CN108218967A - Rice ear sprouting period GAP-associated protein GAP and its encoding gene and application - Google Patents
Rice ear sprouting period GAP-associated protein GAP and its encoding gene and application Download PDFInfo
- Publication number
- CN108218967A CN108218967A CN201611178250.XA CN201611178250A CN108218967A CN 108218967 A CN108218967 A CN 108218967A CN 201611178250 A CN201611178250 A CN 201611178250A CN 108218967 A CN108218967 A CN 108218967A
- Authority
- CN
- China
- Prior art keywords
- plant
- rice
- dna
- recombinant vector
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Botany (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of rice ear sprouting period GAP-associated protein GAP and its encoding gene and applications.Protein provided by the invention, entitled DH1, the protein being made of the amino acid sequence shown in sequence in sequence table 2.Present invention clone obtainsDH1Gene, the heading period of plant can be postponed by being overexpressed the gene, and the heading period of plant can be shifted to an earlier date by lacking the gene, illustrate that the gene can be used to plant heading period；Plant to cultivate high-adaptability is laid a good foundation.Therefore using DH1 gene regulation plant heading stages, adaptability, the yield and quality of different regions crops under the conditions of are improved.
Description
Technical field
The present invention relates to plant genetic engineering field more particularly to a kind of rice ear sprouting period GAP-associated protein GAPs and its encoding gene
With application.
Background technology
Rice is one of important cereal crops in the world, and Rice Production has pole in China's grain-production and national economy
Its important role.However, since economy rapid development, population growth and Cultivated Land Area Decrease, Rice Production face very big
Pressure went out high-yield rice using the technique study of molecular genetics and functional genomics in recent years and was more paid close attention to as people
Hot issue.Heading stage is one of Main Agronomic Characters for influencing rice yield, generally refers to the day of first tassel extraction
Phase is determined that suitable heading stage is before rice is given stable high yields irrespective of drought or water logging by the photonasty of rice, response to temperature and basic nutrition growth characteristics
One of condition is put forward, heading too early can cause the nutrient growth of rice to be not enough, and meeting of earing too late is due to external environment such as season
Section temperature is not suitable for and yield is caused to decline.Surpass parent to understand the growth and development process of monocotyledon rice, solving hybrid paddy rice
The problem of late-maturing, the yield for improving rice and the adaptability to external environment, receive the research of rice ear sprouting period regulatory mechanism
Concern.
Rice belongs to short-day plant, i.e., ears under short-day relatively early, and delay of earing under the long-day.Research is found very
Polygenes participate in rice ear sprouting period regulated and control network, including florigen gene Hd3a, RFT1 and upstream gene Hd1, Ehd1,
DTH2, COL4, downstream gene MADS14, MADS15 etc. identify rice ear sprouting period controlling gene, and then to Rice Heading period regulation
The further investigation of mechanism not only has important theory significance, the application prospect for more having breeding practice, breed improvement etc. wide.
Invention content
It is an object of the present invention to provide a kind of rice ear sprouting period GAP-associated protein GAP and its encoding genes.
Protein provided by the invention, entitled DH1 (Delayed hEading date 1), from rice (Oryza sativa ）, it is as follows（a）Or（b）：
（a）The protein being made of the amino acid sequence shown in SEQ ID NO.2；
（b）By substitution of the amino acid sequence shown in SEQ ID NO.2 by one or several amino acid residues and/or missing
And/or addition and with the plant heading stage relevant protein as derived from SEQ ID NO.2.
It the substitution of one or several amino acid residues and/or lacks and ors add residual to be no more than 10 amino acid
It the substitution of base and/or lacks and ors add.
Above-mentioned SEQ ID NO.2 are made of 355 amino acid residues.
The DNA molecular of encoding said proteins also belongs to protection scope of the present invention.
Above-mentioned DNA molecular is following (1）Or (2）Or (3）DNA molecular：
(1）Code area is the DNA molecular shown in SEQ ID NO.1；
(2）Under strict conditions with（1）The DNA sequence dna hybridization of restriction and the DNA molecular of coding and plant heading stage GAP-associated protein GAP；
(3）With（1）The DNA sequence dna of restriction at least with 70%, at least with 75%, at least with 80%, at least with 85%, at least
With 90%, at least with 95%, at least with 96%, at least with 97%, at least with 98% or at least with 99% homology and
The DNA molecular of coding and plant heading stage GAP-associated protein GAP.
The stringent condition is in 6 × SSC, the solution of 0.5% SDS, 65oHybridize under C, then with 2 × SSC,
0.1% SDS and 1 × SSC, it is primary that 0.1% SDS respectively washes film.
SEQ ID NO.1 in above-mentioned sequence table are made of 1068 nucleotide.
Above-mentioned heading stage is specially the heading period of plant.
It is a further object to provide inhibition or the purposes of the substance of the above-mentioned protein expression of silence.
Application of the substance of inhibition provided by the invention or the above-mentioned protein expression of silence in plant heading is promoted.
In above application, the substance of protein expression is recombinant vector, contains recombinant vector described in the inhibition or silence
Transgenic cell line or recombinant bacterium；
DNA fragmentation 1 and DNA fragmentation 2 is are inserted into binary expression vector by the recombinant vector, obtained inhibition or the right of silence
Profit requires the recombinant vector of 1 protein expression；The code area of the DNA fragmentation 1 and the code area of the DNA fragmentation 2 are each other
Reverse complemental；The nucleotides sequence of 1 code area of DNA molecular is classified as SEQ ID NO.1 from -530 nucleosides in 5 ' ends the 141st
Acid；In an embodiment of the present invention, binary expression vector is pCUbi1390- △ FAD2, and recombinant vector is carried for RNA interference recombinations
Body pCUbi1390- △ FAD2-DH1, construction method are shown in the 2 of the one of embodiment 2.
It is described to promote plant heading stage shifting to an earlier date for heading period in above application, when counting nutrient growth by field
Between shorten embody.
The plant is specially dicotyledon or monocotyledon；The monocotyledon is specially further rice.
Meanwhile transgenic cell line or recombinant bacterium the present invention also provides recombinant vector, containing recombinant vector：
DNA fragmentation 1 and DNA fragmentation 2 is are inserted into binary expression vector by the recombinant vector, obtained inhibition or silence institute
State the recombinant vector of protein expression；The code area of the code area of the DNA fragmentation 1 and the DNA fragmentation 2 reverse complemental each other；
The nucleotides sequence of 1 code area of DNA molecular is classified as SEQ ID NO.1 from -530 nucleotide in 5 ' ends the 141st.
In an embodiment of the present invention, binary expression vector is pCUbi1390- △ FAD2, and recombinant vector is RNA interference weights
Group carrier pCUbi1390- △ FAD2-DH1, construction method are shown in embodiment 2.
Recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing above-mentioned DNA molecular are also that the present invention protects
Range；
The recombinant vector is that above-mentioned DNA molecular is inserted into expression vector, obtains expressing the recombinant vector of above-mentioned albumen.At this
In the embodiment of invention, expression vector is specially pCUbi1390, and recombinant vector is the nucleotide homology shown in SEQ ID NO.1
The carrier obtained on binary expression vector pCUbi1390 is recombinated, is named as pCUbi1390-DH1。
Above-mentioned albumen, above-mentioned DNA molecular or the above-mentioned recombinant vector containing above-mentioned DNA molecular, expression cassette, transgenic cell
The application of system or recombinant bacterium in plant heading stage is postponed；
It is described to postpone the postponement that plant heading stage is specially heading period, nutrient growth time lengthening is counted by field and is embodied.
The plant is specially dicotyledon or monocotyledon；The monocotyledon is specially further rice.
Fourth object of the present invention is to provide a kind of method for cultivating genetically modified plants B or a kind of cultivation genetically modified plants
The method of A.
A kind of method for cultivating genetically modified plants B provided by the invention, to inhibit the work of the above-mentioned albumen in purpose plant
Property or expression, obtain genetically modified plants B, the heading period of the genetically modified plants B is earlier than the purpose plant；
It is described that the activity of the above-mentioned albumen in purpose plant or expression is inhibited specially to lead the recombinant vector in third purpose
Enter the purpose plant；
A kind of method for cultivating genetically modified plants A provided by the invention, for above-mentioned DNA molecular is imported in purpose plant, obtains
The heading period of genetically modified plants A, the genetically modified plants A are later than the purpose plant；
It is described that the DNA molecular for encoding above-mentioned albumen is imported into purpose especially by the above-mentioned recombinant vector containing above-mentioned DNA molecular
Plant.
The purpose plant is specially dicotyledon or monocotyledon；The monocotyledon is specially further water
Rice.
The primer pair for expanding the DNA molecular overall length or its arbitrary segment is also the scope of protection of the invention.
Primer pair in the embodiment of the present invention is as follows：5 '-ATGGGGAAGAAGAAGAAGCG-3 ' and 5 '-
TTACACAATATTCCAGTTCA-3’。
The experiment proves that present invention clone obtainsDH1Gene, being overexpressed the gene causes plant heading stage to push away
Late, the heading period of plant can be shifted to an earlier date by lacking the gene, illustrate that the gene can be used to plant heading stage, be planted to improve
Object adaptability, increase plant products are laid a good foundation.Therefore using DH1 gene regulation plant heading stages, improve different regions and
Under the conditions of crops adaptability, yield and quality.
Description of the drawings
Fig. 1 is pCUbi1390- △ FAD2 carrier structure schematic diagrames.
Fig. 2 is lacked for DH1 and is overexpressed in plantDH1Gene transcription level detects.
Fig. 3 is the phenotype that DH1 lacked and be overexpressed plant.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Rice (Oryza sativa ssp. Japonica)kitaake（Kit）WithNipponbare（Nip）Be documented in as
In Publication about Document：Gao H, Zheng X, Fei G, Chen J, Jin M, Ren Y, Wu W, Zhou K, Sheng P,
Zhou F, Jiang L, Wang J, Zhang X, Guo X, Wang J, Cheng Z, Wu C, Wang H, Wan
J. Ehd4 encodes a novel and Oryza-genus-specific regulator of photoperiodic
flowering in rice. PLoS Genet 9(2):E1003281 (2013), the public can be from Chinese Academy of Agricultural Sciences crops
Science Institute obtains, hereinafter also referred to rice wild rice.
Agrobacterium tumefaciems EHA105（Agrobacterium tumefaciensEHA105）It records in the following literature：
New Agrobacterium helper plasmids for gene transfer to plants. Hood,
Elizabeth E; Gelvin, Stanton B; Melchers, Leo S; Hoekema, Andre. Transgenic Research, 2(4): p. 208-218-218（1993）The public can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science
.
Binary expression vector pCUbi1390 is recorded in the following literature：Wu Z, Zhang X, He B, Diao L,
Sheng S, Wang J, Guo X, Su N, Wang L, Jiang L, Wang C, Zhai H, Wan J. A
chlorophyll-deficient rice mutant with impaired chlorophyllide esterification
in chlorophyll biosynthesis. Plant Physiol. 2007 Sep;145(1):29-40, the public can be therefrom
Crop science research institute of Academy of Agricultural Sciences of state obtains.
PCUbi1390- △ FAD2 carriers are recorded in the following literature：Wax crystal-sparse leaf2, a rice
homologue of WAX2/GL1, is involved in synthesis of leaf cuticular wax. Mao
B., et al. (2012). Planta 235:39-52, the public can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science
.
The cultivation condition of rice material：Rice paddy seed is soaked in water 3 days, is then sowed on seedbed.The rice of 4 leaf phases
In seedling replanting to paddy field, divide single plant rice transplanting.
Embodiment 1,DH1The acquisition of gene
According to gramene databases, primer is designed（Primer sequence is：Forward primer, 5 '-
ATGGGGAAGAAGAAGAAGCG-3’；Reverse primer, 5 '-TTACACAATATTCCAGTTCA-3 '）, drawn with above-mentioned
Object, with rice (Oryza sativa ssp.Japonica) cDNA of 2 weeks seedling of Kitaake is template, obtains full-length cDNA
Sequence 1068bp, result have the nucleotide in sequence table shown in sequence 1 for the PCR product, and the gene of the PCR product isDH1,
The code area of the gene is sequence 1 in sequence table；The albumen of the gene code is named as DH1, and the amino acid sequence of the albumen is
Sequence 2 in sequence table.
Embodiment 2,DH1Application of the gene in plant heading stage is regulated and controled
First, recombinant vector is overexpressed to obtain
1st, it is overexpressed recombinant vector pCUbi1390-DH1Acquisition
With rice (Oryza sativa ssp.Japonica) total cDNA that Kitaake seedling extraction RNA reverse transcriptions in 2 weeks obtain
For template, with primer 5 '-TCTGCACTAGGTACCTGCAGATGGGGAAGAAGAAGAAGCG -3 ' and 5 ' -
ATGGATCCGTCGACCTGCAGCACAATATTCCAGTTCAGAG -3 ' is expanded, and obtains the PCR product of 1105bp.By
Sequencing, the PCR product have the nucleotide shown in 1 code area of sequence in sequence table；
Above-mentioned PCR product is recycled, passes through clontech infusion kit (takara Products) homologous recombinations to double base
The restriction enzyme site of expression vector pCUbi1390PstOn I, obtained connection product is transferred in Escherichia coli, obtains transformant.
The plasmid of extraction transformant sends to sequencing, which is to recombinate the nucleotide homology shown in sequence in sequence table 1
The carrier obtained on to binary expression vector pCUbi1390, is named as pCUbi1390-DH1, to be overexpressed recombinant vector.
2nd,DH1Gene RNA interference carrier pCUbi1390- △ FAD2-DH1Structure
1、DH1The acquisition of gene interference fragment
（1）The extraction of rice varieties Kitaake seedling RNA and the preparation of cDNA
Use RNAprep pure plant total RNA extraction reagent boxes（Purchased from Tiangeng biochemical technology（Beijing）Co., Ltd）, extraction
Rice (Oryza sativa ssp.Japonica) RNA of 14 days seedling of Kitaake, reverse transcription obtain cDNA.
（2）The design of primer
AmplificationDH1The primer of sense fragment isDH1-sense-F:5- CGTAGTCGACGGATCCCGGCGGCATGGCCATCCACG
- 3 andDH1-sense-R:5- GAATTCCCGGGGATCCGGTGCAAGCCCAGAAGCCAT -3。
AmplificationDH1The primer of antisense fragments isDH1-antisense-F:5- TTACTTCTGCACTAGGTACCGGTGCAA
GCCCAGAAGCCAT -3 andDH1-antisense-R: 5-TAGAGCTCAGGCCTGGTACCCGGCGGCATGGCCATCCACG
-3。
（3）PCR amplificationDH1Gene interference fragment
Using cDNA as template, PCR amplification is carried out with DH1-sense-F and DH1-sense-R primers, obtains segment 1.With cDNA
For template, PCR amplification is carried out with DH1-antisense-F and DH1-antisense-R primers, obtains segment 2.
By above-mentioned segment electrophoresis detection, 1 size of segment is about 390bp, and 2 size of segment is about 390bp.By segment 1 and piece
Section 2 sends to sequencing, the results showed that the coded sequence of segment 1 is nucleotide shown in sequence 1 in sequence table from 5 ' end 141-
530bp, the coded sequence of segment 2 are nucleotide shown in sequence 1 in sequence table from the reverse complemental sequence of 5 ' end 141-530
Row.
2nd, bandDH1The pCUbi1390- △ FAD2-sense- of gene justice interference fragmentDH1Recombinant vector obtains
（1）DH1The homologous recombination directed cloning of gene justice interference fragment
WithBamHI digestion pCUbi1390- △ FAD2 carriers（Structure diagram is as shown in Figure 1）, obtained linear
PCUbi1390- △ FAD2, recycling.The method that segment 1 uses homologous recombination directed cloning is connected to linear
PCUbi1390- △ FAD2 carriers（Specific steps and method are with reference to clontech infusion kit specifications, the kit
It can be bought from Dalian treasured biotech firm）, then homologous recombination product is transferred to DH5 α competent cells, 37 degree of overnight incubations obtain
Monoclonal.
（2）Identify pCUbi1390- △ FAD2-sense-DH1Recombinant vector
It selects（1）The monoclonal of middle gained is inoculated in the LB fluid nutrient mediums containing kanamycins, is incubated overnight；Take overnight training
Foster bacterium solution carries out PCR amplification, identification is already inserted into segment as PCR reaction templates using vector primer 1390-F and FAD-R
1 pCUbi1390- △ FAD2-sense-DH1Recombinant vector obtains the as positive colony of 745bp DNA bands, primer
Sequence is as follows：
1390-F：5'-TGCCTTCATACGCTATTTATTTGC-3'；
FAD-R：5'-GAAGCGACGGACCTGGAGAT-3'.
The plasmid of positive colony is extracted, sends to sequencing, sequencing primer is Left MCS-F and Left MCS-R, sequencing result
Show that segment 1 is connected correctly to pCUbi1390- △ FAD2 carriersBamHPlasmid on I is named as pCUbi1390- △ FAD2
-sense-DH1。
3rd, bandDH1The pCUbi1390- △ FAD2 of gene justice and antisense interference fragment-DH1The acquisition of recombinant vector
（1）DH1The homologous recombination directed cloning of gene antisense interference fragment
WithKpnI digestion step pCUbi1390- △ FAD2-sense- DH1Plasmid, recycling are for use.It is oriented using homologous recombination
The method of clone（With reference to clontech infusion kit specifications, which can give birth to from Dalian treasured for specific steps and method
Object company buys）, first by the segment of recycling 2 and linear pCUbi1390- △ FAD2-sense-DH1Homologous recombination reaction is carried out,
Homologous recombination product is transferred to DH5 α competent cells again, 37 degree are incubated overnight to obtain monoclonal.
（2）Identification pCUbi1390- △ FAD2-DH1Recombinant vector
Monoclonal bacterium is selected, is inoculated in the LB fluid nutrient mediums containing kalamycin, is incubated overnight；The bacterium solution being incubated overnight is taken to make
For PCR reaction templates, using FAD-F and 1390-R primers, pcr amplification reaction is carried out.Primer sequence is as follows：
FAD-F：5'-CCTTTCACAACCTGATTTCCCA-3'；
1390-R：5'-TAATCATCGCAAGACCGGCAACAGG-3'.
It is positive colony that the plasmid that clip size is 891bp, which can be expanded,.The plasmid is sent into sequencing, with FAD-F and
For 1390-R as sequencing primer, which is that segment 1 is connected to pCUbi1390- △ FAD2 carriersBamHI, and by segment 2
It is connected to pCUbi1390- △ FAD2 carriersKpnThe plasmid of I site, the code area of segment 1 and the code area of segment 2 are anti-each other
To complementation；Be named as pCUbi1390- △ FAD2-DH1。
3rd, it is overexpressed and turnsDH1Rice and RNA interference turnDH1 The acquisition of RNAi rice
1st, it is overexpressed and turnsDH1The acquisition of rice
By the overexpression recombinant vector pCUbi1390- of above-mentioned acquisitionDH1Agrobacterium tumefaciems EHA105 is transferred to by the method for heat shock
In, recombinant bacterium is obtained, plasmid is extracted, sends to sequencing, plasmid pCUbi1390-DH1, the recombinant bacterium containing the plasmid is named as
EHA105/ pCUbi1390-DH1。
The seed of rice Kitaake is shelled and is sterilized, with reference to the method for Hiei etc.（Plant J. 1994,6:271–
282）It is converted, obtains T0 generations turnDH1Rice plant.
In T0 generations, turnDH1Sowing obtains T1 generations turn after rice plant sowingDH1Rice plant.
In T1 generations, turnDH1After rice plant growth 1 month, the RNA reverse transcriptions for extracting blade obtain cDNA as template, with drawing
Object ACGGTGCAGTAAGTTCTCCA and TGCTTCATCATCCCACACCA carry out quantitative fluorescent PCR（Method is public with reference to Takara
Department, SYBR Premix Ex Taq reagent specifications）, screeningDH1The single plant that expression quantity is turned up.With wild rice（WT）
For control.
Internal reference is Ubiquitin, and the primer of internal reference is UBI-F:ACCCTGGCTGACTACAACATC and UBI-R:
AGTTGACAGCCCTAGGGTG.The results are shown in Figure 2, in wild riceDH1Relative expression quantity for 1.0, and in T1 generations, turnDH1Rice strain OE1, OE2, OE3, OE4, OE5, OE6'sDH1The expression quantity of gene is respectively 63,21.1,34.6,
18.2, 12.9, 11.3。
Show that T1 generations turnDH1In riceDH1The expression quantity of gene is higher than wild rice, to be overexpressedDH1Rice.
Empty carrier pCUbi1390 is transferred in wild rice using same method, obtain T0 generation turn pCUbi1390 water
Rice, sowing, sowing, obtain T1 generation turn pCUbi1390 rice.
2、DH1Gene RNA interferes the acquisition of rice
The plasmid pCUbi1390- △ FAD2-SX of above-mentioned acquisition are transferred to by the method for heat shock in Agrobacterium tumefaciems EHA105,
Obtain recombinant bacterium, extract plasmid, send to sequencing, plasmid be pCUbi1390- △ FAD2-DH1, the recombinant bacterium life containing the plasmid
Entitled EHA105/ pCUbi1390- △ FAD2-DH1。
The seed of rice Nipponbare is shelled and is sterilized, is inoculated into the culture medium of callus induction.After cultivating 3 weeks, from scultellum
Place grows callus, select growth it is vigorous, color is pale yellow, more open embryo callus subculture, the receptor as conversion.
By the EHA105/pCUbi1390- △ FAD2 of above-mentioned acquisition-DH1Embryo callus subculture is infected, is cultivated 3 days for 25 DEG C at dark
Afterwards, hygromycin resistance plant is screened on the Selective agar medium containing 50 mg/L hygromycin.By hygromycin resistance plant in cool place
Locate hardening, be transplanted to paddy field after a few days, obtain T0 generations turnDH1 RNAi rice.
In T0 generations, turnDH1 Sowing obtains T1 generations turn after RNAi rice plant sowingsDH1 RNAi rice plants.
In T1 generations, turnDH1 After 1 month, the RNA reverse transcriptions for extracting blade obtain cDNA as mould for RNAi rice plant growths
Plate carries out quantitative PCR with primer ACGGTGCAGTAAGTTCTCCA and TGCTTCATCATCCCACACCA.With wild rice
（WT）For control.
Internal reference is Ubiquitin, and the primer of internal reference is UBI-F:ACCCTGGCTGACTACAACATC and UBI-R:
AGTTGACAGCCCTAGGGTG.As a result such as Fig. 2 is shown, in wild riceDH1Expression quantity for 1.0, and in T1 generations, turn DH1
RNAi-1 in RNAi rice, RNAi-2, in RNAi-3DH1The expression quantity of gene is respectively 0.5,0.7,0.6, is below
Wild rice.
Show that T1 generations turnDH1 In RNAi riceDH1The expression quantity of gene is less than wild rice.
Empty carrier pCUbi1390- △ FAD2 are transferred in wild rice using same method, obtain T0 generations turn
PCUbi1390- △ FAD2 rice, sowing, sowing, obtain T1 generation turn pCUbi1390- △ FAD2 rice.
3rd, it is overexpressed and turnsDH1Rice and RNA interference turnDH1 The phenotypic evaluation of RNAi rice
By number be OE6 and the T1 of OE1 generations turnDH1In the T1 generations that rice, number are RNAi-1, turnDH1 RNAi rice, wild type water
Rice（WT）, T1 generation turn pCUbi1390 rice and T1 generation turn pCUbi1390- △ FAD2 rice seed after planting, will grow 20 days
Seedling replanting to Beijing field, the related agronomy of time of first tassel extraction of statistics rice and grain number per spike, spike length, plant height
Shape.Each 20 plants of strain, experiment is repeated 3 times.
Grain number per spike, spike length are respectively grain of rice number and spike length degree on the main fringe of every plant of rice；Plant height for every plant of rice from root to
The length on fringe top.
The results are shown in Figure 3, and A, B are Phenotypic Observation, and C is the statistical number of heading period, plant height, spike length and number of grain per ear
According to.
As can be seen from Figure 3A, the spike length ratio WT long of OE6 and OE1, grain number per spike is more, and plant height is higher, and heading period is later.
Find out from Fig. 3 B, the spike length of RNAi is shorter than wild type Nipponbare, and grain number per spike is less, and plant height is shorter, heading period compared with
It is early.
Find out from Fig. 3 C,
Heading period, plant height, spike length and the number of grain per ear that number is OE6 are respectively 66 days, 75.4cm, 14.2cm, 80.
Heading period, plant height, spike length and the number of grain per ear that number is OE1 are respectively 91 days, 90.9cm, 15.9cm, 151.
Heading period, plant height, spike length and the number of grain per ear of the corresponding wild type kitaake of OE is respectively 58 days, 64cm,
12.4cm、60。
Heading period, plant height, spike length and the number of grain per ear that number is RNAi1 are respectively 108 days, 86.7cm, 17.5cm,
112。
Heading period, plant height, spike length and the number of grain per ear of the corresponding wild type Nipponbares of RNAi be respectively 117 days,
111.8cm、22.4cm、170。
The above result shows thatDH1The albumen of coding is related to rice ear sprouting period, when which leads to Rice Heading
Between postpone, plant height increases, and grain number per spike increases, and interferes the expression of the gene that rice ear sprouting period is caused to shift to an earlier date, plant height become short, fringe grain
Number is reduced.
<110>Institute of Crop Science, Chinese Academy of Agricultural Science
<120>Rice ear sprouting period GAP-associated protein GAP and its encoding gene and application
<160>2
<210> 1
<211> 1068
<212> DNA
<213>Rice (Oryza sativa)
<400> 1
1 ATGGGGAAGA AGAAGAAGCG CGTGGAGAAG GTGTTCTGCT ACTACTGCGA CCGCGAGTTC
61 GACGACGAGA AGATCCTCGT GCAGCACCAG AAGGCCAAGC ACTTCAAGTG CCACGTCTGC
121 CACAAGAAGC TCTCCACCGC CGGCGGCATG GCCATCCACG TCCTCCAGGT CCACAAGGAG
181 TCCGTCACCA AGGTTCCCAA TGCAAAGCCT GAGAGGGAAT CAACAGAGAT TGAGATCTTT
241 GGGATGCAAG GGATTCCTCC AGATGTGTTG GCCGCCCACT ATGGAGAAGA GGAAGACCCT
301 TCATCGAAGG TAGCCAAAGT GGAAGTGCCA TCGCTAAGGC CTCCTGTTAT GCCCAATCCA
361 GCGGGCATGG TATATCCTCC ACGACCGGCC TATGGTGTAG CTCCACCTAT GTATAACCCT
421 GCACTGAATC CATTGATGGC CAGACCTCCA ATCTGGCCTG CTCCACCTCC GCAACCTTGG
481 TTTACACAAC CAGTAGTTTC GGTTCCTCAA ATGGCTTCTG GGCTTGCACC ACAACAGCCA
541 CTATTTCCAA TTCAAAACAT GCCTGCTCCT ATGACATCAG CACCTGCAAA TTTACTTCAG
601 ACTTCGTTCC CTATGGCCCA TGTTGGAGTA CCTTCACCTG TTACCCCTCA GGTGTCACAA
661 CCTCTCTTTC CTGTCAGTAC ATCTGCTGGA AACGGTGCAG TAAGTTCTCC ATATGTAGCA
721 TCTGTTGCAC CTGGAAGCAT CCCAACAAGC TCTCCATCAG TTGCTCCTGC AGGAGTAGGA
781 TATGCAGCTA CTAACCAAGG TACAGGAGGT CCAGCGGCTG TACCTCCACC CGCTTCTAAT
841 AATAAAGCAC CAGCCACCCA ACCTGGTGCA AATGAAGTCT ATCTGGTGTG GGATGATGAA
901 GCAATGTCAA TGGAGGAAAG AAGATTGTCG CTACCCAAGT ATCAGGTGCA TGATGAAACT
961 AGCCAGGTAA GTTCTGATTT TTATAATTTT ATATCTGTAA TATTAATGAT ATGTGAAAAA
1021 AACCAAGTTG AAGTTCATGG GGATGCTCTG AACTGGAATA TTGTGTAA
<210> 2
<211> 355
<212>Protein sequence
<213>Rice (Oryza sativa)
<400> 2
1 MGKKKKRVEK VFCYYCDREF DDEKILVQHQ KAKHFKCHVC HKKLSTAGGM AIHVLQVHKE
61 SVTKVPNAKP ERESTEIEIF GMQGIPPDVL AAHYGEEEDP SSKVAKVEVP SLRPPVMPNP
121 AGMVYPPRPA YGVAPPMYNP ALNPLMARPP IWPAPPPQPW FTQPVVSVPQ MASGLAPQQP
181 LFPIQNMPAP MTSAPANLLQ TSFPMAHVGV PSPVTPQVSQ PLFPVSTSAG NGAVSSPYVA
241 SVAPGSIPTS SPSVAPAGVG YAATNQGTGG PAAVPPPASN NKAPATQPGA NEVYLVWDDE
301 AMSMEERRLS LPKYQVHDET SQVSSDFYNF ISVILMICEK NQVEVHGDAL NWNIV
Claims (10)
1. a kind of albumen, the protein being made of the amino acid sequence shown in SEQ ID NO.2.
2. encoding the DNA molecular of albumen described in claim 1, preferably described DNA molecular is that code area is sequence 1 in sequence table
Shown DNA molecular.
3. DNA described in application of the DNA molecular as claimed in claim 2 in plant heading stage is regulated and controled, preferably inhibition or silence
Expression of the molecule in plant.
4. application according to claim 3, it is characterised in that：When the regulation and control plant heading stage is plant heading in advance
Between.
5. application according to claim 3 or 4, it is characterised in that：The plant is dicotyledon or monocotyledon；
The monocotyledon is specially further rice.
6. according to claim 3 to 5 any one of them application, it is characterised in that：Described in the inhibition or silence claim 2
DNA molecular expression is that recombinant vector is converted the plant to realize, wherein, the recombinant vector is by DNA fragmentation 1 and DNA pieces
Section 2 is inserted into binary expression vector, the recombinant vector of protein expression described in obtained inhibition or silence claim 1；It is described
The code area of the code area of DNA fragmentation 1 and the DNA fragmentation 2 reverse complemental each other；The nucleotide of 1 code area of DNA molecular
Sequence is SEQ ID NO.1 from -530 nucleotide in 5 ' ends the 141st.
7. application according to claim 6, it is characterised in that：It is the expression for making the DNA molecular in plant.
8. recombinant vector, transgenic cell line or recombinant bacterium containing recombinant vector：The recombinant vector is by 1 He of DNA fragmentation
DNA fragmentation 2 is inserted into binary expression vector, the recombinant vector of protein expression described in obtained inhibition or silence claim 1；
The code area of the code area of the DNA fragmentation 1 and the DNA fragmentation 2 reverse complemental each other；The core of 1 code area of DNA molecular
Nucleotide sequence is SEQ ID NO.1 from -530 nucleotide in 5 ' ends the 141st.
9. recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing DNA molecular described in claim 2.
10. albumen described in claim 1, DNA molecular described in claim 2 or recombinant vector described in claim 8, expression cassette,
The application of transgenic cell line or recombinant bacterium in plant heading stage is regulated and controled；
The regulation and control plant heading stage is delay plant heading period；
The plant is dicotyledon or monocotyledon；The monocotyledon is further rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611178250.XA CN108218967B (en) | 2016-12-19 | 2016-12-19 | Rice heading stage related protein and coding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611178250.XA CN108218967B (en) | 2016-12-19 | 2016-12-19 | Rice heading stage related protein and coding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108218967A true CN108218967A (en) | 2018-06-29 |
| CN108218967B CN108218967B (en) | 2020-08-14 |
Family
ID=62650730
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611178250.XA Expired - Fee Related CN108218967B (en) | 2016-12-19 | 2016-12-19 | Rice heading stage related protein and coding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108218967B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111072760A (en) * | 2019-12-17 | 2020-04-28 | 西南大学 | EjFRI gene for delaying loquat flowering time and encoding protein and application thereof |
| WO2022188287A1 (en) * | 2021-03-10 | 2022-09-15 | 中国农业科学院作物科学研究所 | Protein for shortening heading stage of rice, and encoding gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006076423A2 (en) * | 2005-01-12 | 2006-07-20 | Monsanto Technology, Llc | Genes and uses for plant improvement |
| CN101353376A (en) * | 2008-08-22 | 2009-01-28 | 中国科学院遗传与发育生物学研究所 | Protein related to rice ear sprouting period and encoding genes and uses thereof |
| CN104098662A (en) * | 2013-04-10 | 2014-10-15 | 中国农业科学院作物科学研究所 | Rice drought resistance related protein, coding gene and application thereof |
-
2016
- 2016-12-19 CN CN201611178250.XA patent/CN108218967B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006076423A2 (en) * | 2005-01-12 | 2006-07-20 | Monsanto Technology, Llc | Genes and uses for plant improvement |
| CN101353376A (en) * | 2008-08-22 | 2009-01-28 | 中国科学院遗传与发育生物学研究所 | Protein related to rice ear sprouting period and encoding genes and uses thereof |
| CN104098662A (en) * | 2013-04-10 | 2014-10-15 | 中国农业科学院作物科学研究所 | Rice drought resistance related protein, coding gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| NCBI: "PREDICTED：Oryza sativa Japonica Group protein SUPPRESSOR OF FRI 4 （LOC4347855），transcript variant X1， mRNA", 《GENBANK DATABASE》 * |
| NCBI: "PREDICTED：protein SUPPRESSOR OF FRI 4 isoform X1 [Oryza sativa Japonica Group]", 《GENBANK DATABASE》 * |
| SANG YEOL KIM 等: "SUPPRESSOR OF FRI 4 encodes a nuclear-localized protein that is required for delayed flowering in winter-annual Arabidopsis", 《DEVELOPMENT》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111072760A (en) * | 2019-12-17 | 2020-04-28 | 西南大学 | EjFRI gene for delaying loquat flowering time and encoding protein and application thereof |
| CN111072760B (en) * | 2019-12-17 | 2021-03-26 | 西南大学 | EjFRI gene for delaying loquat flowering time and encoding protein and application thereof |
| WO2022188287A1 (en) * | 2021-03-10 | 2022-09-15 | 中国农业科学院作物科学研究所 | Protein for shortening heading stage of rice, and encoding gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108218967B (en) | 2020-08-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113337520B (en) | Upland cotton GhA0749 and GhD0744 transcription factors and application thereof in flowering regulation | |
| CN109385431B (en) | Application of OsERF2 gene in regulation and control of rice grain size | |
| CN103014035B (en) | Tumorous stem mustard stress-resistant gene, plant expression vector, construction method and application thereof | |
| WO2022188288A1 (en) | Protein related to rice nitrogen absorption and transformation, encoding gene thereof and application thereof | |
| CN110643630A (en) | Application of KNAT1 gene in improving salt stress resistance of plants | |
| CN104328127B (en) | Tumorous stem mustard stress resistance gene BjEFh1 as well as plant expression vector and application thereof | |
| CN108218967A (en) | Rice ear sprouting period GAP-associated protein GAP and its encoding gene and application | |
| CN101541966B (en) | Antisense DNA of sweetpopato expansin cDNA and method for increasing storage root yield using the same | |
| CA3038869A1 (en) | Growing strawberry plug plants at low elevation without the need for conditioning | |
| WO2014007396A1 (en) | Wheat with increased grain-bearing number and method for producing same, and chemical for increasing grain-bearing number of wheat | |
| JP2010517528A5 (en) | ||
| Kiyoharu | Tissue culture and genetic engineering in rice | |
| CN103665129B (en) | One kind of plant associated protein TaMYB72 at heading stage and application thereof | |
| CN102177241A (en) | Nitrogen use efficient transgenic plants | |
| CN106086063B (en) | RNAi vector constructed based on isocaudarner and application thereof | |
| CN117586369B (en) | ScFT2 protein for delaying flowering or prolonging growth period, and encoding gene and application thereof | |
| CN110904106A (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN104098662A (en) | Rice drought resistance related protein, coding gene and application thereof | |
| CN104558132B (en) | Peanut DELLA gene families and its encoding gene and application | |
| CN116376964B (en) | Gene for regulating low-temperature germination of rice and application thereof | |
| CN113308489B (en) | Creation method of novel salt-tolerant oat germplasm | |
| CN112391403B (en) | Application of TGW10 gene in improvement of crop grain type traits | |
| WO2022188289A1 (en) | Applications of osdreb1c and encoding gene thereof in improving photosynthetic efficiency of rice | |
| CN110964735B (en) | Application of rice gene OsHXK9 in regulation and control of seed dormancy | |
| CN109097369B (en) | Application of rice OsRacD gene in improvement of rice panicle length |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200814 Termination date: 20211219 |