CN112391403B - Application of TGW10 gene in improvement of crop grain type traits - Google Patents

Abstract

The invention belongs to the technical field of gene editing, relates to a method for improving grain shape traits, and particularly relates to application of a rice TGW10 (ground grain weight 10) gene in the aspect of improving rice grain length traits. The invention utilizes CRISPR/Cas9 technology to edit thousand-grain weight gene TGW10 from japonica rice Nipponbare (O.sativa.) at fixed points so as to improve the grain type character of rice. The cloned negative regulation grain type gene TGW10 encodes an RBP containing two RRMs, belongs to the RBP-J type, and regulates grain length by limiting the length of rice glume cells; knocking out the RBP-J gene using CRISPR/Cas9 technology results in cell elongation and enlargement, thereby increasing grain weight.

Description

Application of TGW10 gene in improvement of crop grain type traits

Technical Field

The invention belongs to the technical field of gene editing, relates to a method for improving grain shape traits, and particularly relates to application of a rice TGW10 (ground grain weight 10) gene in the aspect of improving rice grain length traits.

Background

The literature states that rice is one of the major food crops in the world, more than half of the world population has rice as staple food, and scientists expect food demand to double in 2050. In the past 50 years, the rice yield has been greatly increased due to the discovery of semi-dwarf lines and the development of hybrid rice. However, in some regions, including china, the loss of farmable fields and the further increase in population make it appear that the increase in rice production is still standing and even severely food-deficient, and researchers in this field have focused on and met the ever-increasing food demand by exploring new genetic resources and developing more efficient research and application strategies.

Research shows that the rice yield is mainly determined by effective tillering number, grain number per ear, thousand-grain weight and setting percentage, wherein the thousand-grain weight character is mainly influenced by grain length, grain width, grain thickness and filling percentage. Meanwhile, the rice grain type is also an important quality character, and has important market value for the shape of rice in different regions. Currently, northern china, japan, korea and korea prefer short round rice, while southern china, the united states and southeast asia prefer long and thin rice; these yield traits are all Quantitative Traits (QTL) and are controlled by several genes with different effects and are also influenced by the surrounding growth environment. In recent years, some rice grain type QTL have been researched and cloned, but the QTL is rarely widely applied by breeding workers.

The prior art discloses a method for separating and cloning positive control yield character genes, which generally adopts a positioning and cloning technology, then adopts a constitutive expression vector or a tissue specificity expression vector to introduce target genes into target varieties, and for negative control genes, RNAi interference or CRISPR/Cas9 is used for knocking out the target genes so as to obtain the improvement of specific economic characters or stress resistance characters of crops. The RBPs discovered at present mainly comprise domains such as RNA Recognition Motifs (RRMs), K homology domains, zinc fingers, DEAD/DEAH boxes, pulimio/FBF domains, and pentatricopeptide repeat domains, and the domains play an important role in regulating gene transcription and post-transcriptional processing. In plants, RBPs have modular glycine, arginine and serine rich accessory domains and a series of choreographies exist. RBP plays an important role in metabolic pathways such as mRNA synthesis, maturation, transport, signal localization and stability. Cytoplasmic mRNA is processed synthetically in the nucleus, while cis-and trans-acting factors regulate mRNA localization, stability and translation. The trans-acting factor contains RBP, binds to related mRNA and other interacting factors, forms a ribosomal protein complex and is finally exported to the cytoplasm. Although the complex is dynamic, some RBP modules recruited in the nucleus of the cell still interact with mRNA, and research has found that the biological feature can be found at the translation site; this is the reason for heterogeneous ribosomal proteins, and RBPs can be involved in one or more of the processing of nuclear and cytoplasmic RNA, including splicing, maintenance, localization, and translation of RNA. In fact, many RBPs have been reported to have multiple roles within the cell, and such functional diversity is dependent to some extent on the number of RNA-binding domains involved.

At present, no report about the participation of plant RBP-J gene in the formation of yield traits and the improvement of the yield traits is available.

Based on the current situation of the prior art, the inventors of the present application intend to provide a method for improving the grain shape trait, and particularly relate to the application of the TGW10 (rice TGW 10) gene in rice in improving the grain length trait.

The research team clones a gene TGW10 for negatively regulating the rice grain type from Nipponbare by a reverse genetics method, and after the TGW10 gene is knocked out, grains grow and thousand seed weight increases. This gene, which results in the coding of an RNA binding protein RBP (RNA binding protein), named RBP-J, is located on chromosome 10, and has the gene number LOC _ Os10g33230, and is named TGW10 (bound grain weight 10) according to its function.

The negative regulation grain type gene TGW10 cloned by the application codes an RBP containing two RRMs, belongs to the RBP-J type, and regulates grain length by limiting the length of rice glume cells; knocking out the RBP-J gene using CRISPR/Cas9 technology results in cell elongation and enlargement, thereby increasing grain weight.

Disclosure of Invention

The invention aims to provide a method for improving grain type traits based on the current state of the prior art, in particular to application of a rice TGW10 (wheat grain weight 10) gene in improving the grain type traits of crops, especially in improving the grain length traits of rice.

The invention clones a gene TGW10 for negatively regulating the rice grain type from Nipponbare by a reverse genetics method, and after the TGW10 gene is knocked out, grains grow and thousand kernel weight increases. This gene results in the coding of an RNA binding protein RBP (RNA binding protein), specifically named RBP-J, located on chromosome 10, with the gene number LOC _ Os10g33230, which is designated TGW10 (located grain weight 10) according to its function.

The negative regulation grain type gene TGW10 cloned by the application codes an RBP containing two RRMs, belongs to the RBP-J type, and regulates grain length by limiting the length of rice glume cells; knocking out the RBP-J gene using CRISPR/Cas9 technology results in cell elongation and enlargement, thereby increasing grain weight.

In particular, the method comprises the following steps of,

the application of the rice TGW10 gene in the aspect of improving the rice grain type character is characterized in that the CRISPR/Cas9 technology is used for editing the TGW10 gene in Nipponbare (Nipponbare) japonica rice varieties at fixed points so as to improve the rice grain type character.

In the invention, japonica rice Nipponbare (Nipponbare) is used as a gene editing receptor, and a CRISPR/Cas9-TGW10 fixed-point editing vector is constructed for transformation to obtain a TGW 10-knocked gene editing plant.

More specifically, the present invention is to provide a novel,

in the present invention, it is included that,

1) TGW10 gene and protein structure composition

The Rice TGW10 gene, the accession number of Rice Genome Annotation Project (Rice Genome Annotation Project) website is LOC _ Os10g33230, the full length of the accession gene sequence is 5338bp, and the sequence is shown as SEQ.ID NO 1; the full-length CDS consists of 2 exons, the normally coded cDNA has the length of 1395bp, and the sequence is shown as SEQ.ID NO 2; codes 465 amino acids, and the sequence is shown in SEQ.ID NO3;

the structure of the gene and the protein coded by the gene are as follows:

the structure of the rice TGW10 gene is shown in figure 1, and the structure of the protein is shown in figure 2;

2) Construction of TGW10 gene knockout vector CRSPR/Cas9-TGW10

Constructing a rice U6 promoter of a CRISPR/Cas9 vector BGK032 by using a first exon 20bp of a TGW10 gene from japonica rice Nipponbare as a target sequence to obtain a CRISPR/Cas9-TGW10 knockout vector of the TGW10 gene (the vector construction is shown in figure 3);

3) CRISPR/Cas9-TGW10 transformation experiment

After shelling and disinfecting mature Nipponbare seeds, inoculating the seeds on a dedifferentiation plant tissue culture medium to induce callus, after inducing the callus for 2-3 weeks, adopting an agrobacterium transformation method to introduce CRISPR/Cas9-TGW10 plasmid DNA into agrobacterium EH105 competent cells, transforming the callus by using a dip dyeing method, transferring the transformed callus to an MS culture medium added with 30ppm hygromycin after co-culture for continuous culture for 3-4 weeks to screen a resistant cell line, and then transferring the screened cell line to a differentiation culture medium to induce sprouting and rooting;

4) Transplanting of transformation-treated test-tube plantlets and molecular detection of transformed plant progeny

Transplanting the transformed test-tube plantlet of Nipponbare into the field, extracting DNA from leaves in the tillering stage, performing molecular detection by adopting PCR amplification technology, and obtaining a positive T0 generation plant in 2016 summer; in 2016, breeding in Hainan island to obtain transgenic T1 generation, and obtaining 5 strains in total;

5) PCR sequencing detection of knock-out Nipponbare (Nipponbare) plants

Whether the target allele TGW10 is knocked out in Nipponbare (Nipponbare) or not, sequencing primers are designed on two sides of a target region, PCR sequencing is carried out, and the detection result of knocked-out offspring is shown in figure 4;

6) TGW10 knock-out line T ₂ Survey and statistics of generation population yield traits

T-knockout of TGW10 ₂ The generation lines are planted in a test field of a university of Compound Dan, 30 lines are planted in each line of 3 lines, the row spacing is 6 inches multiplied by 6 inches, the three times are repeated, and simultaneously, japonica rice Nipponbare (Nipponbare) parent control is established. The grain length, grain width and grain thickness of 20 individual plants of each strain are counted in the maturation period, the average value is calculated, and the statistical results are shown in table 1:

TABLE 1

Line of plants	Grain length (mm)	Grain width (mm)	Particle thickness (mm)
				rbp-j-1	8.027±0.150	2.980±0.231	2.105±0.056
rbp-j-2	8.102±0.201	3.043±0.145	2.105±0.010
				rbp-j-3	8.031±0.113	3.054±0.102	2.186±0.076
Nipponbare	7.300±0.195	3.255±0.135	2.230±0.102

The changes of the rice TGW10 knockout plant in the traits of grain length, grain width and grain thickness are shown in FIG. 4.

According to the field survey and the seed test data, compared with the control, the grain length of the TGW10 knockout Nipponbare (Nipponbare) line is better than that of the control, and the grain length is increased by about 10.32%.

The invention provides an application of a rice TGW10 (wheat grain weight 10) gene in the aspect of improving the rice grain length property, which has the advantages that: editing thousand grain weight gene TGW10 in Nipponbare (O.sativa.) at fixed points by CRISPR/Cas9 technology to improve the grain type character of rice; according to the invention, the grain length is regulated by limiting the length of the rice glume cells, and RBP-J genes are knocked out by using a CRISPR/Cas9 technology, so that the cells are elongated and enlarged, and thus the grain weight is increased.

Drawings

FIG. 1 shows the structure of TGW10 gene of rice.

FIG. 2 shows the protein structure of rice TGW10 gene.

FIG. 3 is the structure diagram of rice TGW10 gene knock-out vector.

FIG. 4 genotype and phenotype comparison of TGW10 knock-out lines.

FIG. 5 comparison of the phenotype of the whole strain of TGW10 knock-out strain.

FIG. 6 is the result of genetic transformation, wherein

1) Is callus induction and subculture, including induction day one: induction for one week: callus subculture;

2) Is an agrobacterium culture, comprising, dark culture at 28 ℃ for 2 days and co-culture 1: co-culturing 2;

4) Is a screening culture, including screening day 1; screening day 10; screening day 15; screening for 21 days;

5) Is regeneration of differentiation, including, day 1 of differentiation: day 7 of differentiation; day 15 of differentiation; day 25 of differentiation;

6) Is the rooting of the seedling.

Detailed Description

Example 1

1. Vector construction

1. Designing a gRNA target sequence: selecting a target sequence CCGCCTACGGCGACGTCTCCCAG (an identification sequence is 20bp, and a red CCG is a PAM sequence), and synthesizing Oligo according to the following steps;

UP：5‘-TGTGTGCCTACGGCGACGTCTCCCAG

LOW:5’–AAACGGATGCCGCTGCAGAGGGTCCA

2. preparation of Oligo dimer: dissolving the synthesized Oligo in water to 10 μ M, mixing according to the following reaction system, heating at 95 ℃ for 3 minutes, and then slowly reducing to 20 ℃ at about 0.2 ℃/second;

3. construction of Oligo dimers into CRISPR/Cas vector: mixing the components on ice according to the following reaction system, and reacting for 1 hour at room temperature (20 ℃) after uniformly mixing;

4. and (3) transforming escherichia coli: adding 5 μ l of the reaction solution into at least 50 μ l of competent cells, mixing, and standing in ice bath for 30min (without shaking, keeping standing strictly); gently taking out, thermally shocking at 42 ℃ for 60 seconds, and immediately placing on ice for 2 minutes; adding 500. Mu.l of SOB/LB, and culturing at 37 ℃ and 200rpm for 1 hour; coating a proper amount of bacterial liquid on an LB (lysogeny Broth) plate containing kanamycin, and inverting at 37 ℃ for overnight culture;

2. genetic transformation

1) Callus induction and subculture

Selecting mature rice seeds (preferably newly harvested seeds in the same year), peeling glumes, pouring into a 50ml centrifuge tube, adding 75% ethanol for disinfection for 1min, pouring off the ethanol, washing with sterile water once, pouring off, adding 30% sodium hypochlorite for disinfection for 20min, pouring off the sodium hypochlorite, and washing with sterile water for 5-6 times. Absorbing excessive water with a liquid-transfering gun (which can be dried with sterilized filter paper), transferring the seeds to an induction culture medium, wherein 20-25 seeds are placed in each dish;

the callus can be directly transformed by the protoembryo after growing out, small particles growing beside the protoembryo can be picked to a new induction culture medium for subculture, and can be transformed when growing to a proper size; the results are shown in fig. 6, including induction day one: induction for one week: callus subculture:

2) Agrobacterium culture

Agrobacterium EHA105 containing the gene vector of interest was streaked on plates containing the corresponding antibiotic and cultured in the dark at 28 ℃ for 2 days, and the results are shown in FIG. 6, including co-culture 1: co-culturing 2;

3) Infection with Agrobacterium

Preparing AAM staining solution, adding AS (1000 times dilution), selecting enough callus with good callus state, bright yellow color, mellow and hard texture, and diameter of granule of about 3mm, washing off Agrobacterium on the plate by sucking AAM with pipette, adjusting thallus concentration to OD ₆₀₀ 0.3-0.5, namely the agrobacterium suspension for co-culturing and transforming rice.

Selecting enough amount of callus (good callus state, bright yellow color, mellow and hard texture, and proper particle diameter of about 3 mm) and placing into a 100ml sterile triangular flask, adding appropriate amount of Agrobacterium suspension (enough bacterial liquid is ensured to contact with the material), standing at room temperature for 20min, and shaking. Pouring out the bacteria solution, placing the callus on sterile filter paper, absorbing the redundant bacteria solution, immediately transferring to a solid co-culture medium paved with a layer of sterile filter paper, and culturing for 3 days at 26 ℃ in the dark;

4) Screening culture

Cleaning the callus after 3 days of co-culture, namely, sowing the callus on the co-culture medium into a sterilized triangular flask by using a 1ml blue gun head, adding sterile water to wash the two sides of the sterilized triangular flask, washing the sterilized flask once by using sterile water containing 500ul/L carbenicillin for the third time, transferring the callus onto sterile filter paper after absorbing excessive water by using a liquid transfer gun, blowing the water on the callus by using wind of an ultra-clean bench, controlling the blowing time to be about 30min, transferring the callus onto a screening culture medium after the callus is dried for screening culture under the condition of 28-30 ℃, carrying out dark culture, and carrying out screening for 3-4 weeks; the results are shown in fig. 6, including screening day 1: screening day 10; screening day 15;

screening for 21 days;

5) Differentiation and regeneration

After one month of screening, the color is bright yellow, and positive callus with the diameter of 1-2mm grows out, at the moment, the positive callus can be picked on a differentiation medium for differentiation and regeneration. Each differentiation dish was placed with 16 positive calli and placed in a 28-30 ℃ greenhouse for culture under illumination. Generally, green spots can emerge from the calluses in about 10 days, and seedlings can be differentiated in about 10 days; results are shown in fig. 6, including, day 1 of differentiation; day 7 of differentiation; day 15 of differentiation; day 25 of differentiation;

6) Rooting of seedlings

When the differentiated seedlings grow to about 2-3cm and have obvious root systems, the seedlings can be transferred to a rooting culture medium to grow, the rooting culture medium is poured into a higher bottle or tube, the rooted seedlings have enough space length and are cultured under the rooting culture condition of 28-30 ℃ in sterile illumination; results the results are shown in FIG. 6;

3. molecular identification

1. DNA extraction

2. PCR and electrophoresis

3. And (5) sequencing and analyzing.

Test results show that thousand grain weight gene TGW10 in Nipponbare (O.sativa.) can be edited at fixed points by CRISPR/Cas9 technology, and the grain type character of rice can be improved; the grain length is regulated by limiting the length of rice glume cells, and RBP-J genes are knocked out by using a CRISPR/Cas9 technology, so that the cells are elongated and enlarged, and the grain weight is increased.

Sequences related to the invention

SEQ ID NO.1: rice TGW10 gene full-length sequence

LOC_Os10g33230

ACCTCCCCTCCCCGACGCCGAAATCCCCCAAATTCCACCCCCGCCTCCTCCTCCTCCTCGCGTCGCGAGAGAATCCGAGGCGCGCGAGCGAGAGGAAGGAGAGAAGGTGAGAGCAGCGGCGGAGGGAGGAGATGGAGTCGGATCAGGGGAAGCTGTTCATCGGCGGCATCTCGTGGGAGACCACCGAGGAGAAGCTCCGCGACCACTTCGCCGCCTACGGCGACGTCTCCCAGGCCGCCGTCATGCGCGACAAGCTCACCGGCCGCCCCCGCGGCTTCGGCTTCGTCGTCTTCTCCGACCCTTCCTCCGTCGACGCCGCCCTCGTCGACCCCCACACCCTCGACGGCCGCACGGTATCCCCTCTCAAACCCTAGCGAATATTCGCGTTGGATTCCCTCCTCTCAAGGTTCGGTTCGGTTCGGTTTCGTAGGTTGATGTGAAGCGGGCGCTCTCGCGGGAGGAGCAGCAGGCCGCGAAGGCGGCGAACCCTAGCGCGGGGGGGAGGCACGCCTCCGGTGGGGGCGGTGGTGGGGGAGGCGCCGGTGGTGGTGGTGGTGGCGGCGGTGGTGACGCCGGCGGTGCGCGGACGAAGAAGATCTTCGTCGGCGGGCTGCCCTCCAACCTGACGGAGGACGAGTTCCGGCAGTACTTCCAGACCTACGGGGTCGTCACCGACGTCGTCGTCATGTACGACCAGAACACGCAGCGGCCGAGGGGGTTCGGGTTCATCACCTTCGACGCGGAGGACGCCGTTGACCGCGTGCTGCACAAGACCTTCCATGACCTGAGCGGGAAGATGGTGGAGGTGAAGCGCGCCCTGCCCAGGGAGGCCAACCCTGGCTCCGGCAGTGGTGGCCGTTCCATGGGAGGCGGCGGTGGGGGTTACCAGAGTAACAATGGGCCGAACTCCAATTCTGGGGGCTATGATAGCAGAGGTGACGCTAGCAGGTATGGTCAGGCGCAGCAGGGTAGTGGTGGTTATCCCGGTTATGGTGCTGGAGGATATGGTGCTGGTACGGTTGGTTATGGATATGGGCATGCTAACCCTGGAACTGCGTATGGGAATTATGGGGCTGGAGGATTTGGAGGTGTTCCTGCTGGGTATGGTGGGCATTATGGCAATCCAAATGCGCCTGGTTCAGGTTACCAGGGTGGTCCTCCAGGAGCAAACAGAGGACCATGGGGTGGTCAAGCTCCGTCTGGTTATGGCACTGGGAGTTATGGTGGCAATGCAGGCTATGCTGCTTGGAACAACTCTTCTGCTGGAGGTAATGCACCCACTAGTCAGGCCGCTGGTGCAGGCACAGGCTATGGGAGCCAGGGCTATGGATATGGTGGATATGGAGGAGATGCATCGTATGGTAATCATGGTGGATATGGGGGTTATGGAGGAAGGGGAGATGGTGCTGGCAATCCAGCTGCTGGCGGTGGATCTGGGTATGGTGCTGGCTATGGAAGCGGGAATGGCGGTTCTGGTTATCCAAATGCTTGGGCTGATCCTTCACAAGGTGGAGGGTTTGGGGCTTCAGTCAATGGAGTGTCTGAAGGCCAATCAAATTATGGCAGTGGTTATGGTGGTGTGCAACCTAGGGTTGCTCAGTAAATGAGGCCATTAGAGCATCTATGAGATGAACCAGCAAAATTGGGCAGTCTATGTATGTTGTGTTACCCTGGCCCCTCTGATTGCTTTTGGCCTCTTGAAGATCTCCCATTTGCTGGTTAAATCAGTATTTCTCCGGGTTGGAATGCTTGAACCTTTTGCGGCTTACTACTAGAATGTAGTCAATAACTAGCTTCTAGCTATACTATGGAGTAGCTGTATCTTGCGTAATGCTTTATTTAAGTTTAGCCTTATCTGTCGGTGTGCTTTGTCATGAGTGGAATTTCAGTTGCTTCGTCTCTAGTTTAAAGCTAGAGTAGCTTCACTACTTATGGACAACAAACTATCTAGTTGTACCTTTATTCTACAGAATCATATGTTTGTGGTTGACAGTAGTATTTATGCTGGATTGTGCTTTACCTGAATCTGAAATGTTCTATCTTTGGTTGTTTCTCTGTGGTGTGCTCTAGCTCACCTTGCAGTTAAGGTGCTGTTGCGTATTATTCCATTAATATTGATTGTAACAGATGACAATCCTCAAACTTCTATGCAGTGATAGAGGTGTTTTATACTGTAGCTGCTTCTAGCAGTAAGTTCAGGTGTAGTGCAAGTGCTTTTCATGTCATTGGAATGATATATCATTAAAGTATGTGGTCGAGCTATGAGTATGTTTCTGATATTTGGTATGTAGATGGATAAACAAGCATAGTAGAGGCAAACAATTAGCCCCTACCTGAAGCAATAAGAGCATATTAGCAGCAAGTTGGTAGCGCCAATTTCTAAGGTAGTATAGATACAGAGAAGTCTGTGATACTACTTGATGAATGAAATACAGGTAGAAACCATAGAGTAGAATACTCCAGGCATTTGGCAAGCAAAATAATCATCCTTCCTCGTACATTTCCTTTCTGTACAGGTTGGATGCGATGCCATTTCCTTTTAGAGCATGTCCAAGTGGGGCCTTTTGAATCAACTGCCTGGCTGCCTGAGAAATGGCAGAGACATCGACTGATTTTGCTTGATGGGCTGACGATTTCCAATCTTGAAGCATTTGACACAGAAAGCAAGCATCTTGTTTTTAAGCGCTTCATTTTCTGAAGGATCTTGTGCTGTGCAACAAGATGGTGGTATGTGGAATCATGTTTCACTTTCAGTTTTATTTGGAAAAGAAAAGCATTTTCACCATGGTACTTGTACCAGGAAAGTTGTTCAAGATGCTATCTGTCCTCATTTTCCGTTCAATTTAGTAAATGGTATATTATAGTTGAAAGAAAGCATTACCAGCTACCATAGGAAGTATTATGTTTTCATTCAAAATCTTGTCAATTTTGGCCAGAGTTCCATCCCCAATGTACAGATCGACAATGGTGAATTACTATCAGTTTAGTAAATAATAATAAATTAGAAGGTTTTTCAAAAGAATAATTCCATGATCTAATGTATGTTTTTACCTTTTTAGATACGCATATTTGCTAGTAAAACTAGTGATGAAAGTTGTGTCATGGAGATCTAGGAAAAGAACAACACTTGTATACCTAGAGGTGATGCATTTTTTGAAAATCTGTTTTACTGGCTTAACAAATTTAGTCACTAATAAAACTAGTGATGAAAGTTGTGTCATGGATTAGTGCACAAGTTTTGCAAACAGAATTTGGCTTAAACAAACAGTTTGGATGAGTAATTCCTTAACTTTTTCCCCTTATTTACTAAATTGATGAGCATGATTTAAGTTGTACTTACAGTCTTGCACACTGGCATGATGTTTTACAAGTTTTTGGAAGTACTGGAAACCTAGGATCCAATATCCTAGTTTGAGAAAACAACACTCATATTGCTTGTTCCTGTTAATAAGCCTGGGTAGCATGTTCATCGCTCAGCTATGCCTTGCTCGGTTGCTATTGTTGGATGGATAGAAGTGGAAAAAAGGGGGGGGAGGGAATCAGTCTATGATTATATACTTGTATGGTTCAATGTAGATTAAAATCCAAGGCTTTGACTTAAGGTTCCTACACTTATGTACTTCATTGCAAATTTAACTGTGCATATAGTACATTACTAGCCAAGGTAGTCAATACTCAATAGTATTATATATTTCTTCATATTGAATAAGGCTCGCTTCATAGCTTAACATATATGTACCACAATTTTATTGTCCACTACATTATATAGTACATAATCACAATTGCTTACCACTTGCTGTTTCTTGACTATTAAACTATTTAGATTAAAATGACCAATATTTTCTACCTTCTTTTGCAAATCAGTTTCATTACAGCACTTCTGTTAAACTAAAGGTATACTATAGGGTAGATTTAAGGTTATGTAGTTCTGTTTTGGCGTTTTGTTTGAACCAGTTGGATTAGTATTATGAATCCACATCCTTAGTTTATTTTATTGCAGAACACAAATAGTTGCATGGCTTATGCCTGTTGGAGTTAATAGGTGTTAAGGTAAAACATGTAAGTAAAAAAGGTTCTCCAGGACTTGCAATGATGCACCTGTACACTGGATCAATCTGATGGACCAGTATCTGACTTTAGAAATGACAATAACCACACTGATTTAGGAGACTCAAGAGTCAAGATATTTACTGGGTGGAGAGAGAAAACATTAGTGTTAGATTTAACGGCTAAGCTTTGTGTTTGCATTTAACCATTTGTAAATGTGAAAGCAATACTATTTTTGACAGAAAAATACAATTTTGATTAGTGTATCTCGCACGGTTAACTTGATTAAGATCTAAAATACTGCAACTTCATTTGTACTAACCATTAGATGATTTAGTTGCTCAGTGCCTGTTTGGGACTTCATGTGATATAATAACATAATATAACCAGATCGGCTTATATATTAACCTTGGAGCTCAATCACTAAGTCTTCTTCTGTATTATGACATGGATATTTGGAAATGACCAAGTGCAATTCGATTTACATGTTCTATTTATGCTATTTCTTGGTGTTGCTTTAAAACAACCATTTAAGTAATAGCTATGAGAAATAAATTAGTGCCACTTATTTTTCATGATTTTCAATATATTTTTTGCTTTGTTGCTGTCAAATCTCTTAGTAAACCTGATAAAGATATAAAATTAGAAATTTGACTGCAGATGCCATATATAGTGGATAGCTTTATTACCACACTGGTGCCAAGCAAACCAAGTCATAGTCAGCCAAACATCTTTGATATGTTTTTACTCGAGTATCTGAAATAACCAAACATTTTGGAGATATGTTATCATCATTCTATTGACCTCTTTGCATACCTTGTTTGCATGGTATCAATGCAATGGAATATGCCTTCGAGGACTTTGCTGAAAGATCACCTGCAAGTACATCAAAAATCAAGAGATGATTCTGGCCGCCATGTATTATGACCACAGTGACTCGTGCTCATCCAATATTCTTCGTTTCTCGTATCTTAATGGAAACCCTCACAGTAGCGTTGCCACCTTATATCGAAGGACAAGTTGTTTGAAGTTGGCTACCAATTGGTGCCCTACTTTACCAATTGTCAGATGGAAGGGTTGAGCGTACATTAATCTGGAGATGCTTATCGAGTTTGTTGCATGACAAGTCAATATATTCTATTGATGTGGCCAATATTTGCACGATATGATTTCTTGGCAAGTTTTAGTAACATTTTAACTCATTCTTCCAGACAATAGTGCAAATCGCCGAACTCTCTATTTTACTTGTTTTGTTGTCATGGATGAAAGGTTTGCAAGACTTTGTTCCAGA

SEQ ID NO.2: coding sequence of rice TGW10

LOC_Os10g33230

ATGGAGTCGGATCAGGGGAAGCTGTTCATCGGCGGCATCTCGTGGGAGACCACCGAGGAGAAGCTCCGCGACCACTTCGCCGCCTACGGCGACGTCTCCCAGGCCGCCGTCATGCGCGACAAGCTCACCGGCCGCCCCCGCGGCTTCGGCTTCGTCGTCTTCTCCGACCCTTCCTCCGTCGACGCCGCCCTCGTCGACCCCCACACCCTCGACGGCCGCACGGTTGATGTGAAGCGGGCGCTCTCGCGGGAGGAGCAGCAGGCCGCGAAGGCGGCGAACCCTAGCGCGGGGGGGAGGCACGCCTCCGGTGGGGGCGGTGGTGGGGGAGGCGCCGGTGGTGGTGGTGGTGGCGGCGGTGGTGACGCCGGCGGTGCGCGGACGAAGAAGATCTTCGTCGGCGGGCTGCCCTCCAACCTGACGGAGGACGAGTTCCGGCAGTACTTCCAGACCTACGGGGTCGTCACCGACGTCGTCGTCATGTACGACCAGAACACGCAGCGGCCGAGGGGGTTCGGGTTCATCACCTTCGACGCGGAGGACGCCGTTGACCGCGTGCTGCACAAGACCTTCCATGACCTGAGCGGGAAGATGGTGGAGGTGAAGCGCGCCCTGCCCAGGGAGGCCAACCCTGGCTCCGGCAGTGGTGGCCGTTCCATGGGAGGCGGCGGTGGGGGTTACCAGAGTAACAATGGGCCGAACTCCAATTCTGGGGGCTATGATAGCAGAGGTGACGCTAGCAGGTATGGTCAGGCGCAGCAGGGTAGTGGTGGTTATCCCGGTTATGGTGCTGGAGGATATGGTGCTGGTACGGTTGGTTATGGATATGGGCATGCTAACCCTGGAACTGCGTATGGGAATTATGGGGCTGGAGGATTTGGAGGTGTTCCTGCTGGGTATGGTGGGCATTATGGCAATCCAAATGCGCCTGGTTCAGGTTACCAGGGTGGTCCTCCAGGAGCAAACAGAGGACCATGGGGTGGTCAAGCTCCGTCTGGTTATGGCACTGGGAGTTATGGTGGCAATGCAGGCTATGCTGCTTGGAACAACTCTTCTGCTGGAGGTAATGCACCCACTAGTCAGGCCGCTGGTGCAGGCACAGGCTATGGGAGCCAGGGCTATGGATATGGTGGATATGGAGGAGATGCATCGTATGGTAATCATGGTGGATATGGGGGTTATGGAGGAAGGGGAGATGGTGCTGGCAATCCAGCTGCTGGCGGTGGATCTGGGTATGGTGCTGGCTATGGAAGCGGGAATGGCGGTTCTGGTTATCCAAATGCTTGGGCTGATCCTTCACAAGGTGGAGGGTTTGGGGCTTCAGTCAATGGAGTGTCTGAAGGCCAATCAAATTATGGCAGTGGTTATGGTGGTGTGCAACCTAGGGTTGCTCAGTAA

SEQ ID NO.3: amino acid sequence of rice TGW10

LOC_Os10g33230

MESDQGKLFIGGISWETTEEKLRDHFAAYGDVSQAAVMRDKLTGRPRGFGFVVFSDPSSVDAALVDPHTLDGRTVDVKRALSREEQQAAKAANPSAGGRHASGGGGGGGGAGGGGGGGGGDAGGARTKKIFVGGLPSNLTEDEFRQYFQTYGVVTDVVVMYDQNTQRPRGFGFITFDAEDAVDRVLHKTFHDLSGKMVEVKRALPREANPGSGSGGRSMGGGGGGYQSNNGPNSNSGGYDSRGDASRYGQAQQGSGGYPGYGAGGYGAGTVGYGYGHANPGTAYGNYGAGGFGGVPAGYGGHYGNPNAPGSGYQGGPPGANRGPWGGQAPSGYGTGSYGGNAGYAAWNNSSAGGNAPTSQAAGAGTGYGSQGYGYGGYGGDASYGNHGGYGGYGGRGDGAGNPAAGGGSGYGAGYGSGNGGSGYPNAWADPSQGGGFGASVNGVSEGQSNYGSGYGGVQPRVAQ*

Sequence listing

<110> Suzhou New Biotechnology Co., ltd

Application of <120> TGW10 gene in improvement of crop grain type traits

<130> 20190813

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5338

<212> DNA

<213> LOC_Os10g33230

<400> 1

acctcccctc cccgacgccg aaatccccca aattccaccc ccgcctcctc ctcctcctcg 60

cgtcgcgaga gaatccgagg cgcgcgagcg agaggaagga gagaaggtga gagcagcggc 120

ggagggagga gatggagtcg gatcagggga agctgttcat cggcggcatc tcgtgggaga 180

ccaccgagga gaagctccgc gaccacttcg ccgcctacgg cgacgtctcc caggccgccg 240

tcatgcgcga caagctcacc ggccgccccc gcggcttcgg cttcgtcgtc ttctccgacc 300

cttcctccgt cgacgccgcc ctcgtcgacc cccacaccct cgacggccgc acggtatccc 360

ctctcaaacc ctagcgaata ttcgcgttgg attccctcct ctcaaggttc ggttcggttc 420

ggtttcgtag gttgatgtga agcgggcgct ctcgcgggag gagcagcagg ccgcgaaggc 480

ggcgaaccct agcgcggggg ggaggcacgc ctccggtggg ggcggtggtg ggggaggcgc 540

cggtggtggt ggtggtggcg gcggtggtga cgccggcggt gcgcggacga agaagatctt 600

cgtcggcggg ctgccctcca acctgacgga ggacgagttc cggcagtact tccagaccta 660

cggggtcgtc accgacgtcg tcgtcatgta cgaccagaac acgcagcggc cgagggggtt 720

cgggttcatc accttcgacg cggaggacgc cgttgaccgc gtgctgcaca agaccttcca 780

tgacctgagc gggaagatgg tggaggtgaa gcgcgccctg cccagggagg ccaaccctgg 840

ctccggcagt ggtggccgtt ccatgggagg cggcggtggg ggttaccaga gtaacaatgg 900

gccgaactcc aattctgggg gctatgatag cagaggtgac gctagcaggt atggtcaggc 960

gcagcagggt agtggtggtt atcccggtta tggtgctgga ggatatggtg ctggtacggt 1020

tggttatgga tatgggcatg ctaaccctgg aactgcgtat gggaattatg gggctggagg 1080

atttggaggt gttcctgctg ggtatggtgg gcattatggc aatccaaatg cgcctggttc 1140

aggttaccag ggtggtcctc caggagcaaa cagaggacca tggggtggtc aagctccgtc 1200

tggttatggc actgggagtt atggtggcaa tgcaggctat gctgcttgga acaactcttc 1260

tgctggaggt aatgcaccca ctagtcaggc cgctggtgca ggcacaggct atgggagcca 1320

gggctatgga tatggtggat atggaggaga tgcatcgtat ggtaatcatg gtggatatgg 1380

gggttatgga ggaaggggag atggtgctgg caatccagct gctggcggtg gatctgggta 1440

tggtgctggc tatggaagcg ggaatggcgg ttctggttat ccaaatgctt gggctgatcc 1500

ttcacaaggt ggagggtttg gggcttcagt caatggagtg tctgaaggcc aatcaaatta 1560

tggcagtggt tatggtggtg tgcaacctag ggttgctcag taaatgaggc cattagagca 1620

tctatgagat gaaccagcaa aattgggcag tctatgtatg ttgtgttacc ctggcccctc 1680

tgattgcttt tggcctcttg aagatctccc atttgctggt taaatcagta tttctccggg 1740

ttggaatgct tgaacctttt gcggcttact actagaatgt agtcaataac tagcttctag 1800

ctatactatg gagtagctgt atcttgcgta atgctttatt taagtttagc cttatctgtc 1860

ggtgtgcttt gtcatgagtg gaatttcagt tgcttcgtct ctagtttaaa gctagagtag 1920

cttcactact tatggacaac aaactatcta gttgtacctt tattctacag aatcatatgt 1980

ttgtggttga cagtagtatt tatgctggat tgtgctttac ctgaatctga aatgttctat 2040

ctttggttgt ttctctgtgg tgtgctctag ctcaccttgc agttaaggtg ctgttgcgta 2100

ttattccatt aatattgatt gtaacagatg acaatcctca aacttctatg cagtgataga 2160

ggtgttttat actgtagctg cttctagcag taagttcagg tgtagtgcaa gtgcttttca 2220

tgtcattgga atgatatatc attaaagtat gtggtcgagc tatgagtatg tttctgatat 2280

ttggtatgta gatggataaa caagcatagt agaggcaaac aattagcccc tacctgaagc 2340

aataagagca tattagcagc aagttggtag cgccaatttc taaggtagta tagatacaga 2400

gaagtctgtg atactacttg atgaatgaaa tacaggtaga aaccatagag tagaatactc 2460

caggcatttg gcaagcaaaa taatcatcct tcctcgtaca tttcctttct gtacaggttg 2520

gatgcgatgc catttccttt tagagcatgt ccaagtgggg ccttttgaat caactgcctg 2580

gctgcctgag aaatggcaga gacatcgact gattttgctt gatgggctga cgatttccaa 2640

tcttgaagca tttgacacag aaagcaagca tcttgttttt aagcgcttca ttttctgaag 2700

gatcttgtgc tgtgcaacaa gatggtggta tgtggaatca tgtttcactt tcagttttat 2760

ttggaaaaga aaagcatttt caccatggta cttgtaccag gaaagttgtt caagatgcta 2820

tctgtcctca ttttccgttc aatttagtaa atggtatatt atagttgaaa gaaagcatta 2880

ccagctacca taggaagtat tatgttttca ttcaaaatct tgtcaatttt ggccagagtt 2940

ccatccccaa tgtacagatc gacaatggtg aattactatc agtttagtaa ataataataa 3000

attagaaggt ttttcaaaag aataattcca tgatctaatg tatgttttta cctttttaga 3060

tacgcatatt tgctagtaaa actagtgatg aaagttgtgt catggagatc taggaaaaga 3120

acaacacttg tatacctaga ggtgatgcat tttttgaaaa tctgttttac tggcttaaca 3180

aatttagtca ctaataaaac tagtgatgaa agttgtgtca tggattagtg cacaagtttt 3240

gcaaacagaa tttggcttaa acaaacagtt tggatgagta attccttaac tttttcccct 3300

tatttactaa attgatgagc atgatttaag ttgtacttac agtcttgcac actggcatga 3360

tgttttacaa gtttttggaa gtactggaaa cctaggatcc aatatcctag tttgagaaaa 3420

caacactcat attgcttgtt cctgttaata agcctgggta gcatgttcat cgctcagcta 3480

tgccttgctc ggttgctatt gttggatgga tagaagtgga aaaaaggggg gggagggaat 3540

cagtctatga ttatatactt gtatggttca atgtagatta aaatccaagg ctttgactta 3600

aggttcctac acttatgtac ttcattgcaa atttaactgt gcatatagta cattactagc 3660

caaggtagtc aatactcaat agtattatat atttcttcat attgaataag gctcgcttca 3720

tagcttaaca tatatgtacc acaattttat tgtccactac attatatagt acataatcac 3780

aattgcttac cacttgctgt ttcttgacta ttaaactatt tagattaaaa tgaccaatat 3840

tttctacctt cttttgcaaa tcagtttcat tacagcactt ctgttaaact aaaggtatac 3900

tatagggtag atttaaggtt atgtagttct gttttggcgt tttgtttgaa ccagttggat 3960

tagtattatg aatccacatc cttagtttat tttattgcag aacacaaata gttgcatggc 4020

ttatgcctgt tggagttaat aggtgttaag gtaaaacatg taagtaaaaa aggttctcca 4080

ggacttgcaa tgatgcacct gtacactgga tcaatctgat ggaccagtat ctgactttag 4140

aaatgacaat aaccacactg atttaggaga ctcaagagtc aagatattta ctgggtggag 4200

agagaaaaca ttagtgttag atttaacggc taagctttgt gtttgcattt aaccatttgt 4260

aaatgtgaaa gcaatactat ttttgacaga aaaatacaat tttgattagt gtatctcgca 4320

cggttaactt gattaagatc taaaatactg caacttcatt tgtactaacc attagatgat 4380

ttagttgctc agtgcctgtt tgggacttca tgtgatataa taacataata taaccagatc 4440

ggcttatata ttaaccttgg agctcaatca ctaagtcttc ttctgtatta tgacatggat 4500

atttggaaat gaccaagtgc aattcgattt acatgttcta tttatgctat ttcttggtgt 4560

tgctttaaaa caaccattta agtaatagct atgagaaata aattagtgcc acttattttt 4620

catgattttc aatatatttt ttgctttgtt gctgtcaaat ctcttagtaa acctgataaa 4680

gatataaaat tagaaatttg actgcagatg ccatatatag tggatagctt tattaccaca 4740

ctggtgccaa gcaaaccaag tcatagtcag ccaaacatct ttgatatgtt tttactcgag 4800

tatctgaaat aaccaaacat tttggagata tgttatcatc attctattga cctctttgca 4860

taccttgttt gcatggtatc aatgcaatgg aatatgcctt cgaggacttt gctgaaagat 4920

cacctgcaag tacatcaaaa atcaagagat gattctggcc gccatgtatt atgaccacag 4980

tgactcgtgc tcatccaata ttcttcgttt ctcgtatctt aatggaaacc ctcacagtag 5040

cgttgccacc ttatatcgaa ggacaagttg tttgaagttg gctaccaatt ggtgccctac 5100

tttaccaatt gtcagatgga agggttgagc gtacattaat ctggagatgc ttatcgagtt 5160

tgttgcatga caagtcaata tattctattg atgtggccaa tatttgcacg atatgatttc 5220

ttggcaagtt ttagtaacat tttaactcat tcttccagac aatagtgcaa atcgccgaac 5280

tctctatttt acttgttttg ttgtcatgga tgaaaggttt gcaagacttt gttccaga 5338

<210> 2

<211> 1395

<212> DNA

<213> LOC_Os10g33230

<400> 2

atggagtcgg atcaggggaa gctgttcatc ggcggcatct cgtgggagac caccgaggag 60

aagctccgcg accacttcgc cgcctacggc gacgtctccc aggccgccgt catgcgcgac 120

aagctcaccg gccgcccccg cggcttcggc ttcgtcgtct tctccgaccc ttcctccgtc 180

gacgccgccc tcgtcgaccc ccacaccctc gacggccgca cggttgatgt gaagcgggcg 240

ctctcgcggg aggagcagca ggccgcgaag gcggcgaacc ctagcgcggg ggggaggcac 300

gcctccggtg ggggcggtgg tgggggaggc gccggtggtg gtggtggtgg cggcggtggt 360

gacgccggcg gtgcgcggac gaagaagatc ttcgtcggcg ggctgccctc caacctgacg 420

gaggacgagt tccggcagta cttccagacc tacggggtcg tcaccgacgt cgtcgtcatg 480

tacgaccaga acacgcagcg gccgaggggg ttcgggttca tcaccttcga cgcggaggac 540

gccgttgacc gcgtgctgca caagaccttc catgacctga gcgggaagat ggtggaggtg 600

aagcgcgccc tgcccaggga ggccaaccct ggctccggca gtggtggccg ttccatggga 660

ggcggcggtg ggggttacca gagtaacaat gggccgaact ccaattctgg gggctatgat 720

agcagaggtg acgctagcag gtatggtcag gcgcagcagg gtagtggtgg ttatcccggt 780

tatggtgctg gaggatatgg tgctggtacg gttggttatg gatatgggca tgctaaccct 840

ggaactgcgt atgggaatta tggggctgga ggatttggag gtgttcctgc tgggtatggt 900

gggcattatg gcaatccaaa tgcgcctggt tcaggttacc agggtggtcc tccaggagca 960

aacagaggac catggggtgg tcaagctccg tctggttatg gcactgggag ttatggtggc 1020

aatgcaggct atgctgcttg gaacaactct tctgctggag gtaatgcacc cactagtcag 1080

gccgctggtg caggcacagg ctatgggagc cagggctatg gatatggtgg atatggagga 1140

gatgcatcgt atggtaatca tggtggatat gggggttatg gaggaagggg agatggtgct 1200

ggcaatccag ctgctggcgg tggatctggg tatggtgctg gctatggaag cgggaatggc 1260

ggttctggtt atccaaatgc ttgggctgat ccttcacaag gtggagggtt tggggcttca 1320

gtcaatggag tgtctgaagg ccaatcaaat tatggcagtg gttatggtgg tgtgcaacct 1380

agggttgctc agtaa 1395

<210> 3

<211> 464

<212> PRT

<213> LOC_Os10g33230

<400> 3

Met Glu Ser Asp Gln Gly Lys Leu Phe Ile Gly Gly Ile Ser Trp Glu

1 5 10 15

Thr Thr Glu Glu Lys Leu Arg Asp His Phe Ala Ala Tyr Gly Asp Val

20 25 30

Ser Gln Ala Ala Val Met Arg Asp Lys Leu Thr Gly Arg Pro Arg Gly

35 40 45

Phe Gly Phe Val Val Phe Ser Asp Pro Ser Ser Val Asp Ala Ala Leu

50 55 60

Val Asp Pro His Thr Leu Asp Gly Arg Thr Val Asp Val Lys Arg Ala

65 70 75 80

Leu Ser Arg Glu Glu Gln Gln Ala Ala Lys Ala Ala Asn Pro Ser Ala

85 90 95

Gly Gly Arg His Ala Ser Gly Gly Gly Gly Gly Gly Gly Gly Ala Gly

100 105 110

Gly Gly Gly Gly Gly Gly Gly Gly Asp Ala Gly Gly Ala Arg Thr Lys

115 120 125

Lys Ile Phe Val Gly Gly Leu Pro Ser Asn Leu Thr Glu Asp Glu Phe

130 135 140

Arg Gln Tyr Phe Gln Thr Tyr Gly Val Val Thr Asp Val Val Val Met

145 150 155 160

Tyr Asp Gln Asn Thr Gln Arg Pro Arg Gly Phe Gly Phe Ile Thr Phe

165 170 175

Asp Ala Glu Asp Ala Val Asp Arg Val Leu His Lys Thr Phe His Asp

180 185 190

Leu Ser Gly Lys Met Val Glu Val Lys Arg Ala Leu Pro Arg Glu Ala

195 200 205

Asn Pro Gly Ser Gly Ser Gly Gly Arg Ser Met Gly Gly Gly Gly Gly

210 215 220

Gly Tyr Gln Ser Asn Asn Gly Pro Asn Ser Asn Ser Gly Gly Tyr Asp

225 230 235 240

Ser Arg Gly Asp Ala Ser Arg Tyr Gly Gln Ala Gln Gln Gly Ser Gly

245 250 255

Gly Tyr Pro Gly Tyr Gly Ala Gly Gly Tyr Gly Ala Gly Thr Val Gly

260 265 270

Tyr Gly Tyr Gly His Ala Asn Pro Gly Thr Ala Tyr Gly Asn Tyr Gly

275 280 285

Ala Gly Gly Phe Gly Gly Val Pro Ala Gly Tyr Gly Gly His Tyr Gly

290 295 300

Asn Pro Asn Ala Pro Gly Ser Gly Tyr Gln Gly Gly Pro Pro Gly Ala

305 310 315 320

Asn Arg Gly Pro Trp Gly Gly Gln Ala Pro Ser Gly Tyr Gly Thr Gly

325 330 335

Ser Tyr Gly Gly Asn Ala Gly Tyr Ala Ala Trp Asn Asn Ser Ser Ala

340 345 350

Gly Gly Asn Ala Pro Thr Ser Gln Ala Ala Gly Ala Gly Thr Gly Tyr

355 360 365

Gly Ser Gln Gly Tyr Gly Tyr Gly Gly Tyr Gly Gly Asp Ala Ser Tyr

370 375 380

Gly Asn His Gly Gly Tyr Gly Gly Tyr Gly Gly Arg Gly Asp Gly Ala

385 390 395 400

Gly Asn Pro Ala Ala Gly Gly Gly Ser Gly Tyr Gly Ala Gly Tyr Gly

405 410 415

Ser Gly Asn Gly Gly Ser Gly Tyr Pro Asn Ala Trp Ala Asp Pro Ser

420 425 430

Gln Gly Gly Gly Phe Gly Ala Ser Val Asn Gly Val Ser Glu Gly Gln

435 440 445

Ser Asn Tyr Gly Ser Gly Tyr Gly Gly Val Gln Pro Arg Val Ala Gln

450 455 460

Claims (2)

1. The application of the rice TGW10 gene in increasing the grain length character of rice seeds is knocked out, wherein the TGW10 gene in Nipponbare of japonica rice varieties is edited at fixed points by using a CRISPR/Cas9 technology to increase the grain length character of the rice seeds;

the amino acid sequence of the TGW10 gene is shown in SEQ ID NO. 3.

2. The use of claim 1, wherein Nipponbare of japonica rice variety is used as a gene editing receptor, and a CRISPR/Cas9-TGW10 site-specific editing vector is constructed for transformation to obtain a TGW 10-knocked-out gene editing plant.

Images