CN109456971A - A kind of application of long-chain non-coding RNA in diagnoses and treatment cholangiocarcinoma - Google Patents
A kind of application of long-chain non-coding RNA in diagnoses and treatment cholangiocarcinoma Download PDFInfo
- Publication number
- CN109456971A CN109456971A CN201811395835.6A CN201811395835A CN109456971A CN 109456971 A CN109456971 A CN 109456971A CN 201811395835 A CN201811395835 A CN 201811395835A CN 109456971 A CN109456971 A CN 109456971A
- Authority
- CN
- China
- Prior art keywords
- dancr
- cholangiocarcinoma
- cell
- seq
- long
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Hospice & Palliative Care (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to genetic engineering field, in particular to a kind of long-chain non-coding RNA, DANCR and combinations thereof, the application in preparation diagnosis cholangiocarcinoma and target drug treatment.Meanwhile the invention further relates to its primers, diagnose the application in diagnosis cholangiocarcinoma reagent in preparation.By studying the expression of the long-chain non-coding RNA cellular level, itself and the pathogenetic relationship of cholangiocarcinoma are disclosed.By the molecular mechanism of abundant lncRNAs regulation cholangiocarcinoma occurrence and development, disclosing DANCR can be used as the marker of cholangiocarcinoma diagnosis, prognosis for the successful implementation of this research, provide experiment and theoretical foundation for clinic early stage cholangiocarcinoma clinical diagnosis and treatment.
Description
Technical field
The invention belongs to genetic engineering field, in particular to a kind of long-chain non-coding RNA, LINC00152 and combinations thereof,
Application in preparation diagnosis cholangiocarcinoma and target drug treatment.Meanwhile the invention further relates to its primers, diagnose straight knot in preparation
Application in intestinal cancer reagent.By studying the expression of the long-chain non-coding RNA cellular level, itself and cholangiocarcinoma morbidity machine are disclosed
The relationship of reason.
Background technique
Tumour is to seriously threaten a big main arch-criminal of human health, to malignancy of tumor progress Study on Molecular Mechanism always
It is educational circles's focus of attention and difficult point.There is promotion proliferation and invasion to turn during the growth process for existing research report, tumour cell
It moves, continues angiogenesis, the cell phenotypes feature such as immune tolerance and immunologic escape.Studies have shown that the growth of tumour cell is one
A complexity polygenes regulation and multi-step, Multi stage development process, including p53, p21 etc. the inactivation of tumor suppressor genes and
The activation of the proto-oncogenes such as Blc1, Myc.So far, the mechanism of malignant tumour is not fully apparent from yet, is needed further
It explores.
Researches show that: in addition to the encoding gene that these have been widely studied, long non-coding RNA (long
NoncodingRNAs, lncRNAs) unconventionality expression also assist in malignancy of tumor progress.LncRNAs is that a kind of transcript length is super
The RNA molecule for crossing 200nt is different from other small molecule non-coding RNAs, can cis- (in cis) or trans- (in
Trans) mode acted on adjusts RNA metabolism, protein function activity, histone modification and chromatin remodeling, in epigenetic
, transcription and post-transcriptional level wide participation cell biological processes.More and more researchs confirm that lncRNAs not only exists
It maintains to play important regulating and controlling effect in the normal physiological function and growth course of body, unconventionality expression and disease are sent out
The malignant progression of exhibition especially tumour has close connection.
Cholangiocarcinoma (cholangiocarcinoma, CCA) is initiated by the pernicious of the Highly invasive of bile duct epithelial cell
Tumour, global incidence, in trend is risen year by year especially in Asian countries, survival rate is less than 5% within 5 years.Cholangiocarcinoma is early
Phase incidence of occult, often without apparent clinical manifestation, to middle and advanced stage when clarifying a diagnosis.Although having operation, radiotherapy, chemotherapy at present
Equal clinical treatments means, but the prognosis of cholangiocarcinoma patients is still very poor.Existing research shows that the unconventionality expression of lncRNAs mediates
Cholangiocarcinoma malignant progression.The H19 and HULC of up-regulation can promote the migration and invasion of cholangiocarcinoma cell by ceRNA mechanism.
LncRNA CPS1intronic transcript 1 (CPS1- IT1) can promote the proliferation of cholangiocarcinoma cell and inhibit apoptosis,
And influence the liver function and prognosis of patient.Further literature search is as the result is shown: lncRNAs, which can pass through, plays proto-oncogene
Effect participates in the biological processes such as cholangiocarcinoma cell proliferation, apoptosis and invasion transfer, prompts more cholangiocarcinoma malignant progressions related
The function and mechanism of lncRNAs has the necessity further studied.
Summary of the invention
Goal of the invention: present invention aims in view of the deficiencies of the prior art, provide a kind of long-chain non-coding RNA and its group
Object is closed in diagnosis cholangiocarcinoma and the application in preparation treatment bile duct cancer drug.
Technical solution: the present invention provides a kind of long-chain non-coding RNA, DANCR, length 915bp, sequence such as SEQID
Shown in NO:1, it may be assumed that
tcgttccaat gagaatgaag gctgaggtgt gcgccttttt ttttttttcc ttcttagtcg
tgtgtacatc attgggaatg gagggaaata aatgactgga tggtcgctgc tttttaagtt
tcaaattgac attccagaca agcggtgcct gagcccgtgc ctgtcttcag atcttcacag
cacagttcct gggaaggtgg agccaccagc ctctccttgt cctggaggct ggaagtgcaa
aaggaaggtg tcggcaagat cgtttttttc tgagagctct ctccttggct tgcagatggc
agcctgctcc tggcacagtc ttttctctac tcatgcccaa agttacggag gacccagcaa
ccatctcctg cagcccctgg aaacctcttg actcttctgt gatgtcccca gtgatccagc
agccctggcc ttcttttgat ggcttgaaca tttggtcttc attgaacagt ttgtatattg
gaaacttgcc agcctccatc cacattccaa cctccgtctg catccctcga ataactggga
gatgaaacag gaagctctat gacacacttg atcgaatatg acagacaccg aaaatcacga
ctcagccccc tccagcacct ctacctgttg cccgccgatc acagccggaa tgcagctgaa
agattccctg gggcctggtt ccaaccgccc actgtggact ctgaggcctc tgcatttgcg
ggtggtctgc ctgtgatatt t。
Further, the present invention provides reagent the answering in preparation diagnosis cholangiocarcinoma reagent of above-mentioned long-chain non-coding RNA
With.
Further, the present invention also provides a kind of pharmaceutical composition, including detection long-chain non-coding RNA, the detections of DANCR
Reagent.
Further, the application the present invention provides aforementioned pharmaceutical compositions in preparation treatment bile duct cancer drug.
Further, the present invention provides for detecting long-chain non-coding RNA, the primer sets of DANCR, serial number is respectively
Shown in SEQ ID NO:2 and 3, it may be assumed that
SEQ ID NO:2 DANCR F CGGAGGTGGATTCTGTTAGG,
SEQ ID NO:3 DANCR R TCGGTGTAGCAAGTCTGGTG.
Further, the application the present invention provides above-mentioned primer sets in preparation diagnosis cholangiocarcinoma reagent.
Further, the present invention provides a kind of kit, including above-mentioned detection long-chain non-coding RNA, the primer of DANCR
Group.
Preferably, the concentration of primer sets is 0.01-0.1mol/L in the kit.
Further, the present invention also provides a kind of for treating the pharmaceutical composition of cholangiocarcinoma, including the non-volume of long-chain
Code RNA, the inhibitor of DANCR.
Preferably, the inhibitor of the DANCR is the siRNA, sequence such as SEQ ID NO:4,5 or SEQ ID of DANCR
NO:6, shown in 7, it may be assumed that
si-DANCR 1#:
AGCUAGAGCAGUGACAAUGTT SEQ ID NO:4
CAUUGUCACUGCUCUAGCUCC SEQ ID NO:5
si-DANCR 2#:
GCGUACUAACUUGUAGCAATT SEQ ID NO:6
UUGCUACAAGUUAGUACGCTT SEQ ID NO:7。
Technology path of the invention are as follows:
One, experimental subjects
We have collected 2015 to 2016 The Second Affiliated Hospital of Nanjing Medical University's biological therapy center receive diagnosis and
The cholangiocarcinoma patients for the treatment of and the tissue of the healthy volunteer without containing the disease.Tissue specimen collection is at the first time
Liquid nitrogen is stored in -80 DEG C, until RNA is extracted.The research is ratified by Ethics Committee, Nanjing Medical University.It is ill to obtain institute
The written informed consent of people.
Two, experimental facilities and reagent
The experimental method and investigative technique used: such as the extraction of total serum IgE and protein, clone technology, cell transfecting, ChIP examination
It tests, RIP test, the use of Western blot, fluorescence real-time quantitative PCR, bioinformatic database etc.；Required experiment
Material such as antibody, kit etc. is commercially available.
Team of the present invention relies on Nanjing Medical University, required each equipment, such as fluorescence quantitative PCR instrument, flow cytometer, enzyme mark
Instrument, CO2 incubator, low-temperature and high-speed centrifuge, fluorescence inverted microscope, laser confocal microscope etc. and experimental animal,
Directly use.
Three, experimental procedure and result
1, tests route schematic diagram, inventive concept according to the present invention, and experiment route schematic diagram is shown in attached drawing 9.
2 .DANCR conspicuousness height in cholangiocarcinoma is expressed: being detected DANCR expression in cholangiocarcinoma sample and is divided
It analyses its correlation and carries out bioinformatic analysis, search cholangiocarcinoma-cancer in gene expression integrated database (i.e. GEO database)
Other chip data, normalization data is downloaded and carries out differential expression data analysis；It is final to obtain the differential expression by cancer-cancer
LncRNAs.Determine that DANCR is a lncRNA of the conspicuousness up-regulation (P value < 0 .001, the .05 of FDR < 0) in data.It is real
It tests as the result is shown in Fig. 1, DANCR is in the differential expression situation by cancer-cancer: the cholangiocarcinoma table of (A) GSE76297 database
Show up to modal data: relative to cancer side or normal tissue, DANCR high expression in cancer, ordinate is standardized score z value；(B)
Collect cholangiocarcinoma sample, using fluorescence real-time quantitative PCR (qRT-PCR) technology by 17 pairs of cholangiocarcinomas and its cancer group
It is verified in knitting, as the result is shown DANCR significantly high expression in cancer.
The research of 3.DANCR promotion cholangiocarcinoma cell malignant progression
1) it synthesizes DANCR interference sequence (siRNA) and is overexpressed plasmid, transfect cholangiocarcinoma cell system；Interference sequence such as SEQ ID
NO:4,5 and SEQ ID NO:6, shown in 7, it may be assumed that
si-DANCR 1#:
AGCUAGAGCAGUGACAAUGTT SEQ ID NO:4
CAUUGUCACUGCUCUAGCUCC SEQ ID NO:5
si-DANCR 2#:
GCGUACUAACUUGUAGCAATT SEQ ID NO:6
UUGCUACAAGUUAGUACGCTT SEQ ID NO:7
2) qRT-PCR detection inhibits and is overexpressed efficiency, cck8, Clone formation, EDU, Transwell, Flow Cytometry inspection
It surveys closing and is overexpressed after DANCR to cholangiocarcinoma proliferation, apoptosis and the influence for invading metastatic cells function.Further evaluation
Biological function of the DANCR in cholangiocarcinoma cell specifies its oncogene function.
Experimental result is shown in Fig. 4 in figs. 2,3 and 4:
Interference effect of Fig. 2 (A) DANCR in cholangiocarcinoma epithelial cell (HuCCT1 cell) and human bile duct carcinoma (RBE cell)
Rate is all up 90%.(B) DANCR is in cholangiocarcinoma epithelial cell (HuCCT1 cell) and human bile duct carcinoma (RBE cell)
Overexpression efficiency.
Fig. 3 (A and B) CCK8 experimental result is shown: inhibiting the proliferation of HuCCT1 cell and RBE cell after interference DANCR；
Promote the proliferation of HuCCT1 cell and RBE cell after overexpression DANCR；(C and D) colony formation is as the result is shown: interference
DANCR inhibits the proliferation of HuCCT1 cell and RBE cell；Promote the increasing of HuCCT1 cell and RBE cell after overexpression DANCR
It grows；(E) EDU experimental result is shown: interference DANCR inhibits the proliferation of HuCCT1 cell and RBE cell；(F and G)
Transwell experimental result is shown: interference DANCR inhibits the invasion of HuCCT1 cell and RBE cell transfer；It is overexpressed DANCR
Promote the invasion of HuCCT1 cell and RBE cell transfer afterwards.
Fig. 4 (A and B) flow cytomery is as the result is shown: after interference DANCR, the apoptosis of HuCCT1 and RBE cell is bright
It is aobvious to increase.
4.DANCR improves the tumour Forming ability of cholangiocarcinoma cell in vivo
1) slow virus carrier of building DANCR interference and overexpression, is packaged into virus, transfects HuCCT1 cell, screens positive steady
Turn cell strain.
2) two kinds of cell groupings are injected into immunodeficient mouse (BALB/C nude mice), to construct subcutaneous tumor formation model.To tumor
After body is formed, the tumor volume of survey in every 2 days put to death mouse after 4 weeks, took knurl, measured weight；Quantitative PCR detection DANCR
Expression.Further influence of the evaluation DANCR to cholangiocarcinoma cell proliferative capacity.
Experimental result is shown in Fig. 5: (A) nude mice by subcutaneous tumor formation experiment observes and records mouse tumorous size, to knurl
Mouse is put to death after being formed 16 days, is taken out knurl, is photographed to record；It measures the size of knurl simultaneously and claims its weight；(B) knurl is grown
Velocity measuring, the average growth rate for striking low sh-DANCR group mouse knurl are significantly slower than the average growth rate of control group knurl
(C) tumor weight detects, and the average weight for striking low sh-DANCR 2# group mouse knurl is substantially less than the weight of control group knurl.
5. high-flux sequence DANCR adjusts downstream target gene expression
The target gene that DANCR regulated and controled is primarily determined using transcript profile sequencing: being struck in HuCCT1 cell line using siRNA low
DANCR, the important target gene regulated and controled using transcript profile sequencing technologies high flux screening DANCR, and with qRT-PCR to sequencing
As a result it is verified.
Experimental result is shown in Fig. 6: after (A) interferes DANCR, DANCR downstream influences obtained by transcript profile high-flux sequence
Difference expression gene, color indicate z-score；(B) Go is analysis shows that DANCR and cell proliferation, migrate related to apoptosis etc.；
(C) qPCR verifying interferes downstream target gene after DANCR significantly to raise in cholangiocarcinoma cell strain HuCCT1 and RBE.(D) pass through
GSE76297 database prediction DANCR and downstream target FBP1 has correlation.(E) and by western blot experimental verification in gallbladder
Downstream target gene FBP1 after DANCR is interfered significantly to raise in pipe cancer cell line HuCCT1 and RBE.
6.DANCR binding EZH2 apparently inhibits downstream target gene
1) pass through RIP technology in cholangiocarcinoma cell to identify DANCR and EZH2 protein binding.
2) mechanism of DANCR commitment cholangiocarcinoma cell malignant phenotype:
Close off DANCR in a cholangiocarcinoma cell, qRT-PCR, western blot method detect respectively FBP1 mRNA,
The expression of albumen.
After closing EZH2 in b cholangiocarcinoma cell, detect FBP1's respectively using qRT-PCR, western blot method
The expression of mRNA, albumen.
C be identification in cholangiocarcinoma cell DANCR whether with EZH2 specific bond, carried out RNA co-immunoprecipitation
(RNA immunoprecipitation, RIP) experiment has carried out into one the binding of DANCR and EZH2 in cholangiocarcinoma cell
Step demonstrate,proves (experimental result is shown in Fig. 7 A), as a result prompts the DANCR in cholangiocarcinoma cell can be with EZH2 specific bond.
EZH2 be constitute PRC2 compound in uniquely with enzymatic activity subunit, PRC2 be one act on histone H 3 rely
The highly conserved histone methyltransferase of propylhomoserin site K27, biological function are the Transcriptional Silencings to differentiation gene.At present
Known to be studied by full-length genome, the normal action target spot of PRC2 is the key that transcription factor and signal path in a variety of organisms
Site.Studies have shown that the binding of long-chain non-coding mediates the histone methylated expression to inhibit downstream target gene.And research table
Bright, in liver cancer, clear-cell carcinoma, adenocarcinoma of lung and gastric cancer, DANCR can inhibit the expression of downstream target gene in conjunction with EZH2.It is existing
Document report, the expression of FBP1 in bladder cancer, lung cancer, kidney, squamous cell carcinoma, breast cancer, glioma and Colorectal Carcinoma
Amount is substantially less than cancer beside organism, can play cancer suppressing action.And it has been reported that in colorectal cancer and cervical carcinoma, tumour
The expression of FBP1 is related to the methylation of its promoter region in tissue.It prompts our DANCR that can bind EZH2 and mediates histone
It methylates and is expressed so as to cause the inhibition of FBP1 gene.
D .DANCR may apparently inhibit the expression of the tumor suppressor genes such as FBP1 gene by binding EZH2, to promote bile duct
Cancer cell malignant phenotype progress.
ChIP experiment confirms after striking and subtracting DANCR that the binding demeanour of EZH2 and the gene promoter area FBP1 reduces
Above-mentioned experiment as the result is shown in Fig. 7, (A) RIP experiment confirms: DANCR can be bound with EZH2 albumen；(B) lead to
Cross the correlation of GSE76297 database prediction EZH2 and downstream target FBP1.(C) western blot experimental verification is in bile duct
EZH2 gene is successfully interfered in cancer cell line HuCCT1 and RBE.(D) qPCR verifying interferes EZH2 in HuCCT1 and RBE cell
Afterwards, the expression of FBP1mRNA level and protein level is significantly raised.(E) ChIP experiment confirms after striking and subtracting DANCR, strikes and subtracts DANCR
Afterwards, the binding abundance of EZH2 and FBP1 promoter region reduces and the abundance of the gene promoter area FBP1 H3K27me3 drops
It is low.
Fig. 8, (A) GEO database displaying: relative to cancer side or normal tissue, FBP1 low expression in cancer；(B) 17
Verify to cholangiocarcinoma and cancer beside organism qPCR: FBP1 is significantly lowered in cholangiocarcinoma.(C) cck8:FBP1 inhibits cholangiocarcinoma
The increment of cell, and promotion of the DANCR to competence for added value can be saved；(D) colony formation: the mistake in cholangiocarcinoma cell
FBP1 is expressed, as a result shows that FBP1 inhibits the increment of cholangiocarcinoma cell, and promotion of the DANCR to competence for added value can be saved； (E)
Transwell:FBP1 inhibits the migration of cholangiocarcinoma cell, and can save promotion of the DANCR to transfer ability.
The utility model has the advantages that the present invention regulates and controls bile duct from three clinical tissue sample, cell, model animal layer viewpoint DANCR
The mechanism of action of the pernicious process of cancer cell, with qPCR, RIP Protocols in Molecular Biology means between DANCR and target gene
Relationship makees further verifying.The present invention has a significant scientific meaning: DANCR overexpression and is participated in apparent in cholangiocarcinoma
The proliferation that heredity mediates invades mechanism；The utilization of the methods of bioinformatic analysis, transcript profile high-flux sequence, RIP ensure that
As a result accuracy and systematicness；Abundant lncRNAs is regulated and controled the molecule machine of cholangiocarcinoma occurrence and development by the successful implementation of this research
System, disclosing DANCR can be used as the marker of cholangiocarcinoma diagnosis, prognosis, provide experiment for clinic early stage cholangiocarcinoma clinical diagnosis and treatment
And theoretical foundation.
Detailed description of the invention
Fig. 1 DANCR is in cancerous issue-cancer beside organism differential expression situation；
Interference and overexpression efficiency of Fig. 2 DANCR in HuCCT1 cell and RBE cell；
Influence of Fig. 3 DANCR to HuCCT1 cell and RBE cell Proliferation and migration；
Influence of Fig. 4 DANCR to HuCCT1 cell and RBE Apoptosis；
Fig. 5 DANCR forms the influence of size to tumour cell；
Fig. 6 high-flux sequence DANCR adjusts downstream target gene expression；
Fig. 7 DANCR binding EZH2 apparently inhibits the expression of FBP1 gene；
Fig. 8 FBP1 can play cancer suppressing action as the downstream targets of DANCR in cholangiocarcinoma, and can be with the rush of antagonism DANCR
Cancer effect；
Fig. 9 present invention tests route schematic diagram.
Specific embodiment
Embodiment: the present invention is further illustrated with embodiment below, but the present invention is not intended to be limited thereto.The following example
Middle test method without specific conditions, usually according to normal condition, or according to the normal condition proposed by manufacturer.
1. bioinformatics method screens and determines high expression DANCR in cholangiocarcinoma
(1) inclusion criteria enters GEO database, inquires " cholangiocarcinoma " and " cancer of biliary
Duct " limits filter condition " Entry type:Series ", " Organism:Homo sapiens ", " Study
Type:Expression profiling by array " and " Attribute name:tissue ", are obtained about cholangiocarcinoma
Chip research query result, selects the research project met the following requirements: cholangiocarcinoma while containing case-control (or cancer-cancer
It is other), mainstream chip platform (Affy, Agilent and Illumina), single channel chip.
(2) chip data analysis
It downloads existing normalization data or initial data is normalized using RMA Express；Calculate differential expression multiple
(FC)；Z-score transformation is carried out to normalization data；Paired t-test or independent samples t-test are carried out according to sample situation later, and is counted
FDR (false discovery rate) value is calculated, value < 0.001, FDR < 0.05 P is defined as significant difference.
(3) lncRNAs Probe annotauon
LncRNAs annotation is carried out to the probe collection of chip platform in the way of probe sequence BLAST and BiomaRT inquiry, most
Significant difference lncRNAs is obtained eventually.As a result, it has been found that DANCR is the lncRNAs that conspicuousness raises in data.
2. detecting DANCR expression in cholangiocarcinoma sample and analyzing its correlation
Further collect the arrangement of cholangiocarcinoma and cancer beside organism's sample and its clinical data.Trizol method extracts the total of tissue
RNA, taking the RNA reverse transcription of 1 μ g is cDNA template (TAKARA).Using qPCR in 17 pairs of cholangiocarcinomas and its cancer beside organism
It is verified, DANCR averagely raises about 5 times as the result is shown.7500 type quantitative PCR apparatus of quantitative PCR application ABI company
(Applied Biosystem, Foster City, CA) is as a result analyzed using 2- Δ Δ ct value.
The primer sequence is as follows:
DANCR F:5 '-CGGAGGTGGATTCTGTTAGG-3 '
DANCR R:5 '-TCGGTGTAGCAAGTCTGGTG-3 '
GAPDH F:5 '-GGGAGCCAAAAGGGTCAT-3 '
GAPDH R:5 '-GAGTCCTTCCACGATACCAA-3 '
Functional study of the 3.DANCR in cholangiocarcinoma cell
(1) siRNA molecule and overexpression plasmid (invitrogene company) transfection for DANCR of design synthesis specificity
Cholangiocarcinoma cell is control with untransfected interference sequence；Design synthesis specificity DANCR is overexpressed plamid vector transfection cholangiocarcinoma
Cell is control with empty carrier transfection group；The total serum IgE of cell is collected after 48 hours, qRT-PCR detects transfection efficiency respectively.
(2) after cholangiocarcinoma cell system closes off or is overexpressed DANCR, cck8, Clone formation, Transwell experiment,
To cholangiocarcinoma cell proliferation, cell invasion transfer and cell cycle, apoptosis etc. after EDU, Flow Cytometry detection closing DANCR
The influence of function.With biological function of the clear DANCR in cholangiocarcinoma cell.
Functional verification of the 4.DANCR in model animal
The interference and overexpression slow virus carrier building of DANCR: the sequence and specificity interference sequence of DANCR are synthesized, with GAPDH
The sequence of (glyceraldehyde phosphate dehydrogenase) gene is as control.Above-mentioned segment is synthesized by Invitrogen TM company, and is inserted
Enter in slow virus carrier；It is packaged into slow virus carrier infection RBE and HuCCT1 cell, G418 screens positive cell；It collects positive
Surely turn the total serum IgE of cell, qRT-PCR detects the expression of DANCR.It is subcutaneously injected respectively with itself and corresponding cellular control unit
BALB/C nude mice constructs subcutaneous tumor formation model；After knurl is formed, the tumor volume of survey in every 2 days is put to death mouse after 4 weeks, is taken
Knurl measures weight.
5.DANCR regulates and controls the Study on Molecular Mechanism of cholangiocarcinoma cell proliferation
(1) target gene for primarily determining that DANCR is regulated and controled is sequenced using transcript profile
The extraction (Trizol method) of a total serum IgE
After striking low DANCR 48h in HuCCT1 cell, 500ulTrizol is added in control group and interference group cell respectively,
Place 10min；100 μ L chloroforms are added, strenuous vibration 15s is stored at room temperature 5min；Centrifugation, 4 DEG C, 12,000g, 10min will be upper
It is transferred to clearly in a 1 new .5ml centrifuge tube.Isometric isopropanol is added, is gently mixed by inversion, -20 DEG C of placement 30min,
Centrifugation, 4 DEG C, 12,000g, 20min, reject supernatant.75% ethyl alcohol of 1ml pre-cooling is added, washing precipitating is centrifuged, 4 DEG C, 12,
000g, 5min, reject supernatant, drying at room temperature 10min.30-50 μ l RNase-Free water is added, dissolves RNA, -80 DEG C of preservations.
The quality inspection of b.RNA
2200 machine of Agilent is opened, software is opened；It is packed into corresponding R6K Agilent ScreenTape, the volley of rifle fire is packed into 16
A Loading pipette tips；8 unions are taken out, are separately added into 4 μ L R6K Sample Buffer and 1 μ LRNA sample in order
；It is collected by centrifugation mixed liquor after mixing, 72 DEG C of 3min, on ice 2min；Centrifugation is then placed in Agilent to collect tube wall solution
In 2200 sample panels；It clicks Start and starts quality inspection.
C. library construction
Transcript profile RNA fragmentation: the acquisition of poly (A) RNA；RNA fragmentation；Segment RNA purifying building library: RNA adjunction
Head；Reverse transcription；CDNA purifying；CDNA amplification；Amplified production purifying.Library quality inspection: opening 2200 machine of Agilent, opens
Software；It is packed into corresponding D6K Agilent ScreenTape, the volley of rifle fire is packed into 16 Loading pipette tips；8 connecting legs are taken out,
3 μ LD1K Ladder are added in the first pipe, 3 μ LD1K Sample Buffer and 1 μ are separately added into remaining pipe
LcDNA sample is vortexed and mixes 5s；Tube wall solution is collected by centrifugation, is then placed in 2200 sample panel of Agilent；Click Start
Start quality inspection.
The dilution in d sequencing template preparation library；Emulsion droplet PCR；The cleaning of pearl；The enrichment of positive pearl.
Machine is sequenced on e
Clean sequenator；Sequenator initialization；Loading.
(2) RIP experimental verification DANCR and EZH2 is bound
A.RIP: RNP compound is precipitated to RBE cell and HuCCT1 cell EZH2 antibody mediated immunity.
B. by the extracting of the total serum IgE of precipitating.The total serum IgE that the DNAase1 processing of no RNA enzyme is extracted.The RNA of extraction is carried out
Reverse transcription and qRT-PCR detection.
C .RNA-pulldown combines SDS-PAGE- silver staining-mass-spectrometric technique: building DANCR is overexpressed plasmid, with spy
Different restriction enzyme cuts plasmid, transcribes to obtain DANCRRNA using in-vitro transcription kit, then mark with Biotin end
Kit uses magnetic bead hatching combination to DANCR end mark, with intracellular protein, efficiently concentrating rna binding protein, specifically
The albumen in conjunction with DANCR is obtained, then combines SDS-PAGE- silver staining-mass-spectrometric technique, identifies the albumen in conjunction with DANCR.
(3) DANCR binds the expression of EZH2 regulation target gene in cholangiocarcinoma cell
The DANCR interference of a design specificity or over-express vector, will with liposome 2000 (Invitrogen TM) transfection reagent
DANCR interference or over-express vector transiently transfect cholangiocarcinoma cell, after transfection 48 hours, collect cell total rna and albumen is used for
QRT-PCR and westernblot detects target gene mRNA and protein expression respectively (using GAPDH as control).
B. the interference sequence of the E Z H 2 of specificity, interference sequence such as O: 12 institute of S E Q I D N are designed
Show, it may be assumed that s i-E Z H 2:
GAGGUUCAGACGAGCUGAUUU；AUCAGCUCGUCUGAACCUCUU.
Cholangiocarcinoma cell will be transiently transfected after transfection 48 hours with liposome 2000 (Invitrogen TM) transfection reagent to receive
Collection cell total rna and albumen detect the mRNA and egg of EZH2 and target gene FBP1 for qRT-PCR and westernblot respectively
White expression (using GAPDH as control).
After c is closed off and is overexpressed DANCR, ChIP detects the combination energy of EZH2 and target gene FBP1 promoter region
Power.
The primer sequence is as follows:
DANCR CGGAGGTGGATTCTGTTAGG TCGGTGTAGCAAGTCTGGTG
EZH2 TGCACATCCTGACTTCTGTG AAGGGCATTCACCAACTCC
SLIT3 GACACCTGACGCTTATTGACC TCAGGAACGCTGGAAATG
FBP1 TTTGGTGGACAAGGATGTGA TCCCTCCGTAGACCAGAGTG
XDH GACGACATTCCTCGCTACG TGCCCAACACAAGTAACCTTAT
GEM CACAACGTGAAGGAGCTGTT GTCATGGCAGGATTTGGACT
GCNT3 GGTGGAGTTCCCTATTGCAT TAATTGCTTTGACCGCCTCT
TNFATP3 AGTGTCAGCATCCCAACCA CCGGTTAGCCATACATCTGC
GAPDH GGGAGCCAAAAGGGTCAT GAGTCCTTCCACGATACCAA
6. the correlation research in cholangiocarcinoma sample between DANCR and target gene.And analyze the function phenotype of target gene.
It further collects cholangiocarcinoma sample and arranges detailed pathological data and establish follow-up record storehouse.QRT-PCR skill
Art detects cholangiocarcinoma sample and matches the expression of DANCR in normal specimen, and analyzes its disease with cholangiocarcinoma patients
The correlation of reason data (tumour TNM stage, pathological characters, prognosis etc.).QRT-PCR is analyzing cholangiocarcinoma sample and pairing just
The expression of corresponding target genes FBP1 in normal sample；Phase between DANCR and target gene in analysis cholangiocarcinoma clinical tissue sample
Guan Xing.And the effect that FBP1 is played in cholangiocarcinoma is studied by functional experiment.With further evaluate DANCR and
FBP1 can be used as the marker of cholangiocarcinoma diagnosis, prognosis, and abnormal expression may be the crucial target for promoting cholangiocarcinoma occurrence and development
Point.
As described above, must not be explained although the present invention has been indicated and described referring to specific preferred embodiment
For the limitation to invention itself.It without prejudice to the spirit and scope of the invention as defined in the appended claims, can be right
Various changes can be made in the form and details for it.
Sequence table
<120>application of a kind of long-chain non-coding RNA in diagnoses and treatment cholangiocarcinoma
<160> 21
<170> SIPOSequenceListing 1.0
<210> 1
<211> 915
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gcccttgccc agagtcttcc cgggattggc tgcgggcctc gcgaccctcc tgcttccctc 60
cccgccccgc gccgcctctc tggtttgtgc gcccgtcgca ggtcgcaggc ctctttgtca 120
gctggagttg cgcgggctga cgcgccacta tgtagcgggt ttcgggcggg ccacgcgtgc 180
gggacaggaa cccaacccca gccgaccttg agctccagga gttcgtctct tacgtctgcg 240
gaagtgcagc tgcctcagtt cttagcgcag gttgacaact acaggcacaa gccattgaag 300
ctggaatgtc ctgttgctgg tatttcaatt gacttaagcc aactatccct tcagttacaa 360
taggaaagtg cctctaataa ggccaaatat gcgtactaac ttgtagcaac cacgtgtccg 420
tgcagtgcca caggagctag agcagtgaca atgctggtgg caacagggca gtgtagcagg 480
tgcttcatgt tcaccttttc aaccttttca tttaattgtc acaactcgga ggtggattct 540
gttagggaca ggctgcccca ggaccactcc gcccccgcta actcaatgca gctgaccctt 600
accctgaata ctctgcagct gcattcctga accgttatct aggcgctata gcaaggtcac 660
cagacttgct acaccgaagc cctctgggtg gcacggggga ggtcatgaga aacgtggatt 720
acaccccctt gtaaattcct attttcacaa gataatatat tgtaagccgg tcatgagatt 780
atatgtggta aagttaattg actaacaacc ccagggtctc tctcccccat ataaacccct 840
cattttgtaa gctcagggct gccacctccg actggtggag aagcctggca ggttaataaa 900
cttacttggc ctgac 945
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
cggaggtgga ttctgttagg 20
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
tcggtgtagc aagtctggtg 20
<210> 4
<211> 21
<212> DNA/RNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> variation
<400> 4
agcuagagca gugacaaugt t 21
<210> 5
<211> 21
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 5
cauugucacu gcucuagcuc c 21
<210> 6
<211> 21
<212> DNA/RNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> variation
<400> 6
gcguacuaac uuguagcaat t 21
<210> 7
<211> 21
<212> DNA/RNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> variation
<400> 7
uugcuacaag uuaguacgct t 21
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cggaggtgga ttctgttagg 20
<210> 9
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
tcggtgtagc aagtctggtg 20
<210> 10
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
gggagccaaa agggtcat 18
<210> 11
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
gagtccttcc acgataccaa 20
<210> 12
<211> 42
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 12
gagguucaga cgagcugauu uaucagcucg ucugaaccuc uu 42
<210> 13
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
cggaggtgga ttctgttagg tcggtgtagc aagtctggtg 40
<210> 14
<211> 39
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
tgcacatcct gacttctgtg aagggcattc accaactcc 39
<210> 15
<211> 39
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
gacacctgac gcttattgac ctcaggaacg ctggaaatg 39
<210> 16
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
tttggtggac aaggatgtga tccctccgta gaccagagtg 40
<210> 17
<211> 41
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
gacgacattc ctcgctacgt gcccaacaca agtaacctta t 41
<210> 18
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
cacaacgtga aggagctgtt gtcatggcag gatttggact 40
<210> 19
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
ggtggagttc cctattgcat taattgcttt gaccgcctct 40
<210> 20
<211> 39
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
agtgtcagca tcccaaccac cggttagcca tacatctgc 39
<210> 21
<211> 38
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 21
gggagccaaa agggtcatga gtccttccac gataccaa 38
Claims (10)
1. a kind of long-chain non-coding RNA, DANCR, it is characterised in that: length 915bp, sequence is as shown in SEQID NO:1.
2. detecting application of the reagent of long-chain non-coding RNA described in claim 1 in preparation diagnosis cholangiocarcinoma reagent.
3. a kind of pharmaceutical composition, it is characterised in that: including detecting long-chain non-coding RNA, the detection reagent of DANCR.
4. application of claim 3 described pharmaceutical composition in preparation treatment bile duct cancer drug.
5. one kind is for detecting long-chain non-coding RNA, the primer sets of DANCR, it is characterised in that: serial number is respectively such as SEQ ID NO:
Shown in 2 and 3, it may be assumed that
SEQ ID NO:2 DANCR F CGGAGGTGGATTCTGTTAGG,
SEQ ID NO:3 DANCR R TCGGTGTAGCAAGTCTGGTG.
6. application of the primer sets described in claim 5 in preparation diagnosis cholangiocarcinoma reagent.
7. a kind of kit, it is characterised in that: including detecting long-chain non-coding RNA, the primer sets of DANCR described in claim 5.
8. kit according to claim 7, it is characterised in that: the concentration of primer sets is 0.01- in the kit
0.1mol/L。
9. a kind of for treating the pharmaceutical composition of cholangiocarcinoma, it is characterised in that: including long-chain non-coding RNA, the inhibition of DANCR
Agent.
10. according to claim 9 for treating the pharmaceutical composition of cholangiocarcinoma, it is characterised in that: the inhibition of the DANCR
Agent is the siRNA, sequence such as SEQ ID NO:4,5 or SEQ ID NO:6, shown in 7 of DANCR, it may be assumed that
si-DANCR 1#:
AGCUAGAGCAGUGACAAUGTT SEQ ID NO:4
CAUUGUCACUGCUCUAGCUCC SEQ ID NO:5
si-DANCR 2#:
GCGUACUAACUUGUAGCAATT SEQ ID NO:6
UUGCUACAAGUUAGUACGCTT SEQ ID NO:7。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811395835.6A CN109456971A (en) | 2018-11-22 | 2018-11-22 | A kind of application of long-chain non-coding RNA in diagnoses and treatment cholangiocarcinoma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811395835.6A CN109456971A (en) | 2018-11-22 | 2018-11-22 | A kind of application of long-chain non-coding RNA in diagnoses and treatment cholangiocarcinoma |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109456971A true CN109456971A (en) | 2019-03-12 |
Family
ID=65611297
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811395835.6A Pending CN109456971A (en) | 2018-11-22 | 2018-11-22 | A kind of application of long-chain non-coding RNA in diagnoses and treatment cholangiocarcinoma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109456971A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699453A (en) * | 2019-10-10 | 2020-01-17 | 山东大学第二医院 | Bile duct cancer detection, treatment and prognosis target and application |
| CN115466741A (en) * | 2022-01-13 | 2022-12-13 | 上海节惠生物科技有限公司 | Interference sequence aiming at human long-chain non-coding RNA-DANCR and application of interference sequence in preparation of hepatocellular carcinoma treatment drug |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160078168A1 (en) * | 2012-02-13 | 2016-03-17 | Splicingcodes.Com | Fusion transcript detection methods and fusion transcripts identified thereby |
| CN108823305A (en) * | 2017-04-28 | 2018-11-16 | 青岛市中心医院 | A kind of multiple PCR method of 8 kinds of tumour correlation long-chain non-coding RNAs of synchronous detection |
-
2018
- 2018-11-22 CN CN201811395835.6A patent/CN109456971A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160078168A1 (en) * | 2012-02-13 | 2016-03-17 | Splicingcodes.Com | Fusion transcript detection methods and fusion transcripts identified thereby |
| CN108823305A (en) * | 2017-04-28 | 2018-11-16 | 青岛市中心医院 | A kind of multiple PCR method of 8 kinds of tumour correlation long-chain non-coding RNAs of synchronous detection |
Non-Patent Citations (2)
| Title |
|---|
| HUI SHI ET AL.: "Long non-coding RNA DANCR promotes cell proliferation, migration, invasion and resistance to apoptosis in esophageal cancer", 《JOURNAL OF THORACIC DISEASE》 * |
| WANG S ET AL.: "NCBI Reference Sequence: NR_024031.2", 《GENBANK》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699453A (en) * | 2019-10-10 | 2020-01-17 | 山东大学第二医院 | Bile duct cancer detection, treatment and prognosis target and application |
| CN110699453B (en) * | 2019-10-10 | 2020-09-01 | 山东大学第二医院 | Bile duct cancer detection, treatment and prognosis target and application |
| CN115466741A (en) * | 2022-01-13 | 2022-12-13 | 上海节惠生物科技有限公司 | Interference sequence aiming at human long-chain non-coding RNA-DANCR and application of interference sequence in preparation of hepatocellular carcinoma treatment drug |
| CN115466741B (en) * | 2022-01-13 | 2024-07-30 | 上海节惠生物科技有限公司 | Interference sequence for human long-chain non-coding RNA-DANCR and application thereof in preparation of hepatocellular carcinoma treatment drugs |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102549167B (en) | Phosphodiesterase 4d7 as prostate cancer marker | |
| CN110423819B (en) | lncRNA participating in human colorectal cancer proliferation and drug resistance and application thereof | |
| CN107326071B (en) | Application of PLPP4 as non-small cell lung cancer diagnosis, treatment and prognosis target | |
| CN102876676A (en) | Blood serum/blood plasma micro ribonucleic acid (miRNA) marker relevant with pancreatic cancer and application thereof | |
| CN108220434A (en) | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment cholangiocarcinoma | |
| CN111534592A (en) | Method for researching function and mechanism of m6A reader YTHDF1 in ovarian carcinogenesis | |
| CN112501299A (en) | Method for predicting recurrence and metastasis of liver cancer and application | |
| CN109593848A (en) | A kind of tumour correlated series, long-chain non-coding RNA and its application | |
| CN109456971A (en) | A kind of application of long-chain non-coding RNA in diagnoses and treatment cholangiocarcinoma | |
| CN109486817A (en) | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnoses and treatment cholangiocarcinoma | |
| CN108660212B (en) | Application of WDR1 gene in preparation of non-small cell lung cancer treatment and detection products | |
| CN110496221A (en) | Inhibit application of the substance of DPPA3 expression in the product that preparation prevents and treats cancer | |
| WO2019165366A1 (en) | Drug efficacy evaluations | |
| CN114107492A (en) | Molecular marker for tumor molecular typing and therapeutic drug evaluation, detection primer and kit thereof | |
| CN106048073B (en) | Biomarker and its application of a kind of oophoroma auxiliary diagnosis or outcome prediction | |
| Tang et al. | HSP90AA1 promotes lymphatic metastasis of hypopharyngeal squamous cell carcinoma by regulating epithelial-mesenchymal transition | |
| CN105457041B (en) | Application of miR-26a in non-small cell lung cancer | |
| CN109251927A (en) | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment cholangiocarcinoma | |
| CN116855607A (en) | Application of circCHPT1 in preparation of non-small cell lung cancer early diagnosis or prognosis detection kit | |
| CN110257514A (en) | A kind of new cancer of the esophagus blood miRNA marker and its application | |
| CN114891795A (en) | Application of long-chain non-coding RNA CRCAL-3 as breast cancer radiotherapy resistance marker | |
| CN103911436A (en) | Serum/plasma miRNA marker for early diagnosis of noncardiac gastric carcinoma and applications thereof | |
| CN111269987B (en) | Diagnostic prognosis marker MAPK8IP1P2 for thyroid cancer and application thereof | |
| Wang et al. | miR-125b enhances metastasis and progression of cancer via the TXNIP and HIF1α pathway in pancreatic cancer | |
| CN111635941A (en) | Detection kit for SDPR gene expression and/or SDPR gene methylation level and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190312 |