CN108220434A - A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment cholangiocarcinoma - Google Patents
A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment cholangiocarcinoma Download PDFInfo
- Publication number
- CN108220434A CN108220434A CN201711331671.6A CN201711331671A CN108220434A CN 108220434 A CN108220434 A CN 108220434A CN 201711331671 A CN201711331671 A CN 201711331671A CN 108220434 A CN108220434 A CN 108220434A
- Authority
- CN
- China
- Prior art keywords
- pvt1
- cholangiocarcinoma
- seq
- cell
- long
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention belongs to genetic engineering field, more particularly to a kind of long-chain non-coding RNA, PVT1 and combinations thereof, the application in diagnosis cholangiocarcinoma and target drug treatment is prepared.Meanwhile the invention further relates to its primers, are preparing the application in diagnosing straight colon cancer reagent.By studying the expression of the long-chain non-coding RNA cellular level, itself and the pathogenetic relationship of cholangiocarcinoma are disclosed.
Description
Technical field
The invention belongs to genetic engineering field, more particularly to a kind of long-chain non-coding RNA, PVT and combinations thereof, it is preparing
Diagnose the application in cholangiocarcinoma and target drug treatment.Meanwhile the invention further relates to its primers, and cholangiocarcinoma reagent is diagnosed preparing
In application.By studying the expression of the long-chain non-coding RNA cellular level, itself and the pathogenetic pass of cholangiocarcinoma are disclosed
System.
Background technology
Tumour is a big main arch-criminal of serious threat human health, to malignancy of tumor progress Study on Molecular Mechanism always
It is educational circles's focus of attention and difficult point.Studies have reported that, tumour cell has in growth course promotes proliferation and invasion to turn
It moves, continues angiogenesis, the cell phenotypes feature such as immune tolerance and immunologic escape.Research shows that the growth of tumour cell is one
A complexity polygenes regulation and control and multi-step, Multi stage development process, including p53, p21 etc. the inactivation of tumor suppressor genes and
The activation of the proto-oncogenes such as Blc1, Myc.So far, the mechanism of malignant tumour is not fully apparent from yet, is needed further
It explores.
Researches show that：In addition to the encoding gene that these have been widely studied, long non-coding RNA (long noncoding
RNAs, lncRNAs) unconventionality expression also assist in malignancy of tumor progress.LncRNAs is that a kind of transcript length is more than 200nt
RNA molecules are different from other small molecule non-coding RNAs, can cis- (in cis) or trans- (in trans) effect side
Formula adjusts RNA metabolism, protein function activity, histone modification and chromatin remodeling, in epigenetics, transcription and transcription
Horizontal wide participation cell biological processes afterwards.More and more researchs confirm that lncRNAs is not only in the normal life for maintaining body
Important regulating and controlling effect, the evil of the occurrence and development especially tumour of unconventionality expression and disease are played in reason function and growth course
Property progress have close contact.
Cholangiocarcinoma (cholangiocarcinoma, CCA) is initiated by the pernicious of the Highly invasive of bile duct epithelial cell
Tumour, global incidence, in ascendant trend year by year especially in Asian countries, survival rate is less than 5% within 5 years.Cholangiocarcinoma is early
Phase incidence of occult, often without apparent clinical manifestation, to middle and advanced stage when clarifying a diagnosis.Although current existing operation, radiotherapy, chemotherapy
Clinical treatments means are waited, but the prognosis of cholangiocarcinoma patients is still very poor.Some researches show that the unconventionality expression mediations of lncRNAs
Cholangiocarcinoma malignant progression.The H19 and HULC of up-regulation can promote the migration and invasion of cholangiocarcinoma cell by ceRNA mechanism.
LncRNA CPS1intronic transcript 1 (CPS1-IT1) can promote the proliferation of cholangiocarcinoma cell and inhibit apoptosis, and
Influence liver function and the prognosis of patient.Further literature search result is shown：LncRNAs can be by playing the work of proto-oncogene
With the biological processes such as participation cholangiocarcinoma cell proliferation, apoptosis and invasion transfer prompt more cholangiocarcinoma malignant progressions related
The function and mechanism of lncRNAs has the necessity further studied.
Invention content
The object of the present invention is to provide a kind of long-chain non-coding RNA cholangiocarcinoma medicine is treated in diagnosis cholangiocarcinoma and preparing
Application in object.The present invention uses following technical scheme：
The present invention provides a kind of long-chain non-coding RNA, PVT1, which is characterized in that length 1957bp, sequence such as SEQ
ID NO:Shown in 1, i.e.,:
The reagent for detecting above-mentioned long-chain non-coding RNA is preparing the application in diagnosing cholangiocarcinoma reagent
Further, the present invention also provides a kind of pharmaceutical composition, the detection examination including diagnosing above-mentioned long-chain non-coding RNA
Agent.
Further, the pharmaceutical composition is preparing the application in treating bile duct cancer drug.
On the other hand, the present invention also provides the primer sets of two groups of detection PVT1, and sequence is respectively such as SEQ ID NO：2nd, 3 and
4th, shown in 5, i.e.,：SEQ ID NO:2PVT1FTGAGAACTGTCCTTACGTGACC, SEQ ID NO：3PVT1
RAGAGCACCAAGACTGGCTCT, SEQ ID NO:4FAGCCACATCGCTCAGACAC, SEQ ID NO:
5RGCCCAATACGACCAAATCC。
Further, the present invention is claimed any one above-mentioned primer and is preparing the application in diagnosing cholangiocarcinoma reagent.
In addition, the present invention also provides a kind of kit, include the primer of above-mentioned any one detection PVT1；Preferably, institute
State a concentration of 0.01~0.1mol/L of primer in kit.
On the other hand, the present invention provides a kind of pharmaceutical composition for treating cholangiocarcinoma, including the inhibitor of PVT1.
Further, the inhibitor of the PVT1 is the siRNA of PVT1, which is characterized in that its sequence such as SEQ ID NO:
6,7 and SEQ ID NO:Shown in 8,9, i.e.,：
si-PVT1 1#:
GCUUGGAGGCUGAGGAGUUTT SEQ ID NO:6
AACUCCUCAGCCUCCAAGCTT SEQ ID NO:7
si-PVT1 2#:
CCCAACAGGAGGACAGCUUTT SEQ ID NO:8
AAGCUGUCCUCCUGUUGGGTTSEQ ID NO:9
Technology path
First, experimental subjects
We have collected 17 pairs and are connect at The Second Affiliated Hospital of Nanjing Medical University's biological therapy center for 2015 to 2016
By diagnose and treat cholangiocarcinoma patients and do not contain the healthy volunteer of the disease and organize.Tissue specimen collection is
First time liquid nitrogen is stored in -80 DEG C, until RNA is extracted.The research is ratified by Ethics Committee of Nanjing Medical University.It obtains
Obtain the written informed consent of all patients.
2nd, experimental facilities and reagent
Experimental method used in the present invention and investigative technique：Such as the extraction of total serum IgE and protein, clone technology, cell
Transfection, ChIP experiments, RIP experiments, use of Western blot, fluorescence real-time quantitative PCR, bioinformatic database etc.；
Required experiment material such as antibody, kit etc. is commercially available.
Team of the present invention relies on Nanjing Medical University, required each equipment, such as fluorescence quantitative PCR instrument, flow cytometer, enzyme mark
Instrument, CO2Incubator, low-temperature and high-speed centrifuge, fluorescence inverted microscope, laser confocal microscope etc. and experimental animal,
It can be used directly.
3rd, experimental procedure and result
1. testing route schematic diagram, inventive concept according to the present invention, experiment route schematic diagram is shown in attached drawing 8.
2.PVT1 conspicuousness height in cholangiocarcinoma is expressed：It detects PVT1 expressions in cholangiocarcinoma sample and analyzes it
Correlation carries out bioinformatic analysis, searches by cholangiocarcinoma-cancer in gene expression integrated database (i.e. GEO databases)
Normalization data is downloaded and carries out differential expression data analysis by chip data；It is final to obtain the differential expression by cancer-cancer
lncRNAs.It is that conspicuousness raises (P values in data to determine PVT1<0.001, FDR<0.05) a lncRNA.Experimental result
In Fig. 1, PVT1 is in the differential expression situation by cancer-cancer for display：(A) the expression in cholangiocarcinoma modal data of GEO databases is shown：
Relative to cancer side or normal structure, PVT1 high expression in cancer, ordinate is standardized score z values；(B) Wei Entu shows GEO
The lincRNA raised jointly in expression in cholangiocarcinoma the modal data GSE61850 and GSE63420 of database；Collect cholangiocarcinoma Sample is tested using fluorescence real-time quantitative PCR (qRT-PCR) technology in 17 pairs of cholangiocarcinomas and its cancer beside organism Card, as a result shows that PVT1 averagely raises about 5 times, as a result shows in fig. 1 c。
3.PVT1 promotes the research of cholangiocarcinoma cell malignant progression
1)It synthesizes PVT1 interference sequences (siRNA) and is overexpressed plasmid, transfection cholangiocarcinoma cell system；
Interference sequence such as SEQ ID NO:6,7 and SEQ ID NO:Shown in 8,9, i.e.,：
si-PVT1 1#:
GCUUGGAGGCUGAGGAGUUTT
AACUCCUCAGCCUCCAAGCTT
si-PVT1 2#:
CCCAACAGGAGGACAGCUUTT
AAGCUGUCCUCCUGUUGGGTT。
2) qRT-PCR detections inhibit and are overexpressed efficiency, cck8, Clone formation, Transwell, Flow Cytometry inspection
It surveys closing and is overexpressed the influence after PVT1 to cholangiocarcinoma proliferation, apoptosis and invasion transfer cell function.Further evaluate PVT1
Biological function in cholangiocarcinoma cell specifies its oncogene function.
Experimental result is shown in fig. 2：(A) jamming effectiveness of the PVT1 in cholangiocarcinoma epithelial cell (HuCCT1 cells) be most
It is high by reachable 90%；Jamming effectiveness in human bile duct carcinoma (RBE cells) is up to 75%.(B) colony formation result is shown
Show：PVT1 is interfered to inhibit the proliferation of HuCCT1 cells and RBE cells；(C) CCK8 experimental results are shown：Inhibit after interference PVT1
The proliferation of HuCCT1 cells and RBE cells；(D) Transwell experimental results are shown：Interfere PVT1 inhibit HuCCT1 cells and
The invasion transfer of RBE cells；(E) flow cytomery result is shown：After interfering PVT1, the apoptosis of HuCCT1 and RBE cells
Showed increased；(F) flow cytomery result is shown：After interfering PVT1, RBE cell cycles are mainly arrested in G1
Phase.
4.PVT1 improves the tumour Forming ability of cholangiocarcinoma cell in vivo
1) structure PVT1 interference and the slow virus carrier being overexpressed, are packaged into virus, transfect HuCCT1 cells, and screening is positive
Stable cell strain.
2) two kinds of cell groupings are injected into immunodeficient mouse (BALB/C nude mices), to build subcutaneously into knurl model.Treat knurl
After body is formed, survey a tumor volume within every 2 days, mouse is put to death after 4 weeks, take knurl, measure weight；Quantitative PCR detection PVT1's
Expression, paraffin embedding sample, HE dyeing, immunohistochemistry detection proliferation marker ki-67 variations.Further evaluate PVT1
Influence to cholangiocarcinoma cell proliferative capacity.
Experimental result is shown in figure 3：(A-B) nude mice by subcutaneous is tested into knurl, is observed and recorded mouse tumorous size, is treated knurl
Body puts to death mouse after being formed 16 days, take out knurl, photograph to record；It measures the size of knurl simultaneously and claims its weight；(C)：Knurl
Detection, the average weight for striking low sh-PVT1 2# groups mouse knurl are substantially less than the weight of control group knurl.
5. high-flux sequence PVT1 adjusts downstream target gene expression
The target gene for primarily determining that PVT1 is regulated and controled is sequenced using transcript profile：It is struck in HuCCT1 cell lines using siRNA
Low PVT1, the important target gene regulated and controled using transcript profile sequencing technologies high flux screening PVT1, and with qRT-PCR to surveying
Sequence result is verified.
Experimental result is shown in Fig. 4：(A) after interfering PVT1, PVT1 downstream influences obtained by transcript profile high-flux sequence
Difference expression gene, color represent z-score；(B) Go analysis shows that PVT1 formed with cellular vascular it is significantly correlated；(C-D) qPCR
And western blot experimental verifications interfered in cholangiocarcinoma cell strain HuCCT1 and RBE after PVT1 downstream target gene it is notable on
It adjusts.
6.PVT1 binds the apparent inhibition downstream target genes of EZH2
1) caryoplasm separating experiment determines that PVT1 is positioned in cholangiocarcinoma cell strain sub-cellular：Caryoplasm separating experiment determines PVT1
Cellular localization, by RIP technologies to identify PVT1 and EZH2 protein bindings in cholangiocarcinoma cell.
2) mechanism of PVT1 commitments cholangiocarcinoma cell malignant phenotype：
A. PVT1 is closed off and is overexpressed in cholangiocarcinoma cell, and qRT-PCR, western blot methods detect respectively
The mRNA of ANGPTL4, the expression of albumen.
B. after closing EZH2 in cholangiocarcinoma cell, ANGPTL4 is detected using qRT-PCR, western blot methods respectively
MRNA, albumen expression.
C. for identification in cholangiocarcinoma cell PVT1 whether with EZH2 specific bonds, carried out RNA co-immunoprecipitations (RNA
Immunoprecipitation, RIP) experiment bindings of the PVT1 and EZH2 in cholangiocarcinoma cell is further verified
(experimental result is shown in Fig. 4 B) as a result prompts the PVT1 in cholangiocarcinoma cell can be with EZH2 specific bonds.
EZH2 is to form the subunit uniquely in PRC2 compounds with enzymatic activity, and PRC2 is one and acts on histone H 3 and rely
The highly conserved histone methyltransferase of propylhomoserin site K27, biological function are the Transcriptional Silencings to differentiation gene.At present
Known to be studied by full-length genome, the normal action target spot of PRC2 is the key that transcription factor and signal path in a variety of organisms
Site.Research shows that EZH2 can be histone methylated so as to inhibit the expression of downstream target gene with the binding mediation of long-chain non-coding.
And research shows that, it can also cause ANGPTL4 gene upregulations after striking low EZH2.It has been reported that ANGPTL4 in liver cancer tissue
Expression quantity be substantially less than cancer beside organism, and the methylation on ANGPTL4 promoter regions CpG islands is higher than cancer in its tumor tissues
Side tissue, it was demonstrated that the high methylation on ANGPTL4 promoter region CpG islands causes its low expression in tumor tissues.And the past
The inhibition of gene expression research shows that histone methylated and DNA methylation can act synergistically.Prompt us:PVT1 can be bound The histone methylated inhibition so as to cause ANGPTL4 genes of EZH2 mediations is expressed。
d.PVT1 may be by binding the apparent expression for inhibiting the tumor suppressor genes such as ANGPTL4 genes of EZH2, so as to promote courage Pipe cancer cell malignant phenotype is in progress。
ChIP experiments confirm after striking and subtracting PVT1 that EZH2 and the binding demeanour of ANGPTL4 gene promoter areas reduce
The result of above-mentioned experiment shows in Figure 5, (A) caryoplasm separating experiment the result shows that：The transcript of PVT1 is mainly fixed
In nucleus；(B) RIP experiments confirm：PVT1 can be bound with EZH2 albumen；(C) qPCR and western blot are tested
Verification successfully interferes EZH2 genes in cholangiocarcinoma cell strain HuCCT1 and RBE.(D) qPCR verifications are done in HuCCT1 cells
After disturbing EZH2, downstream target gene gene significantly raises.
Fig. 6, shows ANGPTL4 genes (A) in cholangiocarcinoma in (A-C) GSE26566 databases, SPRY4 genes (B),
The expression of GDF15 (C) gene.(D-F) show EZH2 with ANGPTL4 genes in apparent negatively correlated in GSE26566 databases
(D), and the expression of EZH2 and SPRY4 genes (E) and GDF15 genes (F) without apparent negative correlativing relation.(G) in 17 pairs of cholangiocarcinomas
It is verified with cancer beside organism qPCR：ANGPTL4 is significantly lowered in cholangiocarcinoma.(H) ChIP experiments are confirmed after striking and subtracting PVT1,
EZH2 and the binding demeanour of ANGPTL4 gene promoter areas reduce；(I) ChIP experiments are confirmed after striking and subtracting PVT1, ANGPTL4 genes
The abundance of promoter region H3K27me3 reduces.
Advantageous effect
The present invention is pernicious from three clinical tissue sample, cell, model animal layer viewpoint PVT1 regulation and control cholangiocarcinoma cells
The mechanism of action of process is made further with relationship of qPCR, RIP Protocols in Molecular Biology means between PVT1 and target gene
Verification.The present invention has significant scientific meaning：PVT1 in cholangiocarcinoma overexpression and participate in epigenetic mediation increasing
Grow invasion mechanism；The utilization of the methods of bioinformatic analysis, transcript profile high-flux sequence, RIP, RNA-pulldown, mass spectrum
It ensure that the accuracy and systematicness of result；Abundant lncRNAs is regulated and controled cholangiocarcinoma occurrence and development by the successful implementation of this research
Molecular mechanism, disclosing PVT1 can provide as the marker of cholangiocarcinoma diagnosis, prognosis for clinic early stage cholangiocarcinoma clinical diagnosis and treatment
Experiment and theoretical foundation.
Description of the drawings
Fig. 1 PVT1 are in the differential expression situation of cancerous issue-cancer beside organism
Influences of Fig. 2 PVT1 to HuCCT1 cells and RBE cell Proliferations and cell cycle
Fig. 3 PVT1 form tumour cell the influence of size
Fig. 4 high-flux sequences PVT1 adjusts downstream target gene expression
Fig. 5 PVT1 bind the apparent inhibition downstream target genes of EZH2
The apparent expression for inhibiting ANGPTL4 genes of Fig. 6 PVT1 bindings EZH2
The apparent expression for inhibiting ANGPTL4 genes of Fig. 7 PVT1 bindings EZH2 is so as to promote the mechanism of cholangiocarcinoma malignant progression
Figure
Fig. 8 present invention tests route schematic diagram
Specific embodiment
It is further illustrated the present invention below with embodiment, but the present invention is not intended to be limited thereto.It is not noted in the following example
The experimental method of bright actual conditions, usually according to normal condition or according to the normal condition proposed by manufacturer.
1. bioinformatics method screens and determines high expression PVT1 in cholangiocarcinoma
(1) inclusion criteria enter GEO databases (http://www.ncbi.nlm.nih.gov/gds),Inquiry
" cholangiocarcinoma " and " cancer of biliary duct ", limitation filter condition " Entry type:
Series”、“Organism: Homo sapiens”、“Study type：Expression profiling by array " and
“Attribute name：Tissue " obtains the chip research query result about cholangiocarcinoma, selects the research met the following requirements
Project:Cholangiocarcinoma at the same containing case-control (or by cancer-cancer), mainstream chip platform (Affy, Agilent and Illumina),
Single channel chip.
(2) chip data analysis
It downloads and has normalization data or initial data is normalized using RMA Express；Calculate differential expression
Multiple (FC)；Z-score transformation is carried out to normalization data；Paired t-test or independent samples t-test are carried out according to sample situation later,
And FDR (false discovery rate) value is calculated, by P values<0.001, FDR<0.05 is defined as significant difference.
(3) lncRNAs Probe annotauons
LncRNAs notes are carried out to the probe collection of chip platform using the mode of probe sequence BLAST and BiomaRT inquiry
It releases, it is final to obtain significant difference lncRNAs.As a result, it has been found that PVT1 is the lncRNAs that conspicuousness raises in data.
2. it detects PVT1 expressions in cholangiocarcinoma sample and analyzes its correlation
Further collect the arrangement of cholangiocarcinoma and cancer beside organism's sample and its clinical data.Trizol methods extraction tissue
Total serum IgE, the RNA reverse transcriptions for taking 1 μ g are cDNA templates (TAKARA).Using qPCR in 17 pairs of cholangiocarcinomas and its cancer beside organism
In verified, as a result show that PVT1 averagely raises about 5 times.7500 type quantitative PCR apparatus of quantitative PCR application ABI companies
(Applied Biosystem, Foster City, CA) is as a result analyzed using 2- Δ Δ ct values.And analyze itself and clinic
The correlation of pathological data (TNM stage, pathological characters, prognosis etc.), to verify whether PVT1 can diagnose as cholangiocarcinoma, prognosis
Marker, up-regulated expression may be bile duct carcinogenesis, development crucial target molecule.
The primer sequence is as follows:
PVT1F：5’-TGAGAACTGTCCTTACGTGACC-3’
PVT1R：5’-AGAGCACCAAGACTGGCTCT-3’
GAPDH F：5’-AGCCACATCGCTCAGACAC-3’
GAPDH R：5’-GCCCAATACGACCAAATCC-3’
3.PVT1 in the functional study of cholangiocarcinoma cell
(1) siRNA molecule and overexpression plasmid (invitrogene companies) for PVT1 of design synthesis specificity turn
Cholangiocarcinoma cell is contaminated, using untransfected interference sequence as control；Design synthesis specificity PVT1 is overexpressed plamid vector transfection bile duct
Cancer cell, using empty carrier transfection group as control；The total serum IgE of cell is collected after 48 hours, qRT-PCR detects transfection efficiency respectively.
(2) after cholangiocarcinoma cell system closes off or is overexpressed PVT1, cck8, Clone formation, Transwell experiments, stream
To cholangiocarcinoma cell proliferation, cell invasion transfer and the functions such as cell cycle, apoptosis after formula cell technology detection closing PVT1
It influences.With biological functions of the clear and definite PVT1 in cholangiocarcinoma cell.
Functional verifications of the 4.PVT1 in model animal
The interference of PVT1 and overexpression slow virus carrier structure：The sequence of PVT1 and specific interference sequence are synthesized, with
The sequence of GAPDH (glyceraldehyde phosphate dehydrogenase) gene is as control.Above-mentioned segment is synthesized by Invitrogen TM companies, and
It is inserted into slow virus carrier；It is packaged into slow virus carrier infection RBE and HuCCT1 cells, G418 screening positive cells；It receives
The positive total serum IgE for surely turning cell of collection, qRT-PCR detect the expression of PVT1.It is subcutaneously noted respectively with itself and corresponding cellular control unit
BALB/C nude mices are penetrated, are built subcutaneously into knurl model；After knurl is formed, survey a tumor volume within every 2 days, mouse put to death after 4 weeks,
Knurl is taken, measures weight；Using the expression of quantitative PCR detection PVT1, paraffin embedding sample, HE dyeing, immunohistochemistry inspection
Survey proliferation marker ki-67 variations.
The Study on Molecular Mechanism of 5.PVT1 regulation and control cholangiocarcinoma cell proliferation
(1) target gene for primarily determining that PVT1 is regulated and controled is sequenced using transcript profile
A. the extraction (Trizol methods) of total serum IgE
After low PVT1 48h are struck in HuCCT1 cells, 500ul is added in control group and interference group cell respectively
Trizol places 10min；100 μ L chloroforms are added in, strenuous vibration 15s is stored at room temperature 5min；Centrifugation, 4 DEG C, 12,000g, 10
Supernatant is transferred in a new 1.5ml centrifuge tubes by min.Isometric isopropanol is added in, gently overturns mixing, -20 DEG C of placements
30min, centrifugation, 4 DEG C, 12,000g, 20min, reject supernatant.75% ethyl alcohol of 1ml precoolings is added in, washing precipitation centrifuges, 4
DEG C, 12,000g, 5min, reject supernatant, drying at room temperature 10min.Add in 30-50 μ l RNase-Free water, dissolve RNA, -80 DEG C
It preserves.
The quality inspection of b.RNA
2200 machines of Agilent are opened, open software；It is packed into corresponding R6K Agilent ScreenTape, volley of rifle fire dress
Enter 16 Loading pipette tips；8 unions are taken out, are separately added into 4 μ L R6K Sample Buffer and 1 μ LRNA in order
Sample；It is collected by centrifugation mixed liquor after mixing, 72 DEG C of 3min, on ice 2min；Centrifugation is then placed in collecting tube wall solution
In 2200 sample panels of Agilent；It clicks Start and starts quality inspection.
C. library construction
Transcript profile RNA fragmentations：The acquisition of poly (A) RNA；RNA fragmentations；Segment RNA purifying structures library：RNA adds
Connector；Reverse transcription；CDNA is purified；CDNA is expanded；Amplified production purifies.Library quality inspection：2200 machines of Agilent are opened, are beaten
Open software；Corresponding D6K Agilent ScreenTape are packed into, the volley of rifle fire is packed into 16 Loading pipette tips；Take out one 8 company
Pipe, 3 μ LD1K Ladder are added in the first pipe, 3 μ LD1K Sample Buffer and 1 μ L are separately added into remaining pipe
CDNA samples, vortex mixing 5s；Tube wall solution is collected by centrifugation, is then placed in 2200 sample panels of Agilent；Start is clicked to open
Prothyl is examined.
D. sequencing template prepares the dilution in library；Emulsion droplet PCR；The cleaning of pearl；The enrichment of positive pearl
E. upper machine sequencing
Clean sequenator；Sequenator initializes；Loading.
(2) caryoplasm separating experiment determines that PVT1 is positioned in cholangiocarcinoma cell strain sub-cellular
A. caryoplasm detaches, subcellular localization：Cholangiocarcinoma cell matter and nucleus are detached using life companies kit respectively
RNA determines that PVT1 in cytoplasm and nucleus distribution situation, is as follows：PBS cleans cell 2 times on ice；Pancreatin digests
Cell, is collected by centrifugation cell, and PBS cleaning cells are primary.Centrifuge cell adds in cell pyrolysis liquid, blows and beats mixing, is incubated on ice
10min, centrifugation, 4 DEG C, 500g, 5min.It draws supernatant and adds in isometric binding buffer, blow and beat mixing, add in isometric
Absolute ethyl alcohol, piping and druming are uniform；The primary removal cytoplasm rna of nucleus precipitation is cleaned with cell pyrolysis liquid to pollute, centrifugation, 4 DEG C,
500g, 5min go supernatant to add in nucleus lysate, are incubated 5-10 minutes on ice, add in isometric binding buffer, blow
Mixing is beaten, adds in isometric absolute ethyl alcohol.The good reaction solution of mixing, which adds in, to be collected in column, centrifugation, 4 DEG C, 12000g, 1min,
Until all reaction solutions, which pass through, collects column.Cleaning buffer solution cleaning collects column 2 times, and centrifugation, 4 DEG C, 12000g, 1min abandon cleaning
Liquid.Elutionbuffer is heated to 95-100 degrees Celsius to add in collection column, centrifugation, 4 DEG C, 12000g, 1min obtain institute
Need RNA；Carry out next step reverse transcription, qRT-PCR detections.
b.RIP：RNP compounds are precipitated to RBE cells and HuCCT1 cells EZH2 antibody mediated immunities.
By the extracting of the total serum IgE of precipitation.The total serum IgE of the DNAase1 processing extractions of no RNA enzyme.The RNA of extraction is carried out inverse
It transcribes and qRT-PCR is detected.
C.RNA-pulldown joint SDS-PAGE- silver stainings-mass-spectrometric technique：It builds PVT1 and is overexpressed plasmid, with special
Restriction enzyme cuts plasmid, transcribes to obtain PVT1RNA, then with Biotin end labelled reagent using in-vitro transcription kit
Box is to PVT1 end marks, and with intracellular protein with magnetic bead hatching combination, efficiently concentrating rna binding protein specifically obtains
The albumen combined with PVT1, then combine SDS-PAGE- silver stainings-mass-spectrometric technique, identify the albumen combined with PVT1.
(3) PVT1 binds the expression of EZH2 regulation and control target genes in cholangiocarcinoma cell
A. PVT1 interference or the over-express vector of specificity are designed, it will with liposome 2000 (Invitrogen TM) transfection reagent
PVT1 is interfered or over-express vector transiently transfects cholangiocarcinoma cell, after transfecting 48 hours, collects cell total rna and albumen is used for
QRT-PCR and westernblot detects target gene mRNA and protein expression respectively (using GAPDH as control).B. design is special
The interference sequence of the EZH2 of property, interference sequence such as SEQ ID NO:Shown in 7, i.e. si-EZH2：
GAGGUUCAGACGAGCUGAUUU；AUCAGCUCGUCUGAACCUCUU.With liposome 2000 (Invitrogen TM) transfection reagent
Cholangiocarcinoma cell will be transiently transfected, after transfecting 48 hours, cell total rna is collected and albumen is used for qRT-PCR and western
Blot detects the mRNA of EZH2 and target gene ANGPTL4 and protein expression respectively (using GAPDH as control).
C. after closing off and being overexpressed PVT1, the combination energy of ChIP detection EZH2 and target gene ANGPTL4 promoter regions
Power.
The primer sequence is as follows:
EZH2 F：5’-TGCACATCCTGACTTCTGTG-3’
EZH2 R：5’-AAGGGCATTCACCAACTCC-3’
ANGPTL4 F：5’-GTCCACCGACCTCCCGTTA-3’
ANGPTL4 R：5’-CCTCATGGTCTAGGTGCTTGT-3’
EREG F：5’-CGTGTGGCTCAAGTGTCAAT-3’
EREG R：5’-AAGGTTGGTGGACGGTTAAA-3’
ENC1 F：5’-CTGGAGATTCAAAGCCCAAC-3’
ENC1 R：5’-TGCAGGCATCGAACAATAAA-3’
ETV5 F：5’-CCTCCTCTGAGCTGTCGTCT-3’
ETV5 R：5’-ATTCTGATGGGTGGGTGAGA-3’
GDF15 F：5’-GAGGTGCAAGTGACCATGTG-3’
GDF15 R：5’-CAGTGGCAGTCTTTGGCTAAC-3’
SPRY4 F：5’-CCAGGATGTCACCCACCATTG-3’
SPRY4 R：5’-TGTGCTGCTGCTGCTC-3’
U1 F：5’-GGGAGATACCATGATCACGAAGGT-3’
U1 R：5’-CCACAAATTATGCAGTCGAGTTTCCC-3’
GAPDH F：5’-AGCCACATCGCTCAGACAC-3’
GAPDH R：5’-GCCCAATACGACCAAATCC-3’
ANGPTL4 CHIP primers F：5’-ATTTCACACTAGAGGCGGGC-3’
ANGPTL4 CHIP primers R：5’-CAGGCCTTCCTCTACGAACC-3’
6. the correlation research in cholangiocarcinoma sample between PVT1 and target gene.
It further collects cholangiocarcinoma sample and arranges detailed pathological data and establish follow-up record storehouse.QRT-PCR skills
Art detects cholangiocarcinoma sample and matches the expression of PVT1 in normal specimen, and analyze its pathology with cholangiocarcinoma patients
The correlation of data (tumour TNM stage, pathological characters, prognosis etc.).QRT-PCR analyzes cholangiocarcinoma sample and pairing is normal
The expression of corresponding target genes ANGPTL4 in sample；Immunohistochemistry detects the expression quantity of target gene ANGPTL4 protein levels；
Correlation between PVT1 and target gene in analysis cholangiocarcinoma clinical tissue sample.It can be examined using further evaluating PVT1 as cholangiocarcinoma
Disconnected, prognosis marker, abnormal expression may be the crucial target spot for promoting cholangiocarcinoma occurrence and development.
SEQUENCE LISTING
<110>The Second Affiliated Hospital of Nanjing Medical University
<120>A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment cholangiocarcinoma
<130> CP11704216C
<160> 29
<170> PatentIn version 3.3
<210> 1
<211> 1957
<212> DNA
<213>Artificial sequence
<400> 1
ctccgggcag agcgcgtgtg gcggccgagc acatgggccc gcgggccggg cgggctcggg 60
gcggccggga cgaggagggg cgacgacgag ctgcgagcaa agatgtgccc cgggaccccc 120
ggcaccttcc agtggatttc cttgcggaaa ggatgttggc ggtccctgtg acctgtggag 180
acacggccag atctgccctc cagcctgatc ttttggccag aaggagatta aaaagatgcc 240
cctcaagatg gctgtgcctg tcagctgcat ggagcttcgt tcaagtattt tctgagcctg 300
atggatttac agtgatcttc agtggtctgg ggaataacgc tggtggaacc atgcactgga 360
atgacacacg cccggcacat ttcaggatac taaaagtggt tttaagggag gctgtggctg 420
aatgcctcat ggattcttac agcttggatg tccatggggg acgaaggact gcagctggct 480
gagagggttg agatctctgt ttacttagat ctctgccaac ttcctttggg tctccctatg 540
gaatgtaaga ccccgactct tcctggtgaa gcatctgatg cacgttccat ccggcgctca 600
gctgggcttg agctgaccat actccctgga gccttctccc gaggtgcgcg ggtgaccttg 660
gcacatacag ccatcatgat ggtactttaa gtggaggctg aatcatctcc cctttgagct 720
gcttggcacg tggctccctt ggtgttcccc ttttactgcc aggacactga gatttggaga 780
gagtctcact ctgtggtcca ggctgaagta cagtggcatg atcccaggtc actgcaaccc 840
ccacctcccg ggttcaagtg atcctcctgc ctcagcctcc cgagtagctg gtattacagg 900
cgtgtgccac aaagcctggc taagttttgt atttttagta gagacggggt ttcaccatgt 960
tggccaggtt ggtctcgaac tcctgacctc aagtgatcca ctcactttgg cctttcaacg 1020
tgctgggatt acaggcgaga gtcaccgcac ccggacgact ctgacatttt tgaagagtcc 1080
agaatcctgt tacacctggg atttaggcac tttcaatctg aaaaaataca tatcctttca 1140
gcactctgga cggacttgag aactgtcctt acgtgaccta aagctggagt attttgagat 1200
tggagaatta agagccagtc ttggtgctct gtgttcacct ggttcatctg aggagctgca 1260
tctaccctgc ccatgccata gatcctgccc tgtttgcttc tcctgttgct gctagtggac 1320
atgagaagga cagaataacg ggctcccaga ttcacaagcc ccaccaagag gatcacccca 1380
ggaacgcttg gaggctgagg agttcactga ggctactgca tcttgagact caggatgaag 1440
acccagcttg gggctgtcaa agaggcctga agaggcagaa caccccagag gagcctgggg 1500
ccaccaccca gcatcactgt gggaaaacgg cagcaggaaa tgtcctctcg cctgcgtgct 1560
ccacctcggt ccacgccttc cctccttctg gaagccttgc ctgaccactg gcctgcccct 1620
tctatgggaa tcactactga ccttgcagct tattatagac ttatatgttt tttgcatgtc 1680
tgacacccat gactccacct ggaccttatg gctccaccca gaagcaattc agcccaacag 1740
gaggacagct tcaacccatt acgatttcat ctctgcccca accactcagc agcaagcacc 1800
tgttacctgt ccacccccac cccttccccc aaactgcctt tgaaaaatcc ctaacctatg 1860
agctttgaat aagatgagta cgaacttcat cgcccacgtg gcgtggccgg cctcgtgtct 1920
attaaattct ttttctacta aaaaaaaaaa aaaaaaa 1957
<210> 2
<211> 22
<212> DNA
<213>Artificial sequence
<400> 2
tgagaactgt ccttacgtga cc 22
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
agagcaccaa gactggctct 20
<210> 4
<211> 19
<212> DNA
<213>Artificial sequence
<400> 4
agccacatcg ctcagacac 19
<210> 5
<211> 19
<212> DNA
<213>Artificial sequence
<400> 5
gcccaatacg accaaatcc 19
<210> 6
<211> 21
<212> DNA
<213>Artificial sequence
<400> 6
gcuuggaggc ugaggaguut t 21
<210> 7
<211> 21
<212> DNA
<213>Artificial sequence
<400> 7
aacuccucag ccuccaagct t 21
<210> 8
<211> 21
<212> DNA
<213>Artificial sequence
<400> 8
cccaacagga ggacagcuut t 21
<210> 9
<211> 21
<212> DNA
<213>Artificial sequence
<400> 9
aagcuguccu ccuguugggt t 21
<210> 10
<211> 20
<212> DNA
<213> EZH2 F
<400> 10
tgcacatcct gacttctgtg 20
<210> 11
<211> 19
<212> DNA
<213> EZH2 R
<400> 11
aagggcattc accaactcc 19
<210> 12
<211> 19
<212> DNA
<213> ANGPTL4 F
<400> 12
gtccaccgac ctcccgtta 19
<210> 13
<211> 21
<212> DNA
<213> ANGPTL4 R
<400> 13
cctcatggtc taggtgcttg t 21
<210> 14
<211> 20
<212> DNA
<213> EREG F
<400> 14
cgtgtggctc aagtgtcaat 20
<210> 15
<211> 20
<212> DNA
<213> EREG R
<400> 15
aaggttggtg gacggttaaa 20
<210> 16
<211> 20
<212> DNA
<213> ENC1 F
<400> 16
ctggagattc aaagcccaac 20
<210> 17
<211> 20
<212> DNA
<213> ENC1 R
<400> 17
tgcaggcatc gaacaataaa 20
<210> 18
<211> 20
<212> DNA
<213> ETV5 F
<400> 18
cctcctctga gctgtcgtct 20
<210> 19
<211> 20
<212> DNA
<213> ETV5 R
<400> 19
attctgatgg gtgggtgaga 20
<210> 20
<211> 20
<212> DNA
<213> GDF15 F
<400> 20
gaggtgcaag tgaccatgtg 20
<210> 21
<211> 21
<212> DNA
<213> GDF15 R
<400> 21
cagtggcagt ctttggctaa c 21
<210> 22
<211> 21
<212> DNA
<213> SPRY4 F
<400> 22
ccaggatgtc acccaccatt g 21
<210> 23
<211> 16
<212> DNA
<213> SPRY4 R
<400> 23
tgtgctgctg ctgctc 16
<210> 24
<211> 24
<212> DNA
<213> U1 F
<400> 24
gggagatacc atgatcacga aggt 24
<210> 25
<211> 26
<212> DNA
<213> U1 R
<400> 25
ccacaaatta tgcagtcgag tttccc 26
<210> 26
<211> 19
<212> DNA
<213> GAPDH F
<400> 26
agccacatcg ctcagacac 19
<210> 27
<211> 19
<212> DNA
<213> GAPDH R
<400> 27
gcccaatacg accaaatcc 19
<210> 28
<211> 20
<212> DNA
<213> ANGPTL4 CHIP primers F
<400> 28
atttcacact agaggcgggc 20
<210> 29
<211> 20
<212> DNA
<213> ANGPTL4 CHIP primers R
<400> 29
caggccttcc tctacgaacc 20
Claims (9)
1. a kind of long-chain non-coding RNA, PVT1, which is characterized in that length 1957bp, sequence such as SEQ ID NO:Shown in 1.
2. test right requires the reagent of the 1 long-chain non-coding RNA preparing the application in diagnosing cholangiocarcinoma reagent.
3. a kind of pharmaceutical composition requires the detection reagent of the 1 long-chain non-coding RNA including test right.
4. the pharmaceutical composition described in claim 3 is preparing the application in treating bile duct cancer drug.
5. two groups of test rights require the primer of the 1 long-chain non-coding RNA, sequence is respectively such as SEQ ID NO：2nd, 3 and 4,5
It is shown, i.e.,：
SEQ ID NO:2PVT1 F TGAGAACTGTCCTTACGTGACC,
SEQ ID NO：3 PVT1 R AGAGCACCAAGACTGGCTCT,
SEQ ID NO:4F AGCCACATCGCTCAGACAC,
SEQ ID NO:5R GCCCAATACGACCAAATCC。
6. any one group of primer is preparing the application in diagnosing cholangiocarcinoma reagent in claim 5.
7. a kind of kit includes the primer of any one detection PVT1 described in claim 5；Preferably, in the kit
A concentration of 0.01~0.1mol/L of primer.
A kind of 8. pharmaceutical composition for treating cholangiocarcinoma, which is characterized in that the inhibitor including PVT1.
9. pharmaceutical composition according to claim 8, which is characterized in that the inhibitor of the PVT1 is the siRNA of PVT1,
Its sequence such as SEQ ID NO:6th, shown in 7, i.e.,：
si-PVT1 1#:
GCUUGGAGGCUGAGGAGUUTT
AACUCCUCAGCCUCCAAGCTT
Or such as SEQ ID NO:8th, shown in 9, i.e.,：
si-PVT1 2#:
CCCAACAGGAGGACAGCUUTT
AAGCUGUCCUCCUGUUGGGTT。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711331671.6A CN108220434A (en) | 2017-12-13 | 2017-12-13 | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment cholangiocarcinoma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711331671.6A CN108220434A (en) | 2017-12-13 | 2017-12-13 | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment cholangiocarcinoma |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108220434A true CN108220434A (en) | 2018-06-29 |
Family
ID=62649532
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711331671.6A Pending CN108220434A (en) | 2017-12-13 | 2017-12-13 | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment cholangiocarcinoma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220434A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109486817A (en) * | 2018-11-13 | 2019-03-19 | 南京医科大学第二附属医院 | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnoses and treatment cholangiocarcinoma |
| CN111826430A (en) * | 2020-07-24 | 2020-10-27 | 扬州大学 | Method for researching co-regulation target gene of lncRNA and histone methylase in chicken PGCs |
| EP4031253A4 (en) * | 2019-09-19 | 2023-11-01 | Sanford Burnham Prebys Medical Discovery Institute | Methods and compositions for treating myc-driven cancers |
| US11866788B2 (en) | 2018-05-08 | 2024-01-09 | Sanford Burnham Prebys Medical Discovery Institute | Role of PVT1 in the diagnosis and treatment of MYC-driven cancer |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754914A (en) * | 2016-11-28 | 2017-05-31 | 江苏省人民医院 | A kind of long non-coding RNA and its application in diagnosis/treatment preeclampsia |
| CN107012145A (en) * | 2017-03-20 | 2017-08-04 | 南京医科大学第二附属医院 | A kind of long non-coding RNA and its application in diagnosis/treatment cholangiocarcinoma |
-
2017
- 2017-12-13 CN CN201711331671.6A patent/CN108220434A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754914A (en) * | 2016-11-28 | 2017-05-31 | 江苏省人民医院 | A kind of long non-coding RNA and its application in diagnosis/treatment preeclampsia |
| CN107012145A (en) * | 2017-03-20 | 2017-08-04 | 南京医科大学第二附属医院 | A kind of long non-coding RNA and its application in diagnosis/treatment cholangiocarcinoma |
Non-Patent Citations (4)
| Title |
|---|
| MICHAEL H.CHAPMAN ET AL.: "Whole genome RNA expression profiling of endoscopic biliary brushings provides data suitable for biomarker discovery in cholangiocarcinoma", 《JOURNAL OF HEPATOLOGY》 * |
| TERESA COLOMBO ET AL.: "PVT1: A Rising Star among Oncogenic Long Noncoding RNAs", 《BIOMED RESEARCH INTERNATIONAL》 * |
| Y TAKAHASHI ET AL.: "Amplification of PVT-1 is involved in poor prognosis via apoptosis inhibition in colorectal cancers", 《BRITISH JOURNAL OF CANCER》 * |
| 张行行等: "下调长链非编码RNA PVT1表达对胰腺癌BxPC-3细胞凋亡、侵袭及转移的影响", 《基础医学与临床》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11866788B2 (en) | 2018-05-08 | 2024-01-09 | Sanford Burnham Prebys Medical Discovery Institute | Role of PVT1 in the diagnosis and treatment of MYC-driven cancer |
| CN109486817A (en) * | 2018-11-13 | 2019-03-19 | 南京医科大学第二附属医院 | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnoses and treatment cholangiocarcinoma |
| EP4031253A4 (en) * | 2019-09-19 | 2023-11-01 | Sanford Burnham Prebys Medical Discovery Institute | Methods and compositions for treating myc-driven cancers |
| CN111826430A (en) * | 2020-07-24 | 2020-10-27 | 扬州大学 | Method for researching co-regulation target gene of lncRNA and histone methylase in chicken PGCs |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103403181B (en) | NcRNA and application thereof | |
| KR102622309B1 (en) | Detection of chromosomal interactions | |
| CN108220434A (en) | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment cholangiocarcinoma | |
| Hu et al. | KLF4 expression correlates with the degree of differentiation in colorectal cancer | |
| Kim et al. | The C1772T genetic polymorphism in human HIF-1α gene associates with expression of HIF-1α protein in breast cancer | |
| CN108546702A (en) | The siRNA for targeting long-chain non-coding RNA DDX11-AS1 and its application in liver cancer treatment | |
| CN109468382B (en) | Application of lncRNA in diagnosis and treatment of lung adenocarcinoma | |
| CN109680064B (en) | Application of YTHDF2 gene in diagnosis, prevention and treatment of urothelial cancer | |
| CN106701900A (en) | Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer | |
| CN111304326B (en) | Reagent for detecting and targeting lncRNA biomarker and application of reagent in hepatocellular carcinoma | |
| CN106544342A (en) | MT2A gene Mechanisms of Histone Acetylation Modification detection kit and primer pair | |
| Yu et al. | miRNA-338-3p inhibits glioma cell proliferation and progression by targeting MYT1L | |
| CN107586842A (en) | A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment | |
| CN109251927A (en) | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment cholangiocarcinoma | |
| CN109486817A (en) | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnoses and treatment cholangiocarcinoma | |
| CN107326071B (en) | Application of PLPP4 as non-small cell lung cancer diagnosis, treatment and prognosis target | |
| CN107201366A (en) | A kind of analysis and preparation method for diagnosing cancer of liver with the antisense long-chain non-coding RNA for the treatment of | |
| CN107937524A (en) | Mankind's KRAS gene mutation detection kit and detection method | |
| CN111979315A (en) | Application of annular TP63 as lung squamous carcinoma diagnosis or treatment target | |
| Zhao et al. | Long noncoding RNA AK023096 interacts with hnRNP-K and contributes to the maintenance of self-renewal in bladder cancer stem-like cells | |
| CN106729756B (en) | Application of biomarker as target in diagnosis and treatment of lung adenocarcinoma | |
| CN109456971A (en) | A kind of application of long-chain non-coding RNA in diagnoses and treatment cholangiocarcinoma | |
| CN105603117B (en) | MiR-3613 is used to distinguish lung squamous cancer transfer and non-diverting miRNA marker | |
| JP2005230011A (en) | Mammary cancer related protein, gene coding the same, and mammary cancer diagnostic method using the protein or the gene | |
| Qiu et al. | Transcriptome sequencing-based personalized analysis of hepatocellular carcinoma patients with portal vein tumor thrombus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180629 |