CN102250228B - Method for improving rice potassium ion efflux antiporter - Google Patents
Method for improving rice potassium ion efflux antiporter Download PDFInfo
- Publication number
- CN102250228B CN102250228B CN 201110161173 CN201110161173A CN102250228B CN 102250228 B CN102250228 B CN 102250228B CN 201110161173 CN201110161173 CN 201110161173 CN 201110161173 A CN201110161173 A CN 201110161173A CN 102250228 B CN102250228 B CN 102250228B
- Authority
- CN
- China
- Prior art keywords
- kea1
- rice
- potassium ion
- gene
- paddy rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the technical field of biological engineering and discloses a method for improving rice potassium ion efflux antiporter. A function mutant strain of rice potassium ion efflux antiporter protein is obtained by a KEA1 gene for mutation control of rice potassium ion efflux and protein encoded by the gene; meanwhile, gamma rays are utilized to treat 9522 strain of japonica rice, and mutants of which the leaf veins are whitened are selected in F2 generation after the rice is planted so as to obtain the function mutant strain of the rice potassium ion efflux antiporter protein. By utilizing the characteristic that the protein participates in chloroplast potassium ion efflux antiporter and controls rice potassium ion transport by a transgenic technology, a new rice stress-resistant line is generated by inhibiting the expression of the protein, and has important application value in agricultural production.
Description
Technical field
What the present invention relates to is a kind of application of technical field of bioengineering, specifically a kind of method of utilizing the raising rice potassium ion efflux antiporter of KEA1 gene and proteins encoded thereof.
Background technology
Paddy rice is one of topmost food crop of China, and there is 60% above population in China take rice as staple food, is maximum in the world rice producing country and country of consumption.3,000 ten thousand hectares of China paddy rice year sown areas account for 20% of the world; 1.85 hundred million tons of output account for the nearly 1/3 of the world, 6.35 tons/hectare of yield per unit.Higher by 65% than 3.85 tons/hectare of global average yields.Paddy rice remains at about 40% of total amount in China's grain yield, occupied nearly half of the country.
Photosynthesis is the basis of crop yield, and chloroplast(id) is as photosynthetic place, and its developmental regulation research on mechanism is the focus of plant physiology and molecular biology research always.Salting of soil is the major cause that causes the global all kinds of food crop underproduction, and salt stress can make photosynthetic efficiency reduce, and causes the underproduction.Paddy rice is as one of important food crop, and the research of its ion transportation and Mechanisms of Salt Resistance for cultivate the salt tolerant kind that makes new advances in actual breeding, is alleviated grain problem in short supply and laid the foundation.Therefore, the research degeneration-resistant strain of seed selection Novel rice is also furtherd investigate its Regulation Mechanism, is prerequisite and the basis of further excavating the paddy rice fine quality.
Potassium is the necessary mineral element of growth and development of plants, and farm crop can not grow by normal growth in the soil that lacks potassium element.The raising farm crop are one of important channels that solves the Potassic fertilizer resources shortage problem to the efficient that absorbs of potassium element.For the research of kalium ion transport albumen, help more clearly to understand the complicated regulated and control network of ion transport, for promoting the crop alimentary recycle also to have great importance.Suitable high K
+/ Na
+It is very necessary being compared to and keeping the normal photophosphorylation of chloroplast(id), when sodium ion enters in the cell in a large number, just must reduce sodium ion in the kytoplasm with effective means, keeps ionic equilibrium in the kytoplasm, guarantees the normal physiological function of chloroplast(id).Vegetable cell can pass through to increase the absorption of potassium ion, and then improves the K in the kytoplasm
+/ Na
+Ratio is alleviated the injury of salt stress.
Existing gene engineering technique is to be applied on the basis that is based upon the abundant research of plant development process molecular regulation mechanism and understanding, therefore, furtheing investigate paddy rice for chloroplast(id) kalium ion transport mechanism and regulated and control network and be applied is the basis of researching and developing novel salt-resistant high-quality strain producing.
Summary of the invention
The present invention is directed to the prior art above shortcomings, a kind of method that improves rice potassium ion efflux antiporter is provided, utilize KEA1 gene and albumen thereof to participate in the characteristics of chloroplast(id) potassium ion efflux antiporter, and the characteristic of utilizing transgenic technology control paddy rice potassium ion to transport, produce new paddy rice anti contravariance strain by suddenling change or suppressing this protein expression, have very important application in agriculture production.
The present invention is achieved by the following technical solutions:
The present invention relates to a kind of rice potassium ion efflux antiporter albumen, its nucleotide sequence is shown in 1-3465 position among the SEQ ID NO.1.
The present invention relates to a kind of polypeptide with potassium ion efflux antiporter protein-active, its aminoacid sequence is shown in SEQ ID NO.2.
The present invention relates to the host cell of above-mentioned translocator, this host cell is eukaryotic cell, specifically from paddy rice.
The present invention relates to a kind of gene KEA1 that participates in the chloroplast(id) potassium ion efflux antiporter in paddy rice, its nucleotide sequence is shown in 1-3465 position among the SEQ ID NO.1.
The present invention relates to a kind of producing method for seed of the KEA1 mutant based on paddy rice, by utilizing
60The Co gamma-rays is processed japonica rice 9522 strains, to the F2 of mutagenesis in generation in one the arteries and veins mutant three generations that bleaches backcross, obtain the KEA1 mutant of the genetic stability of recessive single-gene regulation and control.
Described utilization
60The Co gamma-rays is processed concrete operation step to japonica rice 9522 strains and is referred to: utilize
60The Co gamma-rays is mutation source, with the 280Gy treatment dosage, processes japonica rice 9522 seeds.
Described F2 is for referring to: warp
60Japonica rice 9522 seeds behind the Co gamma-ray and mutagenesis are sowed after seed soaking, vernalization, and when 30 age in days, list originally is transplanted into the land for growing field crops, and behind seed maturity, each mutant 1 generation plant is F1 generation, the 3 strain spikes of rice of gathering; Then each F1 is sowed respectively for the strain seed, and be transplanted into the land for growing field crops when 30 age in days, single this of each strain is transplanted 24 strains; At last after transplanting, from nourishing and growing until the whole process of reproductive growth, each week field observation once therefrom filter out compare with wild-type occur that phenotype changes 2 generation strain, be F2 generation, be numbered, record phenotype and separate ratio.
The present invention relates to the KEA1 mutant that above-mentioned producing method for seed obtains, its nucleotide sequence is shown in SEQ ID NO.1.
Arteries and veins adaxial and its surface specificity bleaches in the rice mutant kea1 blade that relates among the present invention, and number of chloroplast reduces, irregular arrangement; Under the condition of salt stress, K, Na constituent content are starkly lower than wild-type in the plant, and the K/Na ratio is apparently higher than wild-type.
Kea1 mutant material of the present invention is the conventional japonica rice 9522 process gamma-ray and mutagenesis of being promoted by In Middle And Lower Reaches of Changjiang River, be the monogenic sudden change of recessiveness, the disappearance (2284~2287bp) of four bases occurs at the 11 exon of KEA1 gene, cause the variation of gene order, produce a nucleotide sequence shown in SEQ ID NO.6, thereby cause KEA1 albumen premature termination (802aa), produce an aminoacid sequence shown in SEQ ID NO.7.
Relate to gene KEA1 among the present invention, its promotor can start the KEA1 gene and express in the whole vascular bundle tissue of plant; The KEA1 gene all has expression at root, stem, leaf, leaf sheath, in spending; This gene knock out the phenotype that can obtain this transgenation; Complementary and the mistake of this gene is expressed the phenotype that all can recover mutant kea1.Illustrate that this gene function is to have influence on that arteries and veins bleaches in the blade of paddy rice really, this impact may be to realize by regulating the chloroplast(id) potassium ion efflux antiporter.
The present invention has obvious effect aspect the potassium ion efflux antiporter excavating and utilize, and can produce the degeneration-resistant system of new paddy rice cross breeding, is used for the new anti-adversity of seed selection, has very important application in agriculture production.
Description of drawings
The morphological observation synoptic diagram of Fig. 1 kea1 mutant plant.
Fig. 2 kea1 mutant and wild-type 9522 ionic concns are measured synoptic diagram.
Location, Fig. 3 kea1 seat synoptic diagram.
Fig. 4 is complementary to obtain wild-type phenotype synoptic diagram with mistake expression mutant.
The expression pattern synoptic diagram of Fig. 5 KEA1 promotor.
The Subcellular Localization synoptic diagram of Fig. 6 KEA1.
Fig. 7 RNAi obtains the mutation type surface synoptic diagram.
Embodiment
The below elaborates to embodiments of the invention, and present embodiment is implemented under take technical solution of the present invention as prerequisite, provided detailed embodiment and concrete operating process, but protection scope of the present invention is not limited to following embodiment.
Acquisition and the morphologic observation of embodiment 1:kea1 mutant plant
This mutant is this use for laboratory
60Co gamma-ray and mutagenesis japonica rice 9522 seeds, treatment dosage is 280Gy.To the F2 of mutagenesis in generation in the blade arteries and veins adaxial and its surface specificity mutant three generations that bleaches backcross, obtain the mutant kea1 of the genetic stability of recessive single-gene regulation and control.All vegetable materials are planted in the test base, Academy of Agricultural Sciences, Shanghai City.
Morphological observation to kea1 mutant plant.Such as Fig. 1, the phenotype of wild-type and mutant kea1 contrast shows wild-type 9522 leaf looks normal (left side) (A, B, C), and arteries and veins adaxial and its surface specificity bleach on (right side) (A, B, C) in the kea1 mutant blade; Arteries and veins adaxial and its surface number of chloroplast is a lot of in the wild-type blade, queueing discipline (on) (D), arteries and veins adaxial and its surface number of chloroplast reduces in the mutant kea1 blade, irregular arrangement (descending) is (D); The thylakoid number is a lot of in the wild-type chloroplast(id), queueing discipline (left side) (E), the thylakoid number slightly reduces (right side) (E) in the mutant.
Embodiment 2:kea1 mutant and wild-type 9522 ionic concns are measured
(1) processing of sample.Choose wild-type and mutant the nourish and grow root, stem, leaf, leaf sheath of vigorous period (60d) and the flower (Fig. 2 A) in reproductive growth period, and normal growth and salt processes over-ground part and the root (Fig. 2 B) of 28d seedling under (processing 3d with NaCl 300mM and KCl 300mM respectively) condition, first at the CaCl of 5mM
2Solution is washed fast in 2 pure water and is washed fast twice, washes fast once in distilled water, washes fast in ultrapure water three times, then with thieving paper the moisture on the seedling is blotted, and in the kraft bag of packing into, is put into 90 ℃ of baking ovens, dries to constant weight.
(2) mensuration of paddy rice potassium, Na ion concentration.Material is used scales/electronic balance weighing after drying by the fire well, then is put in the 50ml centrifuge tube, adds the acetum of 0.1M, and 90 ℃ of water-bath 3h put upside down mixing 5-6 time during water-bath.Pour extracting solution into the 2ml centrifuge tube, the centrifugal 5~10min of 12,000rpm gets supernatant, is diluted to suitable concentration with distilled water, measures K with Thermo Elemental SokaarAA type atomic absorption spectrophotometer
+, Na
+Content.Twice of each sample replication.Get twice mean value, calculate the K of every milligram of dry weight
+, Na
+Content (Fig. 2).
Location and the clone of embodiment 3:KEA1 gene
(1) target group.With the hybridization of kea1 and long-grained nonglutinous rice strain Guanglu ai 4, selfing obtains F2 generation, select wherein for the plant that bleaches of arteries and veins adaxial and its surface specificity in the blade be target group.
(2) paddy DNA extracts.Adopt modified CTAB method.Easy steps is as follows: get blade 0.1-0.2 gram (about half sheet) and be put in the little mortar, add an amount of liquid nitrogen, be ground at once powdery, the 2ml centrifuge tube of packing into, add the 1.5xCTAB solution of 100 ℃ of preheatings of 700ul in centrifuge tube, put into 56 ℃ of water-baths behind the careful mixing, take out centrifuge tube after 20 minutes, add equal-volume chloroform/primary isoamyl alcohol, fierce mixing, centrifugal (13000rpm) 10 minutes gets supernatant in new pipe, puts more than half an hour for-20 ℃ behind the adding 900ul dehydrated alcohol mixing.The DNA that separates out is centrifugal, 14000rpm (10 minutes).Remove supernatant, will precipitate with 1ml70% ethanol and clean once, centrifugal drying is dissolved in 200ul 1/10TE or the water, 4 ℃ of Refrigerator stores.
(3) InDel molecular marker analysis.This lab design 132 pairs of polymorphism marks, the SSR primer according to the sequence delivered synthetic (
Http:// www.gramene.org/microsat/ssr.html), other InDel molecule marker designs are according to the nucleotide sequence of having announced that compares 9311 liang of strains of the japonica rice warm and fine long-grained nonglutinous rice of Japan, partial design primer to difference, verify 2 parent japonica rice 9522 and the wide land of the long-grained nonglutinous rice polymorphism between short, the pcr amplification program is: in the 10ul system, and 1ul template, 1ul 10pmol/ulPrimer1,1ul 10pmol/ul Primer2,1ul 10 * Buffer (Mg
2+), 1ul 2mM dNTP, 0.1ul Taq, 3.9ul water.PAGE gel electrophoresis by 6%, silver staining method detects.
(4) the first localization method of colony's compartment analysis (bulked segregant analysis).
Use these polymorphism marks and carry out the pcr amplification analysis, find that in 250 target groups mutator gene is chain with MarkerRM5503 and RM2578 performance on No. 4 karyomit(e), further enlarge target group (700) and design other this gene of polymorphism mark location finding and be in apart from between the CH413 of 122kb and two Marker of CH415; When target group enlarges 2467 recessive monomers more at last, find that this gene is in apart between the SN10 of 46kb and two Marker of SN11 (Fig. 3 A).In this 46kb scope, 7 candidate genes are arranged, comprising 3 prediction chloroplast(id) gene locations.By these 3 candidate gene sequencing analysis are shown, mutant has the disappearance (Fig. 3 B) of 4 bases in the coding region of Os04g58620 gene, a potassium ion efflux antiporter albumen of this genes encoding KEA1, this deletion mutantion causes this protein expression premature termination.
With molecule marker the individual plant that bleaches of arteries and veins adaxial and its surface specificity in the blade in the target group is carried out gene type assay, utilize the linkage map (Fig. 3) of the molecule marker of MapDraw V2.1 establishing target gene region.Sequence such as the table 1 of used mark:
Table 1InDel molecule marker and nucleotide sequence thereof
Embodiment 4:KEA1 functional analyses of genes
For the further function of this gene of checking, change the genome nucleotide sequence of encoded K EA1 gene over to mutant kea1 and wild-type 9522 plant, observe whether to make mutant return to the wild-type phenotype.From the paddy rice fine BAC clone of Japan (OsJNBa0032F06), amplify the genome sequence fragment of the 11977bp of KEA1 gene shown in SEQ ID NO.4 with primer COM12-1F:5 ' cgggatcccgAATGTTTGTATTTCTATGCTGTTGGTT 3 ' and COM12-3R:5 ' gtcgacTACGGGATGGTAGAAATGGAT 3 '.This fragment is inserted into binary vector pCAMBIA1301 carrier for rice transformation by BamHI and SalI; Whether sequence verification is correct, and this carrier imports Wild Type Agrobacteria EHA105 by electric shock, uses the genetic transformation means to transform mutant kea1 and wild-type 9522 mature embryo callus, can make mutant return to the wild-type phenotype to observe.T
0In generation, obtain complementary plant, and Fig. 4 shows T
0The generation complementation is expressed the wild-type phenotype that plant shows with crossing.
Described Wild Type Agrobacteria EHA105 is Agrobacterium tumefaciens (Agrobacterium tumefaciens) COM12-p1301, be preserved in Chinese common micro-organisms culture presevation administrative center (CGMCC) on April 29th, 2011, preserving number CGMCC No.4820, preservation mechanism address is: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City institute of microbiology of the Chinese Academy of Sciences, postcode: 100101.
In order further to verify the function of this gene, change the nucleotide sequence of encoded K EA1 gene over to mutant kea1 and wild-type 9522 plant, observe the phenotype that whether can make mutant return to the wild-type phenotype and cross the appearance of expressing K EA1 gene in wild-type.From the paddy rice fine cDNA clone of Japan (J033101J11), amplify the cDNA sequence fragment of the 3465bp of KEA1 gene shown in SEQ ID NO.1 with primer OVEX12-9F:5 ' gactagtcATGGATTTGTCTAGGTTTACTGCC 3 ' and OVEX12-9R:5 ' ccttaattaaggTCAAATCGCCAATGCTCCA 3 '.This fragment is inserted into the binary vector pCAMBIA1300 carrier that is used for rice transformation of transforming with the Ubiquitin promotor by SpeI and PacI.Structure obtains p1300:Pro
Ubiquitin: the KEA1 carrier, import Agrobacterium EHA105 by electric shock, use the genetic transformation means to transform mutant kea1 and wild-type 9522 mature embryo callus, to observe the phenotype that whether can make mutant return to the wild-type phenotype and cross the appearance of expressing K EA1 gene in wild-type.T
0In generation, obtained the expression plant, and Fig. 4 shows T
0Generation complementary (com) and cross expression (ovex) and transform respectively 9522 and the wild-type phenotype that shows of kea1 plant.
Embodiment 5:KEA1 Assay of promoter activity
From paddy rice 9522 genomes, use primer KEA1-pF:5 ' cg
GgatccCgAATGTTTGTATTTCTATGCTGTTGGTT 3 ' and KEA1-pR:5 ' catg
CcaaatggCCCCACGCGCCCCCTGTAC 3 ' amplifies and contains the 3018bp fragment of KEA1 promoter sequence shown in SEQ ID NO.3.The KEA1 promotor that amplification obtains is inserted among the binary vector pCAMBIA1301 by BamHI and NcoI.Structure obtains p1301:Pro
KEA1: the GUS carrier is converted in wild-type 9522 Rice Callus by agriculture bacillus mediated method.The expression pattern of the activation analysis KEA1 promotor by analyzing beta-galactosidase, in tiller bud, root, stem, leaf, small ear and the Xiao Hua of genetically modified heterozygote plant, dye by the GUS staining fluid, tissue after the dyeing is processed with 75% ethanol decolorization, finds that KEA1 obstructs (E is left), spends the vascular bundle in (E is right) that expression (Fig. 6) is all arranged at tiller bud (A), root (B), stem (a C left side), stipes (C is right), leaf (a D left side), leaf sheath (D is right), the branch of paddy rice.
The activation analysis of embodiment 6:KEA1 signal peptide
From the paddy rice fine cDNA clone of Japan (J033101J11), amplify the nucleotide sequence fragment that includes the coded signal peptide of the 300bp of KEA1 gene cDNA sequence shown in SEQ IDNO.5 with primer Sig-1F:5 ' ccacatgtggATGGATTTGTCTAGGTTTACTGCC 3 ' and Sig-3R:5 ' gaagatctCTCGGTATTATCGACTACTGAGCC 3 '.This fragment is inserted in the binary vector pCAMBIA1301 carrier of transforming with the eGFP label by AflIII/NcoI and BglII.Structure obtains p1301:Sig
KEA1: the eGFP carrier, import Agrobacterium GV3101 by electric shock, use Agrobacterium injection instantaneous conversion means transformation of tobacco blade, pass through fluorescence and the chlorophyll autofluorescence situation of confocal laser scanning microscope GFP behind the 48h.Obtain the KEA1 protein localization on chloroplast(id) by observation analysis, the KEA1 signal peptide is included among the 100aa of this 300bp sequence fragment coding (Fig. 7, the location situation as shown by arrows).
Described Agrobacterium GV3101 is Agrobacterium tumefaciens (Agrobacterium tumefaciens) Sig12-10-3-eGFP-p1301, be preserved in Chinese common micro-organisms culture presevation administrative center (CGMCC) on April 29th, 2011, preserving number CGMCC No.4823, preservation mechanism address is: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City institute of microbiology of the Chinese Academy of Sciences, postcode: 100101.
The application of embodiment 7:KEA1 albumen
For KEA1 albumen is used, make up the carrier of gene RNAi, and transformed wild-type 9522 plant, in the hope of reducing the expression of KEA1, change the level that potassium ion effluxes in the rice plant thereby reach.From the paddy rice fine cDNA clone of Japan (J033101J11), amplify the specific fragment of the 361bp of KEA1 gene cDNA sequence with primer RI12-1F:5 ' GAGCTCAAGCTTCGATAATACCGAGGACGAAG 3 ' and RI12-1R:5 ' GGATCCCTGCAGCCCGACTGATCCCCTTTT 3 '; Amplify the conservative property fragment that is in the ionic channel structural domain of the 437bp of KEA1 gene cDNA sequence with primer RI12-3F:5 ' GAGCTCAAGCTTCTGTGGTGGTCCTGTTGATA 3 ' and RI12-3R:5 ' GGATCCCTGCAGAGAGATTGCTGGGAAGTTTG 3 '.With these 2 fragments respectively by HindIII/BamH1 and the forward and reverse pTCK309 carrier that is inserted into for RNAi of SacI/PstI; Sequence verification is correct, and this carrier uses the genetic transformation means to transform wild-type mature embryo callus by the Agrobacterium EHA105 of the degeneration-resistant strain of electric shock Introduced into Rice.T
0In generation, obtain the RNAi plant, and Fig. 7 shows T
0For the mutation type surface that the RNAi plant shows, arteries and veins bleaches in the blade of RNAi paddy rice, and this impact may be by regulating chloroplast(id) potassium ion efflux antiporter, K/Na than realizing apparently higher than wild-type.
The Agrobacterium EHA105 of described paddy rice anti contravariance strain is Agrobacterium tumefaciens (Agrobacterium tumefaciens) RI12-1-pTCK309, be preserved in Chinese common micro-organisms culture presevation administrative center (CGMCC) on April 29th, 2011, preserving number CGMCC No.4821, preservation mechanism address is: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City institute of microbiology of the Chinese Academy of Sciences, postcode: 100101.
This shows that the KEA1 gene of cloning is to cause the bleach gene of phenotype of arteries and veins adaxial and its surface specificity in the kea1 mutant blade.
In sum, present embodiment is by the mutant kea1 that bleaches of arteries and veins adaxial and its surface specificity in the new rice recessive blade, by hereditary localization method, be separated to new chloroplast(id) potassium ion efflux antiporter albumen and a gene order thereof, this albumen has obvious effect aspect chloroplast(id) potassium ion efflux antiporter and the regulation and control leaf look, can utilize this gene can produce the degeneration-resistant strain of new paddy rice cross breeding by the means generation of genetic engineering, be used for the new anti-adversity of seed selection, have very important application potential in agriculture production.
Claims (8)
1. application for the preparation of the rice potassium ion efflux antiporter albumen of paddy rice anti contravariance strain, it is characterized in that, the nucleotide sequence of this KEA1 gene is shown in 1-3465 position among the SEQ ID NO. 1, utilize the RNAi technology to suppress the expression of KEA1 gene in the paddy rice, thereby the characteristic in the transportation of control paddy rice potassium ion is produced the paddy rice anti contravariance strain by suppressing this protein expression.
2. application according to claim 1 is characterized in that, the host cell of described albumen is eukaryotic cell, specifically from paddy rice.
3. an Agrobacterium EHA105 who uses the paddy rice anti contravariance strain is characterized in that, is Agrobacterium tumefaciens Agerobacterium tumefaciens, and its preserving number is CGMCC No. 4821, and preservation date is: on April 29th, 2011.
4. the application of a KEA1 signal peptide is characterized in that, the aminoacid sequence of KEA1 signal peptide is shown in SEQ ID NO.5, and it is used for the KEA1 protein localization at chloroplast(id).
5. application according to claim 4 is characterized in that, described chloroplast(id) is from tobacco leaf.
6. application according to claim 5, it is characterized in that,, this fragment is inserted into to transform with making up in the binary vector pCAMBIA1301 carrier of eGFP label by AflIII/NcoI and BglII obtains p1301:Sig as albumen chloroplast(id) localization signal peptide by primer amplification SEQ ID NO.5
KEA1: the eGFP carrier, import Agrobacterium GV3101 by electric shock, use Agrobacterium injection instantaneous conversion means transformation of tobacco blade to be achieved.
7. application according to claim 6 is characterized in that, described primer sequence is:
Sig-1F:?5'?ccacatgtggATGGATTTGTCTAGGTTTACTGCC?3',
Sig-3R:?5'?gaagatctCTCGGTATTATCGACTACTGAGCC?3'。
8. the Agrobacterium GV3101 that application according to claim 6 obtains is characterized in that, is Agrobacterium tumefaciens Agerobacterium tumefaciens, and its preserving number is CGMCC No. 4823, and preservation date is: on April 29th, 2011.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110161173 CN102250228B (en) | 2011-06-15 | 2011-06-15 | Method for improving rice potassium ion efflux antiporter |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110161173 CN102250228B (en) | 2011-06-15 | 2011-06-15 | Method for improving rice potassium ion efflux antiporter |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102250228A CN102250228A (en) | 2011-11-23 |
CN102250228B true CN102250228B (en) | 2013-05-01 |
Family
ID=44977827
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201110161173 Expired - Fee Related CN102250228B (en) | 2011-06-15 | 2011-06-15 | Method for improving rice potassium ion efflux antiporter |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102250228B (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2016025334A1 (en) * | 2014-08-10 | 2016-02-18 | Carnegie Institution Of Washington | Photosynthetic acclimation and increased biomass production in fluctuating light environments |
CN106831966B (en) * | 2015-12-03 | 2021-01-15 | 中国科学院分子植物科学卓越创新中心 | Gene for enhancing saline-alkali stress tolerance of plants and application thereof |
CN109553667B (en) * | 2018-11-14 | 2021-08-31 | 贵州省烟草科学研究院 | Tobacco KUP2 gene and application thereof |
CN113862296B (en) * | 2021-09-03 | 2024-04-19 | 上海交通大学 | Construction and application of rice jasmin biosensor J6V-HM |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101443355A (en) * | 2006-04-13 | 2009-05-27 | 巴斯福植物科学有限公司 | Active potassium channel transporters (akt) and their use tocreate stress tolerant plants |
-
2011
- 2011-06-15 CN CN 201110161173 patent/CN102250228B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101443355A (en) * | 2006-04-13 | 2009-05-27 | 巴斯福植物科学有限公司 | Active potassium channel transporters (akt) and their use tocreate stress tolerant plants |
Non-Patent Citations (6)
Title |
---|
AL606641.3;Feng Q et al;《GenBank》;20050416;1-4 * |
Feng Q et al.AL606641.3.《GenBank》.2005,1-4. |
NM_001060834.1;Tanaka T. et al;《GenBank》;20100608;1-4 * |
NP_001054299.1;Tanaka T. et al;《GenBank》;20100608;1-3 * |
Tanaka T. et al.NM_001060834.1.《GenBank》.2010,1-4. |
Tanaka T. et al.NP_001054299.1.《GenBank》.2010,1-3. |
Also Published As
Publication number | Publication date |
---|---|
CN102250228A (en) | 2011-11-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104830847B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9936 | |
CN105087634A (en) | Plants having enhanced yield-related traits and a method for making the same | |
WO2020108031A1 (en) | Soybean photosynthesis-related gene gmgrf5-1, coded protein thereof and use thereof | |
CN107602681A (en) | The wide gene GW5L of rice grain and its application | |
CN108530524A (en) | The application of birch-leaf pear Pb4RMYB genes and its coding albumen in improving plant salt endurance | |
CN106029883A (en) | Salt-tolerance-controlling gene qNaCl3 on soybean chromosome 3, and use thereof | |
CN102459615B (en) | Drought tolerant plants | |
CN109536509A (en) | Sesame drought resisting, moisture-proof and resistant gene of salt SiNAC56 and its coding albumen and application | |
CN104878092B (en) | Nucleic acid sequence and its detection method for detecting corn plant DBN9953 | |
CN110643618A (en) | Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants | |
CN103732615A (en) | Use of jaz5A for improving drought-resistance in a plant | |
CN107840872A (en) | Albumen and the application of wax plum CpWOX13 genes and its coding | |
CN103154254A (en) | Plants having enhanced yield-related traits and method for making the same | |
CN102250228B (en) | Method for improving rice potassium ion efflux antiporter | |
CN103387609A (en) | Gene capable of improving anti-stress capability of plants and application thereof | |
CN102766618A (en) | Rice OsICL protein and coding gene thereof, and application of the two | |
CN106701814A (en) | Method for adjusting content of starch in tuber leaves, and application thereof | |
CN103172715B (en) | Plant epidermal hair controlling gene and application thereof | |
CN103503777B (en) | The carrier of glutamate receptor polypeptide gene application and method | |
CN107022563A (en) | Genetically modified plants | |
CN102477435A (en) | Method for improving plant drought resistance using Poncirus trifoliata transcription factor gene PtrABF | |
CN109971763A (en) | Florescence control gene C MP1 and relevant carrier and its application | |
CN102618516B (en) | Low-phosphorus resistant gene and application thereof | |
CN102732553B (en) | Improve the gene engineering method and material of plant products | |
CN101186919B (en) | Protein coded sequence for regulating and controlling temperature and light sensitive nuclear sterility |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130501 Termination date: 20180615 |