CN108165641B - Method for identifying striped mussels - Google Patents

Abstract

The invention provides a method for identifying striped mussels, which is to perform PCR amplification on an individual to be detected in the genus Mytilus by using a primer pair, and then perform genotyping on an amplification product, wherein the sequence of a nucleotide fragment corresponding to the striped mussel is SEQ ID NO. 1. The SNP sites capable of identifying the striped mussels are obtained by screening, and by detecting the SNP sites, the striped mussels can be subjected to genotyping by using a high-resolution melting curve method. The method identifies the variety of the striped mussel at the molecular level, and gets rid of the limitation of identifying by means of phenotype.

Description

Method for identifying striped mussels

Technical Field

The invention belongs to the technical field of shellfish molecular marker assisted breeding, and particularly relates to a method for identifying striped mussels.

Background

Mussels are classified as marine organisms of the phylum Mollusca (molllusca), class Lamellibranchia (Lamellibranchia), order heterophylla (Anisomyaria), family mytiludae (Mytilidae). Nearly 50 types of Chinese have been found, and the types of Chinese belong to 18 genera. The shells are triangular, and the surface of the shells is provided with a layer of bright black coat. Besides being connected at the back, the two mantles also have healing drainage holes at the back ends, and the edges of the back ventral surfaces of the mantles have a plurality of branch-shaped tentacles. There are two adductor muscles, one smaller in the front and one larger in the back, which open the adductor shells using the adductor muscles and ligaments, there are often gaps between the two valve shells, and the filaments of the foot secretion extend from the gaps and are anchored to the rocks or other objects. Mussel food intake is also obtained passively from the water flow through its body, as are other bivalve mollusks.

Striped mussel (Septiferviargatus) is a warm water wide-distribution species. But only in the western pacific region, japan has a distribution from north sea to the luck ball group island, south to east and south sea. It is a common species in the middle and lower regions of the intertidal zone, but is more densely concentrated in the water region from the low tide line to about 8 m below the tide line. The shell is wedge-shaped, has medium size, and is generally 45.5 mm long, 26 mm high and 21 mm wide. The top of the shell is sharp and is positioned at the front end. The height of the raised ribs on the shell surface is lower, and the whole shell surface is provided with fine radiating ribs; the ribs are bifurcated and low, some individuals are often not obvious, and the distance between the ribs is wide. The surface of the shell is purple brown, the top is light purple and light pink, and the inner surface of the shell is grey blue and sometimes light red; the muscle mark is obvious, the periphery of the shell is provided with a thin notch, and a small triangular clapboard is arranged below the top of the shell. The hinge is narrow and has only 1-3 granular small protrusions. The coat is thin, and the edge of the coat is provided with folds or tentacles. The anterior adductor muscle is small and is positioned on the clapboard; the posterior adductor muscle is large and meniscus-shaped. The byssus hole is slightly shown; the byssus is well developed.

At present, the mussel species are classified by adopting external morphological characteristics such as shell shapes, hinged teeth and the like, but the mussel species are similar in appearance in a floating period and a juvenile stage, and natural hybridization individuals, shelling and vending individuals and individuals with phenotypes molded by environments are difficult to distinguish by the appearance alone. Moreover, with the wide application of molecular marker-assisted genetic breeding in the field of aquatic products, a set of efficient and practical mussel variety identification method needs to be developed, so that a powerful basis is provided for the production and seedling culture, scientific research and market consolidation of mussels.

Disclosure of Invention

The invention aims to provide a method for identifying striped mussels, which can effectively distinguish striped mussels (Septifervvirgatus) from common mussels (Mytilus edulis), perna viridis (pernaviris) and Mytilus coruscus (Mytilus coruscus) which are mainly cultured at present, so that the research on hybridization and strain purification of striped mussels is effectively carried out.

The invention relates to a method for identifying striped mussels, which comprises the steps of carrying out PCR amplification on an individual of mussels to be detected by using a primer pair, and then carrying out genotyping on an amplification product, wherein the sequence of a nucleotide fragment corresponding to the striped mussels is SEQ ID NO. 1;

TACTCTAGGGATAACAGCGCAATCTTTTAGGATAGTTGAAATTGGTTAAATGGTTTGCGACCTCGATGTTGGCTTT

wherein the genotyping is performed by adopting a high-resolution melting curve method or sequencing;

the method, wherein the sequence of the upstream primer of the primer pair is as follows:

5′-TACTCTAGGGATAACAGCGCAAT-3′(SEQ ID NO:2)

the sequence of the downstream primer is as follows:

5′-AAAGCCAACATCGAGGTCGC-3′(SEQ ID NO:3)。

the SNP sites capable of identifying the striped mussels are obtained by screening, and the striped mussels can be genotyped by detecting the SNP sites and utilizing a high resolution melting curve (HRM) method. The method identifies the variety of the striped mussel at the molecular level, and gets rid of the limitation of identifying by means of phenotype.

Drawings

FIG. 1: an alignment chart of SNP sites of perna canaliculus (S.virgatus) and perna viridis (P.viridis), Mytilus edulis (M.edulis) and Mytilus coruscus (M.coruscus);

FIG. 2: HRM typing result graph of primer detection SNP locus.

Detailed Description

The SNP refers to DNA sequence polymorphism caused by single nucleotide variation, including base substitution, insertion or deletion. The SNP has the following advantages: (1) the locus is rich. Both coding and non-coding regions of genes are abundantly distributed. (2) And (4) genetic stability. The single nucleotide mutation rate is 10-9, and the SSR has higher genetic stability compared with SSR, and the SNP molecular marker is developed by utilizing the characteristic for identifying the species. (3) And (5) character relevance. Certain SNPs may directly affect the structure and function of proteins, are associated with resistance and tolerance of organisms, and thus finding them may mean finding the genetic nature of certain diseases. (4) The automatic operation is convenient. Compared with the traditional detection technologies based on gel electrophoresis, such as RFLP, RAPD, AFLP and the like, the detection and the typing of the SNP can be realized by utilizing more precise and efficient technologies, such as micro sequencing, capillary electrophoresis, HRM technology and the like, the efficiency is higher, and the result is more accurate. The invention is completed on the basis of obtaining the specific SNP locus of the striped mussel.

The high-resolution melting curve (HRM) is a new gene analysis technology which forms different form melting curves based on different melting temperatures of mononucleotides, has extremely high sensitivity, can detect the difference of single base, has low cost, high flux, high speed and accurate result, is not limited by detection sites, and realizes real closed-tube operation. The HRM analysis technology plays an important role in mutation scanning, single nucleotide polymorphism analysis, methylation research, genotyping, sequence matching and the like.

The method for extracting DNA used in the present invention is as follows:

extracting genome DNA by using a Tianlong animal tissue DNA extraction kit, which comprises the following specific steps:

(1) a small amount of adductor muscle of adult shellfish is cut into a 1.5ml centrifuge tube, the shellfish sample is put into the centrifuge tube with shell, 20 mul proteinase K, 200 mul lysate and a proper amount of ceramic beads are added.

(2) The centrifuge tube was placed in a BioPrep-24 biological sample homogenizer and shaken for 2min at a linear velocity of 6.0m/s to 7.0 m/s.

(3) The disrupted tissue is kept at 55 deg.C for 1-3 hr in a dry thermostat, and is shaken occasionally to promote tissue lysis until the solution is clear and transparent, and then centrifuged at 12000 rpm for 5 min

(4) And (3) sucking 200 mu L of sample mixed liquor into a pore plate matched with the DNA extraction kit, adding 20ul of magnetic beads and 200ul of absolute ethyl alcohol, and performing automatic extraction of animal tissue DNA in a Tianlong NP968 type full-automatic nucleic acid extractor.

(5) The concentration and purity of the DNA was determined using a NanoDrop 2000(Thermo Scientific, USA) spectrophotometer, and the samples were numbered and placed at-20 ℃ until use.

The present invention will be described in detail with reference to examples.

Example 1 screening of SNP sites and primer design screening

1. Species identification by sequence acquisition and alignment analysis

Ribosomal sequences of Mytilus edulis, Mytilus coruscus, perna viridis, and Mytilus edulis obtained in NCBI database, and aligned using AlignX (a component of Vector NTI Suite 7.1) software to find regions where there is a base difference in at least two Mytilus coruscus.

Finally obtaining the total length 531bp of the consensus sequence, wherein the consensus sequence is used as a reference in the 378-453 interval (total 76bp) of the sequence, and the counting positions of the SNPs are as follows: 397, 401, 403, 405, 406, 407, 410, 413, 414, 416, 417, 421, 423, 424, 425, 426, 427, 428, 429, 431, 434, in total 21 SNP sites. Wherein the nucleotide sequence of the segment corresponding to the striped mussel is SEQ ID NO. 1.

2. Primer design and screening

The primer design should satisfy the following conditions: the target amplification sequence is between 50 and 150 bp; in order to make the melting temperatures different, there is a difference in the GC base content between the sequences; the annealing temperature (Tm) should be between 50 and 60 ℃; mismatch, hairpin structure and primer dimer should be avoided as much as possible between the positive and negative primers; the primers were synthesized by Shanghai Biotech, Inc. Randomly selecting 5 corresponding mussel DNA samples as templates, primarily screening primers by using an agarose gel electrophoresis technology, and selecting a primer combination capable of amplifying a bright single band for HRM analysis.

3. HRM analysis

Use of

480 saturated fluorescent dye HRM kit comprising: 10 μ L

480HRM Master Mix with

dye (Roche diagnostics), forward and reverse primers 10. mu. mol each, 30ng DNA template, 1.6. mu.L Mgcl2, and water to 20. mu.L. The PCR reaction and the melting curve analysis of the product are carried out simultaneously

480 real-time quantitative analyzer (Roche Diagnostics). The reaction procedure was as follows:

after PCR amplification is finished, the program automatically runs a high-resolution melting curve program, and fluorescence is collected for 25 times at 1 ℃ per liter. Use of

Tm value analysis and genotyping were carried out using Tm Calling and Gene Scanning Software 1.5 carried on 480.

4. Sequencing validation

For SNP sites capable of being obviously typed, corresponding PCR products are randomly selected for sequencing, sequencing results of various genotypes are compared and analyzed, and the difference of the base compositions among the SNP sites is observed. Sequencing the PCR products corresponding to each genotype curve, comparing and analyzing the sequencing results of various genotypes, and observing the difference of the base compositions.

The sequence information of the primers obtained by the final screening is shown in the following table:

120 samples for intervarietal identification were collected from coastal intertidal zones of various mussel-represented areas (Table 2), morphologically preliminarily identified, and adduced to test tubes, with absolute ethanol, and stored in a refrigerator at-20 deg.C.

Table 2: mussel individual information table to be detected

The results show that the results of 120 sample DNAs amplified and sequenced by common PCR are consistent with the results of HRM analysis, and that the SNP sites and the detection primers provided by the invention can effectively distinguish the striped mussels from other common cultured mussels (FIG. 2).

Sequence listing

<110> Ningbo university

<120> method for identifying striped mussels

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 76

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tactctaggg ataacagcgc aatcttttag gatagttgaa attggttaaa tggtttgcga 60

cctcgatgtt ggcttt 76

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tactctaggg ataacagcgc aat 23

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaagccaaca tcgaggtcgc 20

Claims (1)

1. A method for identifying striped mussels is characterized in that the method comprises the steps of carrying out PCR amplification on an individual to be detected in the genus Mytilus by using a primer pair, and then carrying out genotyping on an amplification product, wherein the sequence of a nucleotide fragment corresponding to the striped mussels is SEQ ID NO: 1; the genotyping is carried out by adopting a high-resolution melting curve method; wherein, the sequence of the upstream primer is SEQ ID NO. 2, and the sequence of the downstream primer is SEQ ID NO. 3.

Images