CN108272815A - The application of Epstein-Barr virus miR-BART10-5p inhibitor - Google Patents
The application of Epstein-Barr virus miR-BART10-5p inhibitor Download PDFInfo
- Publication number
- CN108272815A CN108272815A CN201711277063.1A CN201711277063A CN108272815A CN 108272815 A CN108272815 A CN 108272815A CN 201711277063 A CN201711277063 A CN 201711277063A CN 108272815 A CN108272815 A CN 108272815A
- Authority
- CN
- China
- Prior art keywords
- bart10
- epstein
- barr virus
- mir
- virus mir
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
Abstract
The invention discloses the applications of Epstein-Barr virus miR BART10 5p inhibitor.The present invention is had found using micro- tube formation assay and chick chorioallantoic membrane experimental analysis, and nasopharyngeal carcinoma angiogenesis can be obviously promoted in the Epstein-Barr virus miR BART10 5p of height expression in nasopharyngeal carcinoma cell.The Epstein-Barr virus miR BART10 5p inhibitor of the present invention is based on the antisense oligonucleotides of Epstein-Barr virus miR BART10 5p, it is obtained by series modification, pass through micro- tube formation assay, chick chorioallantoic membrane experiment and the experiment of matrigel bolt, confirm that Epstein-Barr virus miR BART10 5p inhibitor can obviously inhibit the effect of generation of nasopharyngeal carcinoma new vessels, with treatment nasopharyngeal carcinoma effect, further, the recurrence and transfer of prevention nasopharyngeal carcinoma can also be applied to.
Description
Technical field
The invention belongs to oncomolecularbiology fields, more particularly, to Epstein-Barr virus miR-BART10-5p inhibitor
Using.
Background technology
Nasopharyngeal carcinoma (nasopharyngeal carcinoma, NPC) refers to the malignant tumour for betiding mucous membrane of nasopharynx, multiple
In a middle-aged person, occasionally in teenager, grade malignancy is high, is recurrence rate and the highest disease of the rate of transform in head and neck neoplasm, early stage
It may occur in which that metastasic cervical lymph nodes and the rate of transform are up to 80%, Chang Gaofa in the ground such as the South China of China and Southeast Asia, tool
There is apparent region.Nasopharyngeal Carcinoma Patients still have 20~30% patients the recurrence of nasopharyngeal carcinoma and transfer occur after curing in 5 years, are to face
Leading to dead one of principal element on bed, the main means of clinical treatment nasopharyngeal carcinoma are operation, radiation and chemotherapy at present, although
Current therapeutic level is greatly improved, but 5 years survival rates of nasopharyngeal carcinoma still only have 50% or so, therefore urgently exploitation is more
Therapy, can chemoradiation therapy further increase the survival rates of Nasopharyngeal Carcinoma Patients.
Epstein-Barr virus (Epstein Barr virus, EBV) is a kind of gamma herpes viruses, almost all of undifferentiated and low point
It is all related with Epstein-Barr virus latent infection to change nasopharyngeal carcinoma.Recently research finds that the miRNA of Epstein-Barr virus coding may participate in regulation and control EB diseases
The expression of the gene and human host's gene of poison coding, for example, EBV-miR-BART2 can be with the gene of coding viral dna polymerase
3 ' the UTR complete complementaries of BALF5.When cracking infection period virus massive duplication, miR-BART2 expressions reduce, to BALF5
The decomposition of gene weakens, and is conducive to viral replication cycle；As miR-BART2 selects pressure change, BALF5 expression drops
Low, the virion of EBV infection cells release is constantly reduced, and infection enters latence (Nucleic Acids Res 310:
1035-48,2009).The expression of EBV-miR-BHRF1-3 and the T cell Chemokines CC XCL-11/I-TAC of cell IFN inductions
It is horizontal related, thus it is speculated that CXCL-11/I-TAC is miR-BHRF1-3 action target spots, and Epstein-Barr virus can be done in this, as regulative mode
Disturb immunosurveillance and immune clearance effect (the Cancer Res 68 of host:1436-42,2008).EBV-miR-BART5 can lead to
Cross inhibit host apoptosis before albumen PUMAHl, raise the expression of P53, if from EBV infect cell in remove miR-
BART5, the apoptotic effect that PUMA will be promoted to mediate, prompts EBV that can inhibit the generation of apoptosis, to the epithelium for protecting it to infect
Cell (J Exp Med 205:2551-60,2008；J Biol Chem 285:33358-100,2010).miR-BART6-5p
It can inhibit the expression of EBNA2 viral oncogenes, and the expression of this oncogene is in I types and II types latence (low immunoreaction)
It is indispensable during being converted to type III latence (immune high reaction), shows infection of the miR-BART6 in EBV
Important adjustment effect (the J Biol Chem 285 with latent middle performance:33358-100,2010).It can be seen that Epstein-Barr virus
On the one hand miRNA may act on the viral target gene of itself, promote the infection of virus and hide, on the other hand can also act on
The target gene of host, promotes the immune response of viral escape host cell, and inhibits the apoptosis of host cell.
However, the effect of the miR-BART10 of related Epstein-Barr virus coding and the research of mechanism are less, wherein
CN105154446A and CN105154586A discloses the microRNA BART10 and its antisense oligonucleotides of Epstein-Barr virus coding jointly
The application process of acid, research confirm the expression of EBV-miR-BART10 and the lymph node of Nasopharyngeal Carcinoma Patients in tissues of nasopharyngeal carcinoma
Transfer and DISTANT METASTASES IN correlation；Our sequence alignments to this patent find its really EBV-miR- being related to
BART10-3p.Also studies have pointed out that EBV-miR-BART10-3p can promote nasopharyngeal carcinoma EMT's by targeting BTRC genes
Occur and then promote the transfer (Oncotarget 39 of nasopharyngeal carcinoma:41766-41782).However, so far, related Epstein-Barr virus
The relationship of miR-BART10 and nasopharyngeal carcinoma angiogenesis have no any report.
1971, Folkman proposed growth and metastasis of tumours and relies on angiogenesis, and it is containment tumour to block angiogenesis
This theory of the available strategy of growth.In the malignancy and transfer of solid primary tumor, Tumor Angiongesis plays key
Effect, the growth of tumour and invasion transfer depend on abundant blood supply and vascularization, and the new vessels of tumour are not only to swollen
Tumor tissue conveys nutriment and excretion metabolism waste, and is one of the key link of tumour cell hematogenous metastasis.Tumour
New vessels treat tumour by anti-angiogenesis and its transfer have become basic and clinic studies in recent years as target spot
Hot spot.Inhibit Tumor Angiongesis, the growth and transfer of tumour can be significantly inhibited, this perhaps can be the treatment and prevention of nasopharyngeal carcinoma
It opens up a new way.
In addition, in the prior art, the preparation of miRNA inhibitor, which mostly uses antisense oligonucleotides and loads to poly-D-lysine, repaiies
The method that nanosphere is made on the nano silicon particles of decorations, nanogold-polyethyleneimine (PEI) genophore tool that this method is related to
Toxic side effect, PEI is increased with the increase transfection efficiency of molecular weight, but cytotoxicity can also increase, therefore most of at present
Research be all under the premise of not influencing PEI transfection efficiencies, carrying out appropriate modification to its structure reduces its cytotoxicity.
The generally acknowledged effective radical treatment means of nasopharyngeal carcinoma are radiotherapy or the complex treatment based on radiotherapy at present, but
It is radiotherapy while curing tumour, inevitably damages normal structure and organ, and irradiated volume is big when radiotherapy, puts
The treatment course for the treatment of is long, and complication is more.It is therefore proposed that a kind of low toxicity, safety and efficient treatment of nasopharyngeal carcinoma and preventing preparation, have very much
Realistic meaning.
Invention content
The purpose of the present invention is to provide the applications of Epstein-Barr virus miR-BART10-5p inhibitor, more particularly：Epstein-Barr virus
MiR-BART10-5p antisense oligonucleotides is used to prepare the preparation of anti-nasopharyngeal carcinoma angiogenesis.
The technology path taken of the present invention is：
Epstein-Barr virus miR-BART10-5p inhibitor is preparing the application in treating nasopharyngeal carcinoma preparation；The Epstein-Barr virus
The nucleotides sequence of miR-BART10-5p is classified as：
GCCACCUCUUUGGUUCUGUACAUACAGAACCAAAGAGGUGGCUU(SEQ ID NO:1)。
As the preferred of above application, Epstein-Barr virus miR-BART10-5p inhibitor is preparing the anti-nasopharyngeal carcinoma blood vessel life for the treatment of
At the application in preparation.
As the preferred of above application, Epstein-Barr virus miR-BART10-5p inhibitor is Epstein-Barr virus miR-BART10-5p antisenses
Oligonucleotides, the Epstein-Barr virus miR-BART10-5p antisense oligonucleotides can be with the nucleotide of Epstein-Barr virus miR-BART10-5p
At least five oligonucleotides complementary pairing in sequence.
As the preferred of above application, Epstein-Barr virus miR-BART10-5p antisense oligonucleotides is：
UGUACAGAACCAAAGAGGUGGC(SEQ ID NO:2)。
A kind of anti-nasopharyngeal carcinoma angiogenesis preparation, contains Epstein-Barr virus miR-BART10-5p inhibitor.
As the preferred of above-mentioned preparation, Epstein-Barr virus miR-BART10-5p inhibitor is Epstein-Barr virus miR-BART10-5p antisenses
Oligonucleotides, the Epstein-Barr virus miR-BART10-5p antisense oligonucleotides can be with the nucleotide of Epstein-Barr virus miR-BART10-5p
At least five oligonucleotides complementary pairing in sequence.
As the preferred of above-mentioned preparation, Epstein-Barr virus miR-BART10-5p inhibitor is that Epstein-Barr virus miR-BART10-5p is anti-
Oligonucleotide is formed by chemical modification, the Epstein-Barr virus miR-BART10-5p antisense oligonucleotides energy and Epstein-Barr virus
At least five oligonucleotides complementary pairing in the nucleotide sequence of miR-BART10-5p.
As the preferred of above-mentioned preparation, the Epstein-Barr virus miR-BART10-5p inhibitor is by Epstein-Barr virus miR-
BART10-5p Antisensedigonucleotsequence sequences 3 ' end carry out cholesterol modifications, 5 ' end carry out two thio backbone modifications, 3 ' hold into
Four thio backbone modifications of row, full chain carry out 2 ' methoxyl groups and modify.
As the preferred of above-mentioned preparation, Epstein-Barr virus miR-BART10-5p antisense oligonucleotides is：
UGUACAGAACCAAAGAGGUGGC(SEQ ID NO:2)。
As the preferred of above-mentioned preparation, the preparation can be applied to the recurrence and transfer of prevention and treatment nasopharyngeal carcinoma.
The beneficial effects of the invention are as follows：
The present invention is had found using micro- tube formation assay and chick chorioallantoic membrane experimental analysis, in height in nasopharyngeal carcinoma cell
The Epstein-Barr virus miR-BART10-5p of degree expression can be obviously promoted nasopharyngeal carcinoma angiogenesis.
The Epstein-Barr virus miR-BART10-5p inhibitor of the present invention is with the antisense oligonucleotides of Epstein-Barr virus miR-BART10-5p
Based on acid, obtained by series modification, it is real by micro- tube formation assay, chick chorioallantoic membrane experiment and matrigel bolt
It tests, it was confirmed that Epstein-Barr virus miR-BART10-5p inhibitor can obviously inhibit the effect of the generation of nasopharyngeal carcinoma new vessels, have
Nasopharyngeal carcinoma effect is treated, through a step, the recurrence and transfer of prevention nasopharyngeal carcinoma can also be applied to.
The Epstein-Barr virus miR-BART10-5p inhibitor of the present invention is according to microRNA maturation body sequence designs, by spy
The single-stranded tiny RNA of different label and chemical modification is used exclusively for inhibiting the efficient blocking agent of endogenous microRNA；With it is common
MiRNA inhibitor is compared, and is had and is substantially reduced with cell membrane affinity higher, cell transfection assays transfection reagent dosage, can be rich
Combine in target cell, realize that efficient specificity stablizes interference, and may be used the various ways such as systemic injection or local injection to
Medicine, it is easy to operate, inhibit the duration long, at least up to one week, sustainable 5~6 weeks of longest；And miRNA non-immunogenicities, have
Conducive to preferably being treated to nasopharyngeal carcinoma, be conducive to further clinical development and application.
Description of the drawings
Fig. 1：The concrete outcome of the micro- tube formation assay of Epstein-Barr virus miR-BART10-5p of the present invention, control group in figure
For negative control experiment as a result, BART10-5p is the experimental result after Epstein-Barr virus miR-BART10-5p effects；Figure A is microscope
Observation chart, figure B are micro-pipe statistical data figure；
Fig. 2：The concrete outcome of the micro- tube formation assay of Epstein-Barr virus miR-BART10-5p inhibitor of the present invention, in figure
Control group be negative control experiment as a result, BART10-5p inhibitor groups be Epstein-Barr virus miR-BART10-5p inhibitor effect after
Experimental result；Figure A is microscope observation chart, and figure B is micro-pipe statistical data figure；
Fig. 3：The concrete outcome of Epstein-Barr virus miR-BART10-5p chick chorioallantoic membranes of the present invention experiment, in figure
Control group be negative control experiment as a result, BART10-5p inhibitor groups be Epstein-Barr virus miR-BART10-5p inhibitor effect after
Experimental result；Figure A is microscope observation chart, and figure B is blood vessel occupied area percentage statistic figure；
Fig. 4：The specific knot of Epstein-Barr virus miR-BART10-5p inhibitor chick chorioallantoic membranes experiment of the present invention
Fruit, control group is negative control experiment as a result, BART10-5p inhibitor groups are Epstein-Barr virus miR-BART10-5p inhibitor in figure
Experimental result after effect；Figure A is microscope observation chart, and figure B is blood vessel occupied area percentage statistic figure；
Fig. 5：The concrete outcome of Epstein-Barr virus miR-BART10-5p inhibitor matrigel bolt of the present invention experiment, in figure
Control group be negative control experiment as a result, BART10-5p inhibitor groups be Epstein-Barr virus miR-BART10-5p inhibitor effect after
Experimental result；Figure A is matrigel bolt outside drawing；Figure B is content of hemoglobin statistical data figure.
Specific implementation mode
It further illustrates the present invention, is not intended to limit the present invention below in conjunction with specific implementation mode.
Unless otherwise specified, molecular biology, microbiology, cell biology, immunology and the technology used in the present invention
Belong to this field ordinary skill.
Antisense oligonucleotides：Artificial synthesized, with target gene or the nucleic acid fragment of a certain section complementations of mRNA, can pass through
Base complementrity principle is incorporated on target gene/mRNA, to the expression of block gene.
The human nasopharyngeal epithelioma 1 CNE1 used in the present invention is purchased from Hunan Xiangya Medical College, Zhongnan Univ central laboratory；Carefully
Born of the same parents' transfection carrier is carrier with commercialization liposome Lipofectamine2000；Epstein-Barr virus miR-BART10-5p and its inhibition
Shanghai JiMa pharmacy Technology Co., Ltd's synthesis is entrusted in agent.
Embodiment 1, Epstein-Barr virus miR-BART10-5p, Epstein-Barr virus miR-BART10-5p antisense oligonucleotides, Epstein-Barr virus
MiR-BART10-5p inhibitor
(1) Epstein-Barr virus miR-BART10-5p
It is as follows to go out Epstein-Barr virus miR-BART10-5p sequences according to international common sanger mirbase database retrievals：
GCCACCUCUUUGGUUCUGUACAUACAGAACCAAAGAGGUGGCUU(SEQ ID NO:1)
(2) Epstein-Barr virus miR-BART10-5p antisense oligonucleotides
It is carried out according to the sequence of the Epstein-Barr virus miR-BART10-5p in international common sanger mirbase databases anti-
Justice design；Wherein, the basic principle of probe design is 1) hairpin structure of probe interior is no more than 2；2) compare through BLAST
It is less than 20% with the similitude of other sequences；3) compare and the continuous no more than 3 alkali of the repetition of other gene orders through BLAST
Base；It is as follows to obtain Antisensedigonucleotsequence sequence：
UGUACAGAACCAAAGAGGUGGC(SEQ ID NO:2)
(3) Epstein-Barr virus miR-BART10-5p inhibitor
Preparation method and purification process are as follows：
The SEQ ID NO obtained with embodiment 1:Based on nucleotide sequence shown in 2, with the solid phase phosphoramidite of standard
Quasar-570 is attached to the end of oligonucleotides 5 ' and obtains fluorescent marker by synthetic method, using 5- ethlythiotetrazoles as activator,
Extend reaction in the acetonitrile of a concentration of 0.1M 15 minutes to complete endcapped reaction, oxidation reaction and the deprotection of oligonucleotides
Effect carries out cholesterol modification, 5 ' the two thio backbone modifications in end, 3 ' the four thio backbone modifications in end, full chain 2 ' to its 3 ' end
The inhibitor of Epstein-Barr virus miR-BART10-5p is obtained after methoxyl group modification.
Then purified with HPLC and is eluted and collected eluent to synthesis column, then, frost, removes ammonium hydroxide at drying,
It is dissolved in 9：In 1 first phthalein amine and TBE mixed solutions；It is splined on HPLC to be purified, mobile phase is to contain 20mM containing 10%
The acetonitrile (solvent A) of NaOAC and 70% acetonitrile (solvent B) containing 20mM NaOAC, after alcohol precipitation, washing, vacuum are drained
It is saved backup in -20 DEG C.
Experimental example 1, micro- tube formation assay
Epstein-Barr virus miR-BART10-5p and its inhibitor on human huve cell are detected using micro- tube formation assay
The influence that HUVEC micro-pipes are formed, is as follows：
Take about 105~2 × 105Human nasopharyngeal epithelioma 1 CNE1 is cultivated with not antibiotic containing 10% fetal calf serum completely
Base (RPMI 1640), which is cultivated, is inoculated in 6 orifice plates, 37 DEG C, 5% CO2Incubator is incubated overnight, and next day waits for that cell density reaches
About 60% starts to transfect.Lipofectamine 2000 is diluted with Opti-men culture mediums, while dilute with Opti-men culture mediums
Epstein-Barr virus miR-BART10-5p and its inhibitor are released, after being incubated at room temperature 5min, diluted lipofectamine 2000 is distinguished
With diluted Epstein-Barr virus miR-BART10-5p and its inhibitor mixed, it is incubated at room temperature 20min, after 6 orifice plates cell removes training base,
PBS is rinsed 2 times, after 1.5mLOpti-men culture mediums are added, above-mentioned mixed liquor more than needed is separately added into corresponding hole, gently
Light mixing, 37 DEG C, 5% CO2Incubator is incubated 6~8h, takes the nose for having transfected Epstein-Barr virus miR-BART10-5p and its inhibitor
The supernatant of pharynx cancer cell CNE1, it is spare.
Matrigel glue (BD Biosciences) solution that 50 μ L have diluted is taken to be added in 96 orifice plates of precooling, on ice
Placing 5min makes Matrigel glue (BD Biosciences) liquid level, is positioned over 37 DEG C of incubators and is at least incubated 1h, makes glue
Solidification.The supernatant for the nasopharyngeal carcinoma cell CNE1 for having transfected Epstein-Barr virus miR-BART10-5p and its inhibitor is mixed with HUVEC cells
It closes, is separately added into 96 orifice plates for being covered with Matrigel glue (BD Biosciences), in inverted light microscope after about 2~8h
Lower observation micro-pipe formational situation, counts micro-pipe and is counted.
Experimental result is as depicted in figs. 1 and 2, and Fig. 1 shows compared with the control group, Epstein-Barr virus miR-BART10-5p group micro-pipes
Quantity showed increased illustrates that Epstein-Barr virus miR-BART10-5p can promote the generation of nasopharyngeal carcinoma new vessels；Fig. 2 shows and compares
Group is compared, and Epstein-Barr virus miR-BART10-5p inhibitor group micro-pipe quantity significantly reduces, and illustrates Epstein-Barr virus miR-BART10-5p suppressions
Preparation can obviously inhibit the generation of nasopharyngeal carcinoma new vessels.
Experimental example 2, chick chorioallantoic membrane experiment
By SPF grades of fertilized eggs surface cleaning, it is used in combination 1:1000 bromogeramines impregnate 3min, wipe it is dry after by egg gas chamber to
On be put into standard incubator and hatch；It is incubated 7day, takes egg embryo to mark gas chamber and the position of foetus under ovoscopy lamp, and attached in the position of foetus
Closely without label windowing position at blood vessel.ANER DIAN sterilizes plenum roof and mark, and an aperture is bored outside plenum roof, is then used
Small hacksaw and ophthalmic tweezers carefully peel off 1x1cm size eggshells in mark, and the drop of sterile saline one is added dropwise on shell membrane, uses rubber
Hide glue nipple causes gas chamber negative pressure, physiological saline to sink in the suction of gas chamber end aperture, and artificial vacation gas chamber is formed, with sterile transparent glue
Film sealing label is set and continues to be incubated for 24 hours in incubator；Tear transparent adhesive tape be added 100ul transfected Epstein-Barr virus miR-BART10-5p and its
The supernatant of the nasopharyngeal carcinoma cell CNE1 of inhibitor is put into opposite avascular area on CAM, the closing of sterile transparent glued membrane in incubator
It is incubated；It is incubated the 11st day, with the tincture of iodine and ethanol disinfection inoculation position and surrounding, tears chorion at closing off, expanded with aseptic nipper
Opening shows micro- sem observation with camera or body and takes pictures.
Experimental result is as shown in Figure 3 and Figure 4, and Fig. 3 shows compared with the control group, and Epstein-Barr virus miR-BART10-5p groups are newborn
Blood vessel number showed increased illustrates that Epstein-Barr virus miR-BART10-5p can promote the generation of nasopharyngeal carcinoma new vessels；Fig. 4 show with
Control group is compared, and Epstein-Barr virus miR-BART10-5p inhibitor group new vessels quantity significantly reduces, and illustrates Epstein-Barr virus miR-
BART10-5p inhibitor can obviously inhibit the generation of nasopharyngeal carcinoma new vessels.
Experimental example 3, the experiment of matrigel bolt
The b-FGF (PeproTech) of the Matrigel glue (BD Biosciences) of low growth factor and 1 μ g/mL is mixed
It closes, operates on ice, experimental group is separately added into the nasopharyngeal carcinoma cell CNE1 for having transfected Epstein-Barr virus miR-BART10-5p and its inhibitor
Supernatant, control group be added PBS, total volume be 700 μ L.It is close that the matrigel mixed liquor prepared is injected into nude mice side abdominal vascular
Ji Chu.After 7 days, nude mice is died suddenly, matrigel bolt is taken out, takes pictures and detect content of hemoglobin.
Experimental result is as shown in figure 5, compared with the control group, Epstein-Barr virus miR-BART10-5p inhibitor group new vessels numbers
Amount and content of hemoglobin significantly reduce, and illustrate that Epstein-Barr virus miR-BART10-5p inhibitor can obviously inhibit nasopharyngeal carcinoma newborn
The generation of blood vessel.
To sum up, Epstein-Barr virus miR-BART10-5p inhibitor can obviously inhibit the effect of the generation of nasopharyngeal carcinoma new vessels,
Further the recurrence and transfer of nasopharyngeal carcinoma can also be prevented with treatment nasopharyngeal carcinoma effect.
SEQUENCE LISTING
<110>Nanfang Medical Univ's Shenzhen hospital
<120>The application of Epstein-Barr virus miR-BART10-5p inhibitor
<130>
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 44
<212> RNA
<213>Epstein-Barr virus
<400> 1
gccaccucuu ugguucugua cauacagaac caaagaggug gcuu 44
<210> 2
<211> 22
<212> RNA
<213>Artificial sequence
<400> 2
uguacagaac caaagaggug gc 22
Claims (10)
1.EB virus miR-BART10-5p inhibitor is preparing the application in treating nasopharyngeal carcinoma preparation；The Epstein-Barr virus miR-
The nucleotides sequence of BART10-5p is classified as：
GCCACCUCUUUGGUUCUGUACAUACAGAACCAAAGAGGUGGCUU。
2. application according to claim 1, it is characterised in that：Epstein-Barr virus miR-BART10-5p inhibitor is preparing treatment
Application in anti-nasopharyngeal carcinoma angiogenesis preparation.
3. application according to claim 1 or 2, it is characterised in that：Epstein-Barr virus miR-BART10-5p inhibitor is Epstein-Barr virus
MiR-BART10-5p antisense oligonucleotides, the Epstein-Barr virus miR-BART10-5p antisense oligonucleotides can be with Epstein-Barr virus miR-
At least five oligonucleotides complementary pairing in the nucleotide sequence of BART10-5p.
4. application according to claim 3, it is characterised in that：Epstein-Barr virus miR-BART10-5p antisense oligonucleotides is：
UGUACAGAACCAAAGAGGUGGC。
5. a kind of anti-nasopharyngeal carcinoma angiogenesis preparation, it is characterised in that：Contain Epstein-Barr virus miR-BART10-5p inhibitor.
6. a kind of preparation of anti-nasopharyngeal carcinoma angiogenesis according to claim 5, it is characterised in that：Epstein-Barr virus miR-
BART10-5p inhibitor is Epstein-Barr virus miR-BART10-5p antisense oligonucleotides, and the Epstein-Barr virus miR-BART10-5p is anti-
Oligonucleotide can be at least five oligonucleotides complementary pairing in the nucleotide sequence of Epstein-Barr virus miR-BART10-5p.
7. a kind of anti-nasopharyngeal carcinoma angiogenesis preparation according to claim 5, it is characterised in that：Epstein-Barr virus miR-
BART10-5p inhibitor is to form Epstein-Barr virus miR-BART10-5p antisense oligonucleotides by chemical modification, EB diseases
Malicious miR-BART10-5p antisense oligonucleotides can be at least five few nucleosides in the nucleotide sequence of Epstein-Barr virus miR-BART10-5p
Sour complementary pairing.
8. a kind of anti-nasopharyngeal carcinoma angiogenesis preparation according to claim 7, it is characterised in that：The Epstein-Barr virus miR-
BART10-5p inhibitor is to hold to carry out cholesterol modifications by the 3 ' of Epstein-Barr virus miR-BART10-5p Antisensedigonucleotsequence sequences, 5 '
End carries out two thio backbone modifications, and 3 ' ends carry out four thio backbone modifications, and full chain carries out 2 ' methoxyl groups and modifies.
9. according to a kind of anti-nasopharyngeal carcinoma angiogenesis preparation of claim 6~8 any one of them, it is characterised in that：Epstein-Barr virus
MiR-BART10-5p antisense oligonucleotides is：
UGUACAGAACCAAAGAGGUGGC。
10. according to a kind of anti-nasopharyngeal carcinoma angiogenesis preparation of claim 5~8 any one of them, it is characterised in that：The system
Agent can be applied to the recurrence and transfer of prevention and treatment nasopharyngeal carcinoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711277063.1A CN108272815B (en) | 2017-12-06 | 2017-12-06 | Application of EB virus miR-BART10-5p inhibitor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711277063.1A CN108272815B (en) | 2017-12-06 | 2017-12-06 | Application of EB virus miR-BART10-5p inhibitor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108272815A true CN108272815A (en) | 2018-07-13 |
| CN108272815B CN108272815B (en) | 2020-09-11 |
Family
ID=62801256
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711277063.1A Active CN108272815B (en) | 2017-12-06 | 2017-12-06 | Application of EB virus miR-BART10-5p inhibitor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108272815B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113215318A (en) * | 2021-05-18 | 2021-08-06 | 南方医科大学第三附属医院（广东省骨科研究院） | Primer, kit and detection method for detecting EBV-miRNA-BART10-3P |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100004320A1 (en) * | 2006-04-03 | 2010-01-07 | Santaris Pharma A/S | Pharmaceutical Composition |
| US20100216139A1 (en) * | 2008-11-10 | 2010-08-26 | Battelle Memorial Institute | METHODS, COMPOSITIONS, AND DEVICES UTILIZING MicroRNA TO DETERMINE PHYSIOLOGICAL CONDITIONS |
| CN102268477A (en) * | 2011-06-15 | 2011-12-07 | 中山大学肿瘤防治中心 | Application of nasopharyngeal carcinoma related EB (Epstein-Barr) virus miRNAs (microribonucleic acids) |
| WO2013187612A1 (en) * | 2012-06-14 | 2013-12-19 | 가톨릭대학교 산학협력단 | Composition for restricting apoptosis, including mirna of epstein-barr virus, or promoting cell proliferation |
| CN105154446A (en) * | 2015-07-17 | 2015-12-16 | 中南大学 | Application method of EB virus encoded microRNA BART10 antisense oligodeoxynucleotide |
-
2017
- 2017-12-06 CN CN201711277063.1A patent/CN108272815B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100004320A1 (en) * | 2006-04-03 | 2010-01-07 | Santaris Pharma A/S | Pharmaceutical Composition |
| US20100216139A1 (en) * | 2008-11-10 | 2010-08-26 | Battelle Memorial Institute | METHODS, COMPOSITIONS, AND DEVICES UTILIZING MicroRNA TO DETERMINE PHYSIOLOGICAL CONDITIONS |
| CN102268477A (en) * | 2011-06-15 | 2011-12-07 | 中山大学肿瘤防治中心 | Application of nasopharyngeal carcinoma related EB (Epstein-Barr) virus miRNAs (microribonucleic acids) |
| WO2013187612A1 (en) * | 2012-06-14 | 2013-12-19 | 가톨릭대학교 산학협력단 | Composition for restricting apoptosis, including mirna of epstein-barr virus, or promoting cell proliferation |
| CN105154446A (en) * | 2015-07-17 | 2015-12-16 | 中南大学 | Application method of EB virus encoded microRNA BART10 antisense oligodeoxynucleotide |
Non-Patent Citations (4)
| Title |
|---|
| COSMOPOULOS, K, ET AL.: "Comprehensive Profiling of Epstein-Barr Virus MicroRNAs in Nasopharyngeal Carcinoma", 《JOURNAL OF VIROLOGY》 * |
| S. CALLEGARI, ET AL: "Epstein–Barr virus encoded microRNAs target SUMO-regulated cellular functions", 《FEBS JOURNAL》 * |
| ZENG ZY, ET AL.: "Regulation network and expression profiles of Epstein-Barr virus-encoded microRNAs and their potential target host genes in nasopharyngeal carcinomas", 《SCI CHINA LIFE SCI》 * |
| 袁存存 等: "慢病毒介导的ebv-miR-BART7 稳定过表达鼻咽癌细胞株CNE1的建立", 《南方医科大学学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113215318A (en) * | 2021-05-18 | 2021-08-06 | 南方医科大学第三附属医院（广东省骨科研究院） | Primer, kit and detection method for detecting EBV-miRNA-BART10-3P |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108272815B (en) | 2020-09-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107586759A (en) | A kind of construction method of recombinant Newcastle disease virus and application | |
| CN104887694B (en) | A kind of antisense oligonucleotides targeting non-coding RNA and its application in preparing anti-influenza virus medicament | |
| CN108272815A (en) | The application of Epstein-Barr virus miR-BART10-5p inhibitor | |
| CN101906417B (en) | shRNA for hepatitis B virus and recombinant adeno-associated virus vector treating vector carrying same | |
| CN109876144B (en) | Purposes of the EMC8 gene inhibitor in preparation treatment gastric cancer medicament | |
| CN104940955B (en) | A kind of applications of microRNA in the medicine for preparing treatment influenza | |
| CN113509489A (en) | New use of sodium selenite or composition containing sodium selenite for preventing or treating African swine fever | |
| CN101235364B (en) | Newcastle disease virus D90 strain and application thereof | |
| CN103933578B (en) | Application of miRNA-185 and pharmaceutical composition containing same | |
| CN115317625B (en) | Application of small interfering RNA in preparation of medicine for improving nasopharyngeal carcinoma prognosis | |
| CN107582525A (en) | TRIM31 inhibitor magnetic target drug bearing microspheres are preparing the application in suppressing PDAC multiplication capacity medicines | |
| CN106381297A (en) | Double-stranded p-siRNA molecule and p-siRNA recombinant plasmid for inhibiting SOX2 gene expression, and application thereof | |
| CN108070591A (en) | Nucleic acid molecules CTL4HSH4, its preparation method and application | |
| CN107868782A (en) | Nucleic acid molecules CTL4HSH3, its preparation method and application | |
| CN107881171A (en) | Nucleic acid molecules CTL4HSH12, its preparation method and application | |
| CN108118053A (en) | Nucleic acid molecules CTL4HSH16, its preparation method and application | |
| CN108118052A (en) | Nucleic acid molecules CTL4HSH17, its preparation method and application | |
| CN107868783A (en) | Nucleic acid molecules CTL4HSH2, its preparation method and application | |
| CN104117060A (en) | Tumor vaccine and preparation method thereof | |
| CN100430412C (en) | Nucleic acid molecule RTN4BSR6 and application for preparation of anti-cancer drugs | |
| CN108070590A (en) | Nucleic acid molecules CTL4HSH5, its preparation method and application | |
| CN108330128A (en) | Nucleic acid molecules CTL4HSH10, preparation method and application | |
| CN108315329A (en) | Nucleic acid molecules CTL4HSH13, preparation method and application | |
| CN117467770A (en) | Biomarker for diagnosing colon cancer and application thereof | |
| CN114958780A (en) | Bovine Aichivirus D virus isolate and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |