CN108191980A - Design, initiative and the application of C4 rice chassis acceptor material - Google Patents

Design, initiative and the application of C4 rice chassis acceptor material Download PDF

Info

Publication number
CN108191980A
CN108191980A CN201810025488.1A CN201810025488A CN108191980A CN 108191980 A CN108191980 A CN 108191980A CN 201810025488 A CN201810025488 A CN 201810025488A CN 108191980 A CN108191980 A CN 108191980A
Authority
CN
China
Prior art keywords
protein
plant
amino acid
sequence
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810025488.1A
Other languages
Chinese (zh)
Other versions
CN108191980B (en
Inventor
路铁刚
张治国
崔学安
吴金霞
孙学辉
谷晓峰
保罗·奎克 威廉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biotechnology Research Institute of CAAS
Original Assignee
Biotechnology Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biotechnology Research Institute of CAAS filed Critical Biotechnology Research Institute of CAAS
Priority to CN201810025488.1A priority Critical patent/CN108191980B/en
Publication of CN108191980A publication Critical patent/CN108191980A/en
Application granted granted Critical
Publication of CN108191980B publication Critical patent/CN108191980B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/8269—Photosynthesis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Physiology (AREA)
  • Plant Pathology (AREA)
  • Botany (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses design, initiative and the applications of C4 rice chassis acceptor material.The application of protein active or the substance of expression in transfer-gen plant of the cytological structure similar to C4 plants is cultivated in inhibition or reduction purpose plant provided by the present invention.It can utilize the experiment of encoding gene transformation wild rice (Nipponbare) that can prove the rice material of class C4 structures the present invention, anatomical structure is similar to C4 materials, the big degree of convergence of photosynthetic efficiency improves, and to cultivating C4 rice, improves rice yield and has a good application prospect.

Description

Design, initiative and the application of C4 rice chassis acceptor material
Technical field
The invention belongs to Rice Photosynthesis technical field of improvement, more particularly to the material screening of class C4 anatomical structures and Gene cloning clones CRV1 genes using map based cloning method, is related to design, initiative and the application of C4 rice chassis acceptor material, Using material (C4 rice chassis acceptor material) of the CRV1 genes initiative with class C4 anatomical structures, C4 rice prototypes are formulated.
Background technology
With industrialization, the development of urbanization and the increase of population, China's grain demand will be in that rigidity increases, and plough Reduction, shortage of water resources, climate change etc. become increasingly conspicuous to the constraint of grain-production, and China's grain supply and demand will be chronically at " tight Balance " state, Ensuring Food Safety face a severe challenge.The Plant-type Breeding and heterosis utilization of crops are made for China's grain The raising of produce amount ensures that the fast development of national economy is made that tremendous contribution, but grain yield further improves difficulty It is increasing.In current Ensuring Food Safety as under the background of China's long-term national policy, cereal crops yield level how is realized Lasting promotion be a difficult problem to lie across in Chinese society economy, agricultural science and technology forward march.Crop harvest index is weighing apparatus One of leading indicator of crop yield is measured, the harvest index of rice, wheat is all close to 0.5 at present, it means that both crops Grain yield account for nearly the 50% of all biological amount, by traditional breeding method realize grain yield large span improve can not possibly.
Fortunately, there are other plants (C4 plants, such as corn, sorghum and sugarcane), they photosynthetic in the world Efficiency is higher by 50% than C3 plant.Compared with C3 plant, C4 materials have vein density height, have special " garland shape " knot Structure, blade vascular bundle sheath cell it is big and less, Development of Chloroplasts is good, has special C4 photosynthesis approach.
Invention content
It is an object of the present invention to provide inhibit or reduce the use of protein active or the substance of expression in purpose plant On the way.
The present invention provides inhibit or reduce protein active or the substance of expression in purpose plant cultivating cytology knot Structure is similar to the application in the transfer-gen plant of C4 plants；
The protein be following a)-e) in any protein：
A) amino acid sequence includes the protein of the amino acid sequence shown in sequence 1 in sequence table；
B) amino acid sequence is made of the amino acid residue shown in sequence in sequence table 1；
C) by substitution and/or missing of amino acid sequence a) or b) limited by one or several amino acid residues And/or add and have the protein of identical function；
D) amino acid sequence and a) or b) limited have more than 99%, more than 95%, more than 90%, more than 85% or More than 80% homology of person and the protein with identical function；
E) a)-d) in the fusion protein that obtains after the N-terminal of any limited protein and/or C-terminal connection label.
Above application obtains cytological structure similar to C4 to inhibit or reducing protein active or expression in C3 plant The genetically modified plants of plant；
The genetically modified plants that the cytological structure is similar to C4 plants are high higher than C3 plant, photosynthetic efficiency for vein density C3 plant is smaller than in C3 plant and/or cell.
The present invention also provides inhibit or reduce protein active or the substance of expression in purpose plant improving purpose plant Application in vein density, raising purpose plant photosynthesis efficiency and/or reduction purpose plant cell spacing；
The protein be following a)-e) in any protein：
A) amino acid sequence includes the protein of the amino acid sequence shown in sequence 1 in sequence table；
B) amino acid sequence is made of the amino acid residue shown in sequence in sequence table 1；
C) by substitution and/or missing of amino acid sequence a) or b) limited by one or several amino acid residues And/or add and have the protein of identical function；
D) amino acid sequence and a) or b) limited have more than 99%, more than 95%, more than 90%, more than 85% or More than 80% homology of person and the protein with identical function；
E) a)-d) in the fusion protein that obtains after the N-terminal of any limited protein and/or C-terminal connection label.
In above application,
Protein active or the substance of expression are following 1) -4 in the inhibition or reduction purpose plant) any one of it is raw Object material：
1) DNA molecular shown in sequence 2 13-33 or the DNA molecular shown in sequence 2 87-107；
2) recombinant vector containing the DNA molecular；
3) recombinant bacterium containing the DNA molecular；
4) transgenic cell line containing the DNA molecular.
In above application,
The recombinant vector is shown in the DNA molecular shown in expressed sequence 2 13-33 or sequence 2 87-107 The carrier of DNA molecular and case9 albumen.
2nd purpose of the invention is to provide a kind of biomaterial.
Biomaterial provided by the invention is protein active in the inhibition or the reduction purpose plant in above application Or the substance of expression.
3rd purpose of the invention is to provide a kind of side for cultivating cytological structure and being similar to the genetically modified plants of C4 plants Method.
Method provided by the invention, includes the following steps：Inhibit or reduce protein active or expression in C3 plant, obtain Cytological structure is similar to the genetically modified plants of C4 plants；
The protein be following a)-e) in any protein：
A) amino acid sequence includes the protein of the amino acid sequence shown in sequence 1 in sequence table；
B) amino acid sequence is made of the amino acid residue shown in sequence in sequence table 1；
C) by substitution and/or missing of amino acid sequence a) or b) limited by one or several amino acid residues And/or add and have the protein of identical function；
D) amino acid sequence and a) or b) limited have more than 99%, more than 95%, more than 90%, more than 85% or More than 80% homology of person and the protein with identical function；
E) a)-d) in the fusion protein that obtains after the N-terminal of any limited protein and/or C-terminal connection label.
In the above method,
Protein active or be expressed as will be shown in expressed sequence 2 13-33 in the inhibition or reduction C3 plant In the cas9 vector introduction C3 plants of DNA molecular shown in DNA molecular or sequence 2 87-107.
In the above method,
The genetically modified plants that the cytological structure is similar to C4 plants are vein density higher than the C3 plant, photosynthetic effect Rate is smaller than the C3 plant higher than the C3 plant and/or cell.
4th purpose of the invention is to provide that a kind of cultivation vein density improves, photosynthetic efficiency improves and/or iuntercellular is away from subtracting The method of few genetically modified plants.
Method provided by the invention, includes the following steps：Inhibit or reduce above-mentioned protein active or table in purpose plant It reaches, obtains transfer-gen plant；
The vein density of the genetically modified plants is higher than the purpose plant；
And/or the photosynthetic efficiency of the genetically modified plants is higher than the purpose plant；
And/or the cell of the genetically modified plants is smaller than the purpose plant.
In the above method,
The plant is dicotyledon or monocotyledon；
Or the purpose plant is C3 plant；
Or the plant is rice.
The present invention provides gene, be transformed, import C3 plant rice in, initiative with class C4 structure features material Material, big spoke improve the photosynthetic efficiency of plant.The present invention provides chassis material for cultivating C4 plants, has great production application Value.
The present invention is screened from the T-DNA-inserted Mutant Pool in Rice of structure obtains class C4 anatomical structure mutant Crv1, mutant crv1 performance vein density become close, and cell number greatly reduces between scun, has the anatomy knot of C4 plant leaf veins Structure feature, photosynthetic efficiency significantly improve.Genetic analysis finds that the mutant character is controlled by Recessive genes, uses map based cloning Method has isolated the gene for controlling the mutant character, and it is (the name of a cysteine family gene to find its wild type gene For CRV1).The research that has complementary functions has been carried out to the gene with complementary method, has restored the phenotype of mutant.It utilizes simultaneously Material of the CRISP9 technologies initiative with class C4 anatomical features provides chassis material for final initiative C4 rice materials.
Description of the drawings
Fig. 1 is that picture is learned in the phenotype picture of mutant crv1 and wild type and dissection.
Fig. 2 is CRV1 gene cloning flow charts.
Fig. 3 is the plant phenotype photo in function covering experiment.
Fig. 4 is to utilize material of the CRISP9 technologies initiative with class C4 anatomical features.
The anatomy that Fig. 5 is strain 1-1 is analyzed, with the anatomical Partial Features of class C4.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.
Quantitative test in following embodiment, is respectively provided with three repeated experiments, and results are averaged.
Rice varieties Nipponbare (Oryza sativa L.ssp.Japonica), also known as wild rice, are represented with WT： Rice in China crossbreeding center (China, Changsha).PCambia2300 carriers：PCAMBIA companies.Agrobacterium AGL1：Chinese matter Grain carrier bacterial strain cell strain gene collection.
The discovery of embodiment 1, CRV1 albumen and its encoding gene
First, the discovery of class C4 anatomical structures mutant crv1
C4 plant Zea mays have higher photosynthetic efficiency, biological yield etc. than C3 plant rice, and main cause is that C4 plants Object has special anatomical structure.Using the T-DNA insertional mutagenesis libraries of rice varieties Nipponbare, by micro- sem observation, Mutant of the screening with class C4 anatomical structures.In screening, it was found that the mutant that a vein density significantly improves Crv1 (using 2 millimeters of vein numbers as statistical number).Vegetative growth phase and generative growth phase, mutant crv1 and wild type water Rice (NIP) plant type does not have significant difference, and plant height is about 110 centimetres (Figure 1A).Mutant crv1 and the sword-like leave vein of wild type are close Degree is shown in Figure 1B, and mutant crv1 veins density is 2 millimeters of 15 arteries and veins, and wild type vein density is 2 millimeters of 9 arteries and veins.Due to mutation Body crv1 veins density significantly becomes close, very similar to the vein structure of C4, therefore, with the photosynthetic instrument of LOCR-6400, determines prominent The photosynthetic parameters of variant crv1 and wild type, the photosynthetic efficiency of mutant crv1 is up to 21.47 ± 0.73 μm of ol m-2s-1, and it is wild Type rice is up to 13.47 ± 0.24 μm of ol m-2s-1, it is significantly higher than the photosynthetic efficiency of wild rice.
2nd, the assignment of genes gene mapping
Class C4 mutant crv1 and rice variety Dular (OryzasativaL.ssp.Indica) are assembled into cross combination, The polymorphism generated in this way will more be enriched, and generate FlGeneration, FlGeneration selfing generates F2For segregating population.
F is used first2Segregating population is positioned, plant strain growth to maturity period, and mutant character performance is apparent, utilizes microscope Observation takes mutant plants blade extraction genomic DNA to carry out the assignment of genes gene mapping.100 F are taken first2Mutant plants carry out thick Positioning chooses the preferable molecular labeling of polymorphism in 12 linkage groups of rice per every about about 20cM, is planted with 40 mutant Strain carries out linkage analysis, after finding the molecular labeling chain with CRV1, is further verified with 200 mutant plants.Verification is just After really, Shang great groups carry out chromosome walking, further finely positioning target gene.Share 2000 F2Mutant plants will CRV1 is positioned in 100K sections, and 5 complete ORF are shared in this away minor segment interior prediction, and gene structure is carried out to 5 ORF It analyzes and all carries out sequencing analysis, determine candidate gene.See Fig. 2 (A schemes for just positioning, and B is finely positioning figure).
Based on above-mentioned steps, find the new albumen for deriving from rice varieties Nipponbare, be named as CRV1 albumen, Its amino acid sequence is as shown in sequence 1 in sequence table.The unnamed gene of CRV1 albumen will be encoded as CRV1 genes, the core of the gene Nucleotide sequence is in sequence table shown in sequence 2, open reading frame be in sequence table sequence 2 from the core of 5 ' end 132-1880 Shown in thuja acid.
Embodiment 2, function covering experiment
First, the structure of recombinant plasmid
1st, the total serum IgE of extraction rice varieties Nipponbare and reverse transcription are cDNA.
2nd, using the cDNA that step 1 obtains as template, PCR amplification is carried out with the BucdsF and BucdsR primer pairs formed, is obtained To pcr amplification product.
BucdsF：5’-CCCGGGCGCTTTCGGCATTCGTTATCTACC-3’；
BucdsR：5’-TCTAGAGGGATCCGGCAATGGTGTATATCA-3’。
3rd, with Restriction enzyme Sma I and the pcr amplification product of XbaI double digestion steps 2, digestion products are recycled.
4th, with Restriction enzyme Sma I and XbaI double digestion pCambia2300 carriers, carrier framework is recycled.
5th, the digestion products that step 3 obtains with the carrier framework that step 4 obtains are connected, obtains recombinant plasmid pCambia2300-CRV1。
Recombinant plasmid pCambia2300-CRV1 is in the SmaI of pCambia2300 carriers and interleaving for XbaI enzyme cutting site The plasmid that the CRV1 genes in sequence table shown in sequence 2 obtain is entered.
2nd, complementation is the acquisition of plant
1st, recombinant plasmid pCambia2300-CRV1 is imported into Agrobacterium AGL1, obtains recombinational agrobacterium.
2nd, the recombinational agrobacterium that step 1 is taken to obtain is resuspended in liquid and co-cultures culture medium (YEP fluid nutrient mediums+100 Mg/L acetosyringones, pH5.2), obtain OD600nm=1.0 bacterium solution.
3rd, the embryo callus of mutant crv1 (material is preserved by Academy of Agricultural Sciences of state biotechnology research institute) is taken, is used Bacterium solution that step 2 obtains impregnates 30min, then through co-culturing, screening, taking root, strong sprout, obtains T0For plant.
4、T0T is obtained for plant selfing1For seed, T1It is T for the plant that seed grows up to1For plant (complementation system).
3rd, complementation is the identification of plant
4 complementary system (bu-1, bu-2, bu-3 and bu- that the Nipponbare rice that takes growth conditions consistent, step 2 obtain 4) T1, in vegetative reproduction late period, carries out vein density observation for plant.
As a result such as Fig. 3, (A is complementary system and the Adult plant photo comparison of mutant, and B is complementary system and the vein pair of mutant Than) shown in, the phenotype of vein density reduction is restored by complementation system (bu-1, bu-2, bu-3 and bu-4) (cp1 is also known as in figure)； Show that CRV1 albumen has the function of to reduce vein density.
Embodiment 3, the initiative of class C4 anatomical structures material
First, CRV1 relevant carriers are built using CRISP9 technologies
1st, CRV1 3 sections of gene are designed, synthesize following primer sequence first, by Gradient annealing, obtain band toughness The double-stranded DNA of end.
The primer of Region1-1:
TGGCA gacgataaggcgcagctctc
AAAC GAGAGCTGCGCCTTATCGTCT
The primer of Region1-2:
TGGCA ttgttctccatcaatccaac
AAAC GTTGGATTGATGGAGAACAA T
Respectively by the primer of Region1-1 and the primer annealing of Region1-2, the Region1 with cohesive end is obtained With the Region2 with cohesive end.
With BbsI single endonuclease digestion intermediate carriers psgR-Cas9-OS (Molecular Plant Advance Access Published September 5,2013), obtain skeleton carrier, by skeleton carrier respectively with cohesive end Region1 is connected with the Region2 with cohesive end by T4 ligases, obtains intermediate carrier psgR-Cas9-OS- Region1-1 and intermediate carrier psgR-Cas9-OS-Region1-2；
Intermediate carrier psgR-Cas9-OS-Region1-1 is that the DNA fragmentation shown in sequence 2 13-33 comes in and goes out centre The carrier that the BbsI restriction enzyme sites of carrier psgR-Cas9-OS obtain.
Intermediate carrier p2 × sgR-Cas9-OS-Region1-2 is by the DNA fragmentation discrepancy shown in sequence 2 87-107 The carrier that the BbsI restriction enzyme sites of intermediate carrier p2 × sgR-Cas9-OS obtain.
2nd, again respectively with HindIII and EcoRI double digestion intermediate carrier psgR-Cas9-OS-Region1-1 and intermediate load Body psgR-Cas9-OS-Region1-2 obtains the Region1-1 digestion products of 6000bp and the Region1-2 enzymes of 6100bp Cut product；
It is respectively that the Region1-2 digestion products of the Region1-1 digestion products of 6000bp and 6100bp are similary with passing through 10000bp pCambia1300 carriers (purchase of Wuhan Miao Ling bio tech ltd) skeleton connection that digestion obtains, obtains Knockout carrier pCambia1300-CRV1 (1-1) and pCambia1300-CRV1 (1-2).
By obtain 2 recombinant plasmid pCambia1300-CRV1 (1-1), recombinant plasmid pCambia1300-CRV1 (1- 2) Agrobacterium AGL1 is directed respectively into, obtains recombinational agrobacterium.
2nd, recombinational agrobacterium is taken, liquid is resuspended in and co-cultures culture medium (YEP fluid nutrient medium+100mg/L acetyl cloves Ketone, pH5.2), obtain the bacterium solution of OD600nm=1.0.
3rd, the embryo callus of wild rice Nipponbare is taken, impregnates 30min, Ran Houjing with the bacterium solution that step 2 obtains It co-cultures, screen, taking root, strong sprout, obtaining T0 for plant.
4th, T0 obtains T1 for seed for plant selfing, and T1 is T1 for plant for the plant that seed grows up to；T1 for plant from It hands over and obtains T2 for seed, T2 is T2 for plant for the plant that seed grows up to, and obtains T2 generations and turns CRV1 (1-1) plant and T2 generations Turn CRV1 (1-2).
5th, take T1 generation turn CRV1 (1-1) plant, T1 generation turn CRV1 (1-2) plant and T2 generation turn CRV1 (1-1) plant and T2 In generation, turns the blade of CRV1 (1-2) plant, extracts genomic DNA and carries out PCR using the primer pair that BucdsF and BucdsR is formed Identification, it is positive fragment to obtain 454bp.
BucdsF：CGACATCCAACCTACAGCATT
BucdsR：AACCTGAGAGCCTGAACCAAT
By sequencing, recombinant plasmid pCambia1300-CRV1 (1-1) and recombinant plasmid pCambia1300-CRV1 (1-2) Importing lack CRV1 genes.
2nd, turn the acquisition of empty carrier plant
Recombinant plasmid pCambia1300-CRV1 is replaced to carry out step 1 with pCambia1300 carriers, obtain turning empty carrier Plant.
3rd, C4 anatomical structures material is identified
In the random T2 generations for taking 2 homozygous transgenic lines, turn CRV1 (1-1) plant and T2 generations turn CRV1 (1-2) plant, Each strain respectively selects a strain for having representative：1-1 strains, 1-2 strains take the T2 for turning empty carrier plant for plant and wild type Each 20 plants of rice.
Above-mentioned each strain is subjected to vein density and photosynthetic efficiency identification and cytological structure identification (vein density respectively Method refers to PLoS One.2014Apr 23；9(4):e94947.It is portable photosynthetic that photosynthetic parameters measure refers to LI-COR 6800 Instrument specification).
As a result as Fig. 4 (A for mutant crv1 with WT lines compared with, B be strain 1-1 compared with WT lines, C It is strain 1-2 compared with WT lines) shown in, compared with compareing (wild rice), 1-1 strains, 1-2 strains are not changing Under conditions of economical character, it is respectively provided with the anatomical features of C4 plants：(see Fig. 4, B, C note bracket represent leaf to the increase of vein density Rapid pulse), photosynthetic efficiency improves (being shown in Table 1), and two iuntercellulars have had away from (see Fig. 4, B, C note bracket represent vein number) is reduced There is the feature of class C4 anatomical structures.
Fig. 5 A are C3 rice figure compared with the vein of C4 corns, and two kinds of plants are the representative model plants of C3 and C4, and B is Cytological structure shows the cell number and size between two arteries and veins of wild type and strain 1-1, with the anatomical parts of class C4 Feature.
Each economical character of transgenosis and empty map is compared as follows (6800 photosynthetic instrument of LI-COR measure) shown in table 1：
Table 1 is transgenosis compared with each economical character of empty map
The above results show reduce purpose plant in CRV1 protein expressions, can realize purpose plant leaf vein density increase, Photosynthetic efficiency improves and iuntercellular is away from reduction, shows as the Photosynthetic Characteristics of C4.
Sequence table
<110>Biological Technology institute, Chinese Academy of Agricultural Sciences
<120>The design, initiative and application of C4 rice " chassis " acceptor material
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 1749
<212> PRT
<213> Artificial sequence
<400> 1
Met Lys Pro Ser Asp Asp Lys Ala Gln Leu Ser Gly Leu Ala Gln Ser
1 5 10 15
Glu Glu Ser Ser Leu Asp Val Asp His Gln Ser Phe Pro Cys Ser Pro
20 25 30
Ser Ile Gln Pro Val Ala Ser Gly Cys Thr His Thr Glu Asn Ser Ala
35 40 45
Ala Tyr Phe Leu Trp Pro Thr Ser Asn Leu Gln His Cys Ala Ala Glu
50 55 60
Gly Arg Ala Asn Tyr Phe Gly Asn Leu Gln Lys Gly Leu Leu Pro Arg
65 70 75 80
His Pro Gly Arg Leu Pro Lys Gly Gln Gln Ala Asn Ser Leu Leu Asp
85 90 95
Leu Met Thr Ile Arg Ala Phe His Ser Lys Ile Leu Arg Arg Phe Ser
100 105 110
Leu Gly Thr Ala Val Gly Phe Arg Ile Arg Lys Gly Asp Leu Thr Asp
115 120 125
Ile Pro Ala Ile Leu Val Phe Val Ala Arg Lys Val His Lys Lys Trp
130 135 140
Leu Asn Pro Ala Gln Cys Leu Pro Ala Ile Leu Glu Gly Pro Gly Gly
145 150 155 160
Val Trp Cys Asp Val Asp Val Val Glu Phe Ser Tyr Tyr Gly Ala Pro
165 170 175
Ala Gln Thr Pro Lys Glu Gln Met Phe Ser Glu Leu Val Asp Lys Leu
180 185 190
Cys Gly Ser Asp Glu Cys Ile Gly Ser Gly Ser Gln Val Ala Ser His
195 200 205
Glu Thr Phe Gly Thr Leu Gly Ala Ile Val Lys Arg Arg Thr Gly Asn
210 215 220
Lys Gln Val Gly Phe Leu Thr Asn His His Val Ala Val Asp Leu Asp
225 230 235 240
Tyr Pro Asn Gln Lys Met Phe His Pro Leu Pro Pro Asn Leu Gly Pro
245 250 255
Gly Val Tyr Leu Gly Ala Val Glu Arg Ala Thr Ser Phe Ile Thr Asp
260 265 270
Asp Val Trp Tyr Gly Ile Tyr Ala Gly Thr Asn Pro Glu Thr Phe Val
275 280 285
Arg Ala Asp Gly Ala Phe Ile Pro Phe Ala Asp Asp Phe Asp Ile Ser
290 295 300
Thr Val Thr Thr Val Val Arg Gly Val Gly Asp Ile Gly Asp Val Lys
305 310 315 320
Val Ile Asp Leu Gln Cys Pro Leu Asn Ser Leu Ile Gly Arg Gln Val
325 330 335
Cys Lys Val Gly Arg Ser Ser Gly His Thr Thr Gly Thr Val Met Ala
340 345 350
Tyr Ala Leu Glu Tyr Asn Asp Glu Lys Gly Ile Cys Phe Phe Thr Asp
355 360 365
Ile Leu Val Val Gly Glu Asn Arg Gln Thr Phe Asp Leu Glu Gly Asp
370 375 380
Ser Gly Ser Leu Ile Ile Leu Thr Ser Gln Asp Gly Glu Lys Pro Arg
385 390 395 400
Pro Ile Gly Ile Ile Trp Gly Gly Thr Ala Asn Arg Gly Arg Leu Lys
405 410 415
Leu Thr Ser Asp His Gly Pro Glu Asn Trp Thr Ser Gly Val Asp Leu
420 425 430
Gly Arg Leu Leu Asp Arg Leu Glu Leu Asp Ile Ile Ile Thr Asn Glu
435 440 445
Ser Leu Gln Asp Ala Val Gln Gln Gln Arg Phe Ala Leu Val Ala Ala
450 455 460
Val Thr Ser Ala Val Gly Glu Ser Ser Gly Val Pro Val Ala Ile Pro
465 470 475 480
Glu Glu Lys Ile Glu Glu Ile Phe Glu Pro Leu Gly Ile Gln Ile Gln
485 490 495
Gln Leu Pro Arg His Asp Val Ala Ala Ser Gly Thr Glu Gly Glu Glu
500 505 510
Ala Ser Asn Thr Val Val Asn Val Glu Glu His Gln Phe Ile Ser Asn
515 520 525
Phe Val Gly Met Ser Pro Val Arg Asp Asp Gln Asp Ala Pro Arg Ser
530 535 540
Ile Thr Asn Leu Asn Asn Pro Ser Glu Glu Glu Leu Ala Met Ser Leu
545 550 555 560
His Leu Gly Asp Arg Glu Pro Lys Arg Leu Arg Ser Asp Ser Gly Ser
565 570 575
Ser Leu Asp Leu Glu Lys
580
<210> 2
<211> 1749
<212> DNA
<213> Artificial sequence
<400> 2
atgaagcctt cggacgataa ggcgcagctc tcaggtttgg cgcaatcaga agaatcgtca 60
cttgatgtgg atcaccagtc atttccttgt tctccatcaa tccaaccggt tgcttctggg 120
tgcacacaca cagagaacag cgcagcatac ttcttatggc cgacatccaa cctacagcat 180
tgtgcagccg agggacgtgc aaactacttt ggaaaccttc agaaaggatt gttgccaagg 240
caccctggtc ggttgcccaa aggtcagcaa gcaaatagct tgcttgactt gatgactata 300
agagctttcc atagcaagat attgcggcgt tttagcctcg ggacagcagt gggattccgc 360
atcaggaaag gggatctaac agatatccct gcaatccttg tctttgttgc tcgcaaggtt 420
cataagaagt ggcttaatcc agcacaatgt cttcctgcta ttcttgaggg tccaggaggt 480
gtttggtgtg atgttgatgt tgttgaattt tcgtactacg gtgcaccggc tcaaacacct 540
aaagagcaaa tgttcagtga gcttgttgat aagttatgtg gcagtgacga atgtattggt 600
tcaggctctc aggttgcaag ccatgaaact tttggtactt tgggtgcaat tgtgaaacgg 660
cgcactggca acaagcaggt tggtttcctc actaaccatc atgtcgcggt tgacttggac 720
taccctaatc agaagatgtt tcatccatta ccacccaatc ttgggcctgg cgtttatctt 780
ggagctgttg aaagagcaac ttctttcatc acagatgacg tttggtatgg aatctatgct 840
ggaacaaacc cagagacatt tgtacgagct gacggtgcat ttatcccatt tgctgatgac 900
tttgacattt ccaccgtcac gactgtagtt aggggagtcg gtgacattgg ggatgtcaag 960
gttatagatc tgcagtgtcc gctcaatagc ctcataggga ggcaagtatg caaagttggc 1020
agaagctctg gtcacacaac tgggactgtg atggcctatg cccttgagta caatgacgag 1080
aaaggaatat gcttcttcac agacatcctt gttgttggtg agaaccgcca aacatttgat 1140
ttggaaggtg atagcggaag ccttattatc ctgactagcc aagatggtga gaagccgcgt 1200
ccaattggaa ttatatgggg tggcacagca aatcgtggga ggttgaagct tacaagtgat 1260
catggccctg aaaactggac tagtggggtt gatcttggcc gtctactcga ccgtctggaa 1320
cttgatatta tcattaccaa tgaatcactc caagatgccg tgcagcagca aagatttgct 1380
ttggtggccg ccgttacctc agctgttggg gagtcttccg gggtgcctgt cgccatcccg 1440
gaagagaaga tcgaagagat cttcgagcca ttggggatcc aaatccagca actgcctcgc 1500
catgacgtgg cggcctctgg aactgaaggg gaggaggcat ccaacacggt ggtcaatgtg 1560
gaagagcacc agttcatctc aaacttcgtc ggtatgtcgc ccgtgcgcga cgaccaagac 1620
gctccgagga gcatcaccaa cctgaacaac ccctccgagg aagaactcgc catgtcgctc 1680
catctgggtg accgagagcc caagcggctc cgttcggact ccggatcaag ccttgacctg 1740
gagaaatga 1749

Claims (10)

1. protein active or the substance of expression are cultivating cytological structure similar to C4 plants in inhibition or reduction purpose plant Transfer-gen plant in application；
The protein be following a)-e) in any protein：
A) amino acid sequence includes the protein of the amino acid sequence shown in sequence 1 in sequence table；
B) amino acid sequence is made of the amino acid residue shown in sequence in sequence table 1；
C) by amino acid sequence a) or b) limited by the substitution of one or several amino acid residues and/or missing and/or Addition and the protein with identical function；
D) amino acid sequence and a) or b) limited have more than 99%, more than 95%, more than 90%, more than 85% or More than 80% homology and the protein with identical function；
E) a)-d) in the fusion protein that obtains after the N-terminal of any limited protein and/or C-terminal connection label.
2. protein active or the substance of expression are improving purpose plant leaf vein density, are improving mesh in inhibition or reduction purpose plant Plant photosynthesis efficiency and/or reduce purpose plant cell spacing in application；
The protein be following a)-e) in any protein：
A) amino acid sequence includes the protein of the amino acid sequence shown in sequence 1 in sequence table；
B) amino acid sequence is made of the amino acid residue shown in sequence in sequence table 1；
C) by amino acid sequence a) or b) limited by the substitution of one or several amino acid residues and/or missing and/or Addition and the protein with identical function；
D) amino acid sequence and a) or b) limited have more than 99%, more than 95%, more than 90%, more than 85% or More than 80% homology and the protein with identical function；
E) a)-d) in the fusion protein that obtains after the N-terminal of any limited protein and/or C-terminal connection label.
3. application according to claim 1 or 2, it is characterised in that：
Protein active or the substance of expression are following 1) -4 in the inhibition or reduction purpose plant) any one of biological material Material：
1) DNA molecular shown in sequence 2 13-33 or the DNA molecular shown in sequence 2 87-107；
2) recombinant vector containing the DNA molecular；
3) recombinant bacterium containing the DNA molecular；
4) transgenic cell line containing the DNA molecular.
4. application according to claim 3, it is characterised in that：The recombinant vector is shown in expressed sequence 2 13-33 DNA molecular or sequence 2 87-107 shown in DNA molecular and case9 albumen carrier.
5. a kind of biomaterial is egg in the inhibition or the reduction purpose plant in claim 1-4 in any application White matter activity or the substance of expression.
6. a kind of method cultivated cytological structure and be similar to the genetically modified plants of C4 plants, includes the following steps：Inhibit or drop Protein active and/or expression in low C3 plant obtain the genetically modified plants that cytological structure is similar to C4 plants；
The protein be following a)-e) in any protein：
A) amino acid sequence includes the protein of the amino acid sequence shown in sequence 1 in sequence table；
B) amino acid sequence is made of the amino acid residue shown in sequence in sequence table 1；
C) by amino acid sequence a) or b) limited by the substitution of one or several amino acid residues and/or missing and/or Addition and the protein with identical function；
D) amino acid sequence and a) or b) limited have more than 99%, more than 95%, more than 90%, more than 85% or More than 80% homology and the protein with identical function；
E) a)-d) in the fusion protein that obtains after the N-terminal of any limited protein and/or C-terminal connection label.
7. according to the method described in claim 6, it is characterized in that：
It protein active or is expressed as in the inhibition or reduction C3 plant by the DNA molecular shown in expressed sequence 2 13-33 Or in the cas9 vector introduction C3 plants of the DNA molecular shown in sequence 2 87-107.
8. the method described according to claim 6 or 7, it is characterised in that：
The genetically modified plants that the cytological structure is similar to C4 plants are high higher than the C3 plant, photosynthetic efficiency for vein density The C3 plant is smaller than in the C3 plant and/or cell.
9. a kind of method for cultivating the increase of vein density, photosynthetic efficiency raising and the genetically modified plants of/iuntercellular away from reduction, including Following steps：Inhibit or reduce protein active and/or expression described in claims 1 or 2 in purpose plant, obtain transgenosis plant Strain；
The vein density of the genetically modified plants is higher than the purpose plant；
And/or the photosynthetic efficiency of the genetically modified plants is higher than the purpose plant；
And/or the cell of the genetically modified plants is smaller than the purpose plant.
10. according to the method any in claim 6-9, it is characterised in that：
The plant is dicotyledon or monocotyledon；
And/or the purpose plant is C3 plant；
And/or the plant is rice.
CN201810025488.1A 2018-01-11 2018-01-11 Design, creation and application of C4 rice chassis receptor material Expired - Fee Related CN108191980B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810025488.1A CN108191980B (en) 2018-01-11 2018-01-11 Design, creation and application of C4 rice chassis receptor material

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810025488.1A CN108191980B (en) 2018-01-11 2018-01-11 Design, creation and application of C4 rice chassis receptor material

Publications (2)

Publication Number Publication Date
CN108191980A true CN108191980A (en) 2018-06-22
CN108191980B CN108191980B (en) 2020-08-25

Family

ID=62589042

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810025488.1A Expired - Fee Related CN108191980B (en) 2018-01-11 2018-01-11 Design, creation and application of C4 rice chassis receptor material

Country Status (1)

Country Link
CN (1) CN108191980B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112852832A (en) * 2021-02-20 2021-05-28 浙江师范大学 Rice dwarf multi-tillering mutant dmt1 and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1970767A (en) * 2006-11-29 2007-05-30 中国科学院遗传与发育生物学研究所 Plant-related gene from paddy and its coded protein and application thereof
CN103694327A (en) * 2013-12-20 2014-04-02 中国农业科学院生物技术研究所 Plant drought-enduring associated protein DSM1 as well as coding gene and application thereof
WO2014118636A3 (en) * 2013-02-01 2015-03-05 International Rice Research Institute Breeding methods for enhanced grain yield and related materials and methods

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1970767A (en) * 2006-11-29 2007-05-30 中国科学院遗传与发育生物学研究所 Plant-related gene from paddy and its coded protein and application thereof
WO2014118636A3 (en) * 2013-02-01 2015-03-05 International Rice Research Institute Breeding methods for enhanced grain yield and related materials and methods
CN103694327A (en) * 2013-12-20 2014-04-02 中国农业科学院生物技术研究所 Plant drought-enduring associated protein DSM1 as well as coding gene and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JING QI ET AL.: "NCBI Reference Sequence:EU093963.1，Oryza sativa Japonica Group narrow leaf 1 mRNA, complete cds", 《GENBANK DATABASE》 *
TOSHIYUKI TAKAI ET AL.: "A natural variant of NAL1,selected in high-yield rice breeding programs,pleiotropically increases photosynthesis rate", 《SCIENTIFIC REPORTS》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112852832A (en) * 2021-02-20 2021-05-28 浙江师范大学 Rice dwarf multi-tillering mutant dmt1 and application thereof

Also Published As

Publication number Publication date
CN108191980B (en) 2020-08-25

Similar Documents

Publication Publication Date Title
CN106164272A (en) The plant modified
CN109694872A (en) The method of controlling gene expression
CN108822194B (en) Plant starch synthesis related protein OsFLO10, and coding gene and application thereof
CN103243107A (en) Panicle size controlling gene, mutant and application thereof
WO2023065966A1 (en) Application of bfne gene in tomato plant type improvement and biological yield increase
CN103865937A (en) Cytoplasmic male sterility restorer gene in rice and application thereof
CN110964733B (en) Rice semi-dominant brittle stalk control gene, molecular marker and application
CN109134632A (en) The albumen and its encoding gene of regulation plant root development and application
CN102603878B (en) Vegetable glutelin transportation storage related protein OsVps9a as well as coding gene and application thereof
CN106496313B (en) Disease-resistance-related protein IbSWEET10 and its encoding gene and application
CN110256545A (en) ZmAER albumen and its encoding gene and application
CN106749580B (en) Plant salt tolerance GAP-associated protein GAP TaPUB15-D and its encoding gene and application
CN111471697B (en) Rice crisp stalk regulatory gene DBC2 and application thereof
CN104004775B (en) One sterility changing gene and its application
CN108558992A (en) The transcription factor PDD1 and its encoding gene of regulation and control needle mushroom fruit body development and application
CN106062192A (en) Maize cytoplasmic male sterility (CMS) s-type restorer gene RF3
CN102250228B (en) Method for improving rice potassium ion efflux antiporter
CN108191980A (en) Design, initiative and the application of C4 rice chassis acceptor material
CN106929518B (en) A kind of rubber tree HbAG genes and its application
CN105838718A (en) Rice stem-leaf strong expression starter SAFES7 and application thereof
CN104278053B (en) A kind of method for improving drought tolerance in plants ability
CN109354618A (en) Application of the G-protein α subunit in regulation germination of cucumber seeds, growth of seedling and plant low temperature resistivity
CN102154337A (en) Gossypium hirsutum mitogen-activated protein kinas 6 (GhMAPK6) gene and application thereof
CN102732553B (en) Improve the gene engineering method and material of plant products
CN109161551A (en) Wild cabbage BoMS1 gene and its application in initiative sterile material

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20200825

CF01 Termination of patent right due to non-payment of annual fee