu L, DEPC, so that the total reaction volume is 25 mu L; pre-denaturing the mixed reaction solution at 95 ℃ for 5min, then denaturing at 94 ℃ for 1min, annealing at 52 ℃ for 1min, and extending at 72 ℃ for 1min, so as to complete 30 cycles, continuing to extend at 72 ℃ for 7min after the last cycle is finished, and finishing the reaction;
4) and (3) carrying out electrophoresis detection on an RT-PCR amplification product: after the second RT-PCR reaction, taking 7 mu L of the product, detecting the product by using 1.5% agarose gel electrophoresis, observing the product on a gel imaging system after the product is dyed by Ultra GelRed, and recording an experimental result; the electrophoresis detection result of the sample containing the porcine Seneca virus shows that an amplified band appears at 523bp (figure 1), otherwise, no amplified band appears.
Example 3: specificity determination of nested RT-PCR detection kit for porcine Saka virus
1) Extraction of RNA: respectively taking samples carrying the porcine Sayboard virus (SVV), the Foot and Mouth Disease Virus (FMDV), the Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) and the Classical Swine Fever Virus (CSFV) as materials, respectively taking 140 microliter of the samples, adding 560 microliter of Carrier RNA working solution, fully and uniformly mixing, incubating at room temperature for 15min, and gently shaking and uniformly mixing in the period; adding 560 μ L absolute ethanol, mixing, incubating at room temperature for 5min, transferring all the liquid in the tube into an adsorption column, centrifuging at 8000rpm for 1min to discard waste liquid, adding 500 μ L buffer solution GD, centrifuging at 8000rpm for 1min to discard waste liquid, adding 500 μ L eluent RW again, centrifuging at 8000rpm for 1min to discard waste liquid, putting the adsorption column back into a collection tube, centrifuging at 12000rpm for 3min to completely dry the adsorption membrane, discarding waste liquid, standing at room temperature for 3min to completely dry the adsorption membrane, putting the adsorption column into 1.5mL RNase-Free centrifuge tube, carefully opening the cover of the adsorption column, and dripping 40 μ L RNase-Free ddH into the middle part of the adsorption membrane2And O, covering a cover, standing at room temperature for 5min, and centrifuging at 8000r/min for 1min to obtain the RNA.
2) Reverse transcription reaction: 2 mul of total RNA of a sample to be detected, 0.5 mul of outer downstream primer with the concentration of 10 mul mol/L and 8.5 mul of DEPC water with the concentration of 25mmol/L MgCl are added into a PCR tube 24 mu L of the solution; 2 μ L of 10 XTRT buffer, 2 μ L of dNTPs with a concentration of 10mmol/L, 0.5 μ L of reverse transcriptase with a concentration of 200U/μ L, and 0.5 μ L of RNase inhibitor with a concentration of 40U/μ L, incubating the reaction at 25 ℃ for 10min, then reverse transcribing at 42 ℃ for 15min, and extending at 70 ℃ for 15min to synthesize cDNA.
3) First round of RT-PCR reaction: adding 4 μ L of sample cDNA to be detected into PCR tube, adding 0.5 μ L Taq DNA polymerase with concentration of 2.5U/μ L, 0.5 μ L dNTPs with concentration of 10mmol/L, 2.5 μ L10 XPCR Buffer, and MgCl with concentration of 25mmol/L2mu.L of outer forward primer 2. mu.L at a concentration of 10. mu. mol/L and outer reverse primer 2. mu. L, DEPC at a concentration of 10. mu. mol/L, and 11.5. mu.L of water, so that the total reaction volume is 25. mu.L; the mixed reaction solution was pre-denatured at 95 ℃5min, then denaturation at 94 ℃ for 1min, annealing at 55 ℃ for 1min, and extension at 72 ℃ for 1min, so 30 cycles are performed, extension at 72 ℃ is continued for 7min after the last cycle is finished, and the reaction is finished;
4) second round of RT-PCR reaction: taking 0.2 μ L of the first RT-PCR reaction product, adding 0.5 μ L of Taq DNA polymerase with concentration of 2.5U/μ L, 0.5 μ L of dNTPs with concentration of 10mmol/L, 2.5 μ L of 10 XPCR Buffer, and MgCl with concentration of 25mmol/L into each tube 22 mu L of inner upstream primer with concentration of 10 mu mol/L and 17.3 mu L of water with concentration of inner downstream primer with concentration of 10 mu mol/L and 1 mu L, DEPC, so that the total reaction volume is 25 mu L; pre-denaturing the mixed reaction solution at 95 ℃ for 5min, then denaturing at 94 ℃ for 1min, annealing at 52 ℃ for 1min, and extending at 72 ℃ for 1min, so as to complete 30 cycles, continuing to extend at 72 ℃ for 7min after the last cycle is finished, and finishing the reaction;
5) and (3) carrying out electrophoresis detection on an RT-PCR amplification product: after the second RT-PCR reaction, 7. mu.L of the product was detected by 1.5% agarose gel electrophoresis, and the results were observed and recorded on a gel imaging system after Ultra GelRed staining (FIG. 2). As can be seen from FIG. 2, only the porcine racenia virus sample has an amplification band at 523bp, and other virus samples have no amplification band, which indicates that the kit of the invention has strong specificity.
Example 4: sensitivity determination of nested RT-PCR detection kit for porcine Saka virus
After the cDNA of the porcine Sayboard virus (SVV) sample was diluted by a gradient of 100 times, the cDNA was used as a template for detection according to the method of example 2, and a negative control and a blank control were set for the assay. As can be seen from FIGS. 3 and 4, the detection sensitivity of the second round of RT-PCR was 10 times higher than that of the first round of RT-PCR4The double, i.e. nested RT-PCR, increases the detection sensitivity by 104And the kit has high sensitivity.
Example 5: clinical sample detection of porcine Sayboard Virus
60 clinical blood samples of 5 different pig farms are taken as materials, detection is carried out according to the method of the embodiment 3, and the test is carried out by adopting a common RT-PCR method for comparison. The result shows that 21 parts of porcine Sayboard virus (SVV) can be detected from 60 clinical blood samples (the detection rate is 35 percent) by adopting the method, and the detection rate is 12 percent higher than that of the common RT-PCR (reverse transcription-polymerase chain reaction) (shown in Table 1).
TABLE 1 test results of clinical blood samples
| Detection method | Number of positive samples | Percentage of detection (%) |
| Nested RT-PCR | 21 portions of | 35 |
| General RT-PCR | 14 portions of | 23 |
The concentrations of the substances used in examples 1 to 5 were the same as those listed in the technical scheme of the present invention.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Sederte (Fuzhou) Biotechnology Ltd
<120> primer group and kit for nested RT-PCR (reverse transcription-polymerase chain reaction) detection of porcine Saka virus and application
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cgagaccggg gttattgagg 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
taccgaatgt acacggccac 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cgggtaacac tgacaccgat 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gagttccaag ggagcacgaa 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
taccgaatgt acacggccac 20
<210> 6
<211> 523
<212> DNA
<213> porcine Sai-Cani virus (Swine Seneca virus)
<400> 6
cgggtaacac tgacaccgat ttctctggtg aactggcggc tcctggctct aaccacacta 60
atgtcaagtt cctgtttgat cgatctcgat tattgaatgt aatcaaggta ctggagaagg 120
acgccgtttt cccccgccct ttccctacac aagaaggtgc gcagcaggat gatggttact 180
tttgtcttct gaccccccgc ccaacagtcg cttcccgacc cgccactcgt ttcggcctgt 240
acgccaatcc gtccggcagt ggtgttcttg ctaacacttc actggacttc aatttttata 300
gcttggcctg tttcacttac tttagatcgg accttgaggt tacggtggtc tcactagagc 360
cggatctgga atttgctgta gggtggtttc cttctggcag tgaataccag gcttccagct 420
ttgtctacga ccagctgcat gtgcccttcc actttactgg gcgcactccc cgcgctttcg 480
ctagcaaggg tgggaaggta tctttcgtgc tcccttggaa ctc 523
Claims (10)
1. A primer group for nested RT-PCR detection of porcine Saikovia virus comprises an outer upstream primer, an outer downstream primer, an inner upstream primer and an inner downstream primer; the nucleotide sequences of the outer upstream primer, the outer downstream primer, the inner upstream primer and the inner downstream primer are respectively shown as SEQ ID NO: 1 to SEQ ID NO: 4, respectively.
2. A kit for nested RT-PCR detection of porcine Sayboard virus, wherein the kit comprises the primer set of claim 1.
3. The kit of claim 2, wherein the kit further comprises RT Buffer, rnase inhibitor, reverse transcriptase, MgCl2PCR Buffer, dNTPs and Taq DNA polymerase.
4. The kit of claim 2 or 3, further comprising a positive control and a negative control.
5. The kit of claim 4, wherein the positive control comprises porcine Saika virus; the negative control included DEPC water.
6. Use of the primer set of claim 1 or the kit of any one of claims 2 to 5 for nested RT-PCR detection of porcine Sayboard virus for non-diagnostic purposes, comprising the steps of:
1) extracting total RNA of a sample to be detected, and carrying out reverse transcription reaction by taking the total RNA of the sample to be detected as a template to obtain cDNA of the sample to be detected;
2) taking cDNA of a sample to be detected as a template, and carrying out a first round of RT-PCR amplification reaction by using the outer upstream primer and the outer downstream primer in claim 1 to obtain a first round of RT-PCR amplification product;
3) performing a second RT-PCR amplification reaction by using the inner upstream primer and the inner downstream primer in claim 1 by using the first RT-PCR amplification product as a template to obtain a second RT-PCR amplification product;
4) detecting the second RT-PCR amplification product by agarose gel electrophoresis, wherein an amplification band appears at 523bp to indicate that the sample to be detected contains the porcine Sayboard virus; the absence of amplified band at 523bp indicates that the sample to be tested does not contain porcine Saikoviruses.
7. The use of claim 6, wherein the reaction system used in the first round of RT-PCR amplification reaction in step 2) comprises 25 μ L: mu.L of cDNA of a sample to be detected, 0.5 mu.L of Taq DNA polymerase with the concentration of 2.5U/. mu.L, 0.5 mu.L dNTPs with the concentration of 10mmol/L, 2.5 mu.L PCR buffer with the concentration of 25mmol/L MgCl22. mu.L of the outer forward primer at a concentration of 10. mu. mol/L, 2. mu.L of the outer reverse primer at a concentration of 10. mu. mol/L, and 11.5. mu.L of DEPC water.
8. The use of claim 6 or 7, wherein the procedure of the first round of RT-PCR amplification reaction in step 2) is as follows: 5min at 95 ℃, 1min at 94 ℃, 1min at 55 ℃, 1min at 72 ℃ for 30 cycles, 7min at 72 ℃ and the reaction is finished.
9. The use of claim 6, wherein the second round of RT-PCR amplification in step 3)The reaction system used for the amplification reaction included, in 25. mu.L: 0.2 mul of the first round RT-PCR amplification product, 0.5 mul of Taq DNA polymerase with the concentration of 2.5U/mul, 0.5 mul of dNTPs with the concentration of 10mmol/L, 2.5 mul of 10 XPCR Buffer and MgCl with the concentration of 25mmol/L22 μ L of the inner forward primer at a concentration of 10 μmol/L, 1 μ L of the inner reverse primer at a concentration of 10 μmol/L, and 17.3 μ L of DEPC water.
10. The use of claim 6 or 9, wherein the procedure of the second round of RT-PCR amplification reaction in step 3) is: 5min at 95 ℃, 1min at 94 ℃, 1min at 52 ℃, 1min at 72 ℃ for 30 cycles, 7min at 72 ℃ and the reaction is finished.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910547702.4A CN110229933B (en) | 2019-06-24 | 2019-06-24 | Primer group and kit for nested RT-PCR (reverse transcription-polymerase chain reaction) detection of porcine Saikovia virus and application of primer group and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910547702.4A CN110229933B (en) | 2019-06-24 | 2019-06-24 | Primer group and kit for nested RT-PCR (reverse transcription-polymerase chain reaction) detection of porcine Saikovia virus and application of primer group and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110229933A CN110229933A (en) | 2019-09-13 |
| CN110229933B true CN110229933B (en) | 2022-06-07 |
Family
ID=67857267
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910547702.4A Active CN110229933B (en) | 2019-06-24 | 2019-06-24 | Primer group and kit for nested RT-PCR (reverse transcription-polymerase chain reaction) detection of porcine Saikovia virus and application of primer group and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110229933B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105925728A (en) * | 2016-06-01 | 2016-09-07 | 华南农业大学 | Seneca valley virus real-time fluorescence quantification PCR detection primer and kit |
| CN106498091A (en) * | 2016-10-25 | 2017-03-15 | 湖南新南方养殖服务有限公司 | A kind of primer sets of diagnosis pig Cord blood wild strains of classical swine fever virus, the test kit containing the primer sets and its application |
| CN107937617A (en) * | 2017-12-28 | 2018-04-20 | 广州维佰生物科技有限公司 | Detect the RT LAMP primer compositions thing and its kit and method of Sai Neijia paddy viruses |
| CN108300811A (en) * | 2018-04-18 | 2018-07-20 | 滕建芬 | The RT-PCR detection kit and its detection method of one boar Sai Nika paddy viruses |
| CN109234464A (en) * | 2018-11-23 | 2019-01-18 | 山东新希望六和集团有限公司 | For detecting primer and probe, the PCR kit for fluorescence quantitative and methods and applications of Seneca Valley virus |
| CN109735661A (en) * | 2019-03-07 | 2019-05-10 | 长江大学 | A kind of universal Porcine epidemic diarrhea virus nested PCR detection method |
-
2019
- 2019-06-24 CN CN201910547702.4A patent/CN110229933B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105925728A (en) * | 2016-06-01 | 2016-09-07 | 华南农业大学 | Seneca valley virus real-time fluorescence quantification PCR detection primer and kit |
| CN106498091A (en) * | 2016-10-25 | 2017-03-15 | 湖南新南方养殖服务有限公司 | A kind of primer sets of diagnosis pig Cord blood wild strains of classical swine fever virus, the test kit containing the primer sets and its application |
| CN107937617A (en) * | 2017-12-28 | 2018-04-20 | 广州维佰生物科技有限公司 | Detect the RT LAMP primer compositions thing and its kit and method of Sai Neijia paddy viruses |
| CN108300811A (en) * | 2018-04-18 | 2018-07-20 | 滕建芬 | The RT-PCR detection kit and its detection method of one boar Sai Nika paddy viruses |
| CN109234464A (en) * | 2018-11-23 | 2019-01-18 | 山东新希望六和集团有限公司 | For detecting primer and probe, the PCR kit for fluorescence quantitative and methods and applications of Seneca Valley virus |
| CN109735661A (en) * | 2019-03-07 | 2019-05-10 | 长江大学 | A kind of universal Porcine epidemic diarrhea virus nested PCR detection method |
Non-Patent Citations (1)
| Title |
|---|
| 塞尼卡谷病毒TaqMan荧光定量PCR检测方法的建立;樊晓旭等;《中国预防兽医学报》;20161215(第12期);参见全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110229933A (en) | 2019-09-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103255229B (en) | One tube PCR type kit for discriminating and diagnosing goose parvovirus and Muscovy duck parvovirus | |
| CN107385111B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer of goose astrovirus and kit thereof | |
| CN110643745B (en) | Composition and kit for detecting feline calicivirus and feline parvovirus and application of composition and kit | |
| CN104152578B (en) | Porcine epidemic diarrhea virus RT-PCR differential diagnosis kit and its application | |
| CN103866050B (en) | Porcine epidemic diarrhea virus fluorescent quantitative PCR detection method and primer thereof | |
| CN113832260B (en) | Multiplex nano PCR detection primer pair, kit and application method for goose astrovirus, goose parvovirus and goose embedded cup virus | |
| CN107699635B (en) | Fluorescent RPA (reverse transcriptase amplification) detection method for porcine epidemic diarrhea virus | |
| CN112795706A (en) | Fluorescent probe primer group and kit for African swine fever virus P72 gene and application of fluorescent probe primer group and kit | |
| CN105463136B (en) | Kit for the detection of avian infectious bronchitis virus RT-PCR partings | |
| CN104711369B (en) | The detection primer of high-pathogenicity porcine reproductive and respiratory syndrome virus, probe and detection method | |
| CN108486279A (en) | A method of pigeon with newcastle disease is detected based on fluorescent quantitative PCR technique | |
| CN115896348A (en) | Primer and probe for dual TaqMan fluorescent quantitative PCR (polymerase chain reaction) of canine distemper virus and canine coronavirus and application of primer and probe | |
| CN111041128B (en) | Primer probe set, kit and detection method for detecting duck astrovirus type 3 based on real-time fluorescent quantitative PCR | |
| CN114592089A (en) | Triple TaqMan fluorescent quantitative PCR kit for simultaneously detecting three circovirus | |
| CN114196786A (en) | Poultry adenovirus type 4 and 8 dual fluorescent quantitative PCR rapid detection kit and method | |
| CN105506186A (en) | Primers for detecting porcine epidemic diarrhea viruses and fluorescent quantitative RT-PCR detecting method | |
| CN110229933B (en) | Primer group and kit for nested RT-PCR (reverse transcription-polymerase chain reaction) detection of porcine Saikovia virus and application of primer group and kit | |
| CN102154512A (en) | Fluorescence quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection method for rabbit hemorrhagic disease virus | |
| CN110643740B (en) | Real-time fluorescent quantitative RT-PCR detection primers, probes and detection kits for Paliam serogroup virus | |
| CN107937615B (en) | Primers and probes for distinguishing wild strains and vaccine strains of swine Japanese encephalitis virus | |
| CN113265488B (en) | RPA-LFD primer, probe and kit for jointly detecting epidemic hemorrhagic disease virus and palieimia serogroup virus | |
| CN105200163A (en) | Porcine reproductive and respiratory syndrome virus nano PCR differential diagnosis kit and detection method thereof | |
| CN111500774B (en) | Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit | |
| CN111500773B (en) | Fluorescent quantitative RT-PCR primer, probe and kit for identification of serotype of epidemic hemorrhagic disease virus | |
| CN108384894A (en) | Taqman real-time fluorescence quantitative RT-PCRs kit for detecting Sai Nika paddy viruses and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |