CN104450697B - SNP marker associated with oyster antiviral properties and application thereof - Google Patents

SNP marker associated with oyster antiviral properties and application thereof Download PDF

Info

Publication number
CN104450697B
CN104450697B CN201410723155.8A CN201410723155A CN104450697B CN 104450697 B CN104450697 B CN 104450697B CN 201410723155 A CN201410723155 A CN 201410723155A CN 104450697 B CN104450697 B CN 104450697B
Authority
CN
China
Prior art keywords
snp marker
concha ostreae
snp
oyster
characterised
Prior art date
Application number
CN201410723155.8A
Other languages
Chinese (zh)
Other versions
CN104450697A (en
Inventor
管旭东
张琳琳
李莉
张国范
Original Assignee
中国科学院海洋研究所
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 中国科学院海洋研究所 filed Critical 中国科学院海洋研究所
Priority to CN201410723155.8A priority Critical patent/CN104450697B/en
Publication of CN104450697A publication Critical patent/CN104450697A/en
Application granted granted Critical
Publication of CN104450697B publication Critical patent/CN104450697B/en

Links

Abstract

The invention belongs to the fields of molecular biology and genetic breeding and in particular relates to an SNP marker associated with oyster antiviral properties and an application thereof. The SNP marker is positioned on a TLR2-1 (CGI_10005421) single exon gene in a Pacific oyster TLR immune pathway. The SNP marker and the application disclosed by the invention have the advantages that oyster parents can be subjected to genotype identification during young oyster breeding, and the oyster parents with the genotypes of A/A or A/C are screened, so that the antiviral properties of offspring groups are improved.

Description

A kind of SNP marker relevant to Concha Ostreae ntiviral characteristic and application thereof

Technical field

The invention belongs to molecular biology and genetic breeding field, be specifically related to one and Concha Ostreae ntiviral characteristic shape phase The SNP marker closed and application thereof.

Background technology

Long Concha Ostreae, is under the jurisdiction of Mollusca, lamellibranchiata/Bivalvia.Long Concha Ostreae originates in pacific China, day This and Korea, after introduced a fine variety to American-European continent.Due to long Concha Ostreae fast growth, meat flavour is delicious and environmental suitability waits by force spy Point, has the highest edible and economic worth, is increasingly becoming the shellfish kind of China's important cultivation in the even world.

So far, multiple bivalve shellfish has been detected by worldwide OsHV-1, and OsHV-1 is demonstrate,proved Bright relevant with the massive mortality of larva, in breeding season, the massive mortality of larva also brings huge economy for aquaculture Loss.

PRR concept is proposed in 1989 for the first time by Charles Janeway, and the nearest more than ten years are about the micro-life of cell recognition The knowledge of the mechanism of thing cause of disease is explosive growth.Will be apparent from now knowing that a few quasi-mode identification receptor family PRRs exists In cell micro-environment, can identify and virus infection.TLR family be at present research more and also the most clearly PRR family it One.Simplex virus particles can be identified by TLR2, TLR2 may identify herpesvirus glycoprotein, then induction of pro-inflammatory cell because of The expression of son.

SNP is single nucleotide polymorphism, and as the molecular marker of latest generation, SNP leads in marine fishery heredity, breeding etc. Territory the most gradually demonstrates huge application potential.In Concha Ostreae genome, average every 20-30bp just has a SNP existence. Snp analysis technology is broadly divided into two big classes by the character of object of study: one is to be analyzed unknown SNP, i.e. determines certain section With or without the existence of SNP in sequence, or determine whether a certain unknown SNP exists with certain character and associate;Two is to known SNP is analyzed, and i.e. to carrying out the analysis of known SNP site genotype in different groups or individuality, determines each one by one The individual genotype for some SNP, and then carry out the research work such as subsequent gene location or association analysis.Summary of the invention

It is an object of the invention to provide a kind of SNP marker relevant to Concha Ostreae ntiviral characteristic character and application thereof.

For achieving the above object, the technical solution used in the present invention is:

The SNP marker that a kind of and long Concha Ostreae ntiviral characteristic is relevant, SNP marker is positioned in long Concha Ostreae TLR immune pathway In the single exon genes of TLR2-1 (CGI_10005421).

Described SNP marker is positioned at the leucine enrichment C end identification domain (Leucine of TLR2-1 gene protein molecule Rich repeat C-terminal domain) on.

Described SNP marker is positioned at (base sequence shown in SEQ ID NO.1 at 5 ' the 858th bases of end shown in SEQ ID NO.1 At 286th aminoacid of the aminoacid sequence coded by row) base be A or C.

Described SNP genotype in genomic DNA is A/A, A/C or C/C.

A kind of application of the SNP marker relevant to long Concha Ostreae ntiviral characteristic described in claim 1, described SNP marker The application in the antiviral gene type of parent shellfish before identifying seed breeding.

The authentication method of the SNP marker relevant to long Concha Ostreae ntiviral characteristic character, comprises the following steps that

1) OsHV-1 (Concha Ostreae herpes one type virus) the wild long Concha Ostreae colony of artificial challenge is used, screening death at first 100 individualities (TM group) and last dead 100 individualities (TF group).

2) extraction step 1) in two group leader's Concha Ostreae genes of individuals groups DNA.

3) take above-mentioned steps 2) in 100 individual DNA of gained of TM group, the DNA mixed in equal amounts of each individuality is mixed as TM Pond;Take 100 individual DNA of gained of TF group, the DNA mixed in equal amounts of each individuality is mixed pond as TF.

4) by step 3) two genes of gained mix pond and utilize secondary sequencing technologies to carry out full-length genome to resurvey sequence.

5) step 4) described in sequence of resurveying terminate after, two mixed ponds order-checking gained sequences are compared with Concha Ostreae genome, Carry out the examination of full-length genome SNP site;

6) choosing Concha Ostreae immunity related keyword pathway gene as candidate gene, design primer, the specificity of SNP site draws Thing sequence is (concentration 10uM):

Forward primer sequence F:5 '-GAATATTATCTATTCACTACATACCTGACATG-3 ';

Reverse primer sequences R:5 '-GGATCAATATGTACTAGTTTGTTGAAGG-3 '

Utilize PCR Amplification Technologies that candidate gene purpose fragment is carried out amplification in vitro.PCR response procedures:

7) by step 6) gained amplified production entrust Sani bio tech ltd, Shanghai it is carried out generation Sanger Order-checking.

8) to step 7) described sequencing result uses auxiliary software that its order-checking peak figure is carried out manual analysis and statistics.

9) by step 8) analytic statistics result uses plink software to be associated analyzing with antiviral character to it, labelling SNP。

By to TM, TF Liang Ge colony this SNP site genotype with see that viral functionality shape is associated analyzing, find Antiviral colony TF genotype is more biased towards in A/A or A/C, and virus sensitive population TM genotype is more biased towards in C/C (P < 0.05).

Show according to result above identification marking SNP result: going out genotype in above-mentioned SNP site is the individual of A/A or A/C Body is insensitive to virus, stronger to virus resistance;Genotype be C/C individuality to virus rdativery sensitive, more weak to virus resistance.

A kind of specific primer of the SNP marker relevant to long Concha Ostreae ntiviral characteristic for detection, specific primer is:

Forward primer sequence F:5 '-GAATATTATCTATTCACTACATACCTGACATG-3 ';

Reverse primer sequences R:5 '-GGATCAATATGTACTAGTTTGTTGAAGG-3 '.

The test kit of a kind of SNP marker relevant to long Concha Ostreae ntiviral characteristic for detection, test kit contains forward and draws Thing sequence F:5 '-GAATATTATCTATTCACTACATACCTGACATG-3 ';

Reverse primer sequences R:5 '-GGATCAATATGTACTAGTTTGTTGAAGG-3 '

Advantage for present invention:

The SNP marker relevant to long Concha Ostreae antiviral is positioned at long Concha Ostreae TLR2-1 gene ORF (Open reading Frame, open reading frame) the 858th base at, the 286th aminoacid of aminoacid sequence, there is A and C two kinds in this base Form;Accordingly, there are two kinds of allelic forms of A and C in this SNP in genomic DNA, and this SNP site is the individual of A genotype Body is better than C genotype to OsHV-1 virus resistance;This SNP in genomic DNA the also corresponding existence A/A, A/ of genotype C, C/C tri-kinds (following genotype refers both to this SNP genotype in genomic DNA);Amino acid codes corresponding to this SNP There are GAA glutamic acid and two kinds of forms of GAC aspartic acid.

The present invention utilizes virus relevant Liang Ge colony full-length genome to resurvey SNP in the range of sequence screening inspection full-length genome On the basis of, then by round pcr, the specific region of particular candidate gene involved in immunity is expanded, then PCR primer is entered Row Sanger checks order, and checks checking SNP site, and to the gene frequency of SNP site and ntiviral characteristic association analysis, thus Mark and the SNP site of Concha Ostreae ntiviral characteristic significant correlation.This SNP marker is can to carry out parent shellfish before seed breeding Genotype identification (genotype is identified in the sampling of Concha Ostreae not damaged), by screening the close shellfish of A/A and A/C genotype, improves offspring group The ntiviral characteristic of body.The SNP that the Concha Ostreae ntiviral characteristic of labelling of the present invention is relevant has diving for aquatic products industry breeding It is being worth, is advantageously reducing the loss of oyster culture industry.

Accompanying drawing explanation

The PCR primer electrophoresis detection figure comprising SNP 10005421-858 that Fig. 1 provides for the embodiment of the present invention;

Various genotype bases order-checking characteristic peak figure that Fig. 2 provides for the embodiment of the present invention (there is set peak in first base, Illustrate that this site is C/T heterozygosis), this figure does not represent SNP peak of the present invention figure, is only said base peak diagram form at this Bright.

Detailed description of the invention

Explain the present invention below in conjunction with embodiment further, but the present invention is not done any type of limit by embodiment Fixed, experiment material used by the present invention is all from commercial.

Embodiment 1

With instantiation, above invention is further explained explanation below, concrete steps to specifications in SNP mirror Determine method, it may be assumed that

1) OsHV-1 (Concha Ostreae herpes one type virus) the wild long Concha Ostreae colony of artificial challenge is used, screening death at first 100 individualities (TM group) and last dead 100 individualities (TF group).TM is the sensitive group of virus, and TF is antiviral group.

2) respectively extraction step 1) in two group leader Concha Ostreae individuality gill tissue genomic DNAs.

3) take above-mentioned steps 2) in 100 individual DNA of TM group gained, the DNA mixed in equal amounts of each individuality is mixed as TM Pond, takes 100 individual DNA of TF group, is that TF mixes pond by the DNA mixed in equal amounts of each individuality.

4) by step 3) two genes of gained mix pond entrust BGI Technology Solutions Co., Ltd. use secondary survey Sequence technology carries out full-length genome to it and resurveys sequence.

5) step 4) described in sequence of resurveying terminate after, two mixed ponds order-checking gained sequences are compared with Concha Ostreae genome, Carry out the examination of full-length genome SNP site;

6) Concha Ostreae immunity related keyword pathway gene is chosen as candidate's base according to Concha Ostreae virus response expression modal data storehouse Cause, uses Primer Premier 5.0 software design primer, and the specific primer sequence of SNP site is (concentration 10uM):

Forward primer sequence F:5 '-

GAATATTATCTATTCACTACATACCTGACATG-3’;

Reverse primer sequences R:5 '-GGATCAATATGTACTAGTTTGTTGAAGG-3 '

Utilize PCR Amplification Technologies that candidate gene purpose fragment is carried out amplification in vitro.

PCR amplification system:

PCR response procedures:

7) by step 6) gained amplified production entrust Sani bio tech ltd, Shanghai it is carried out generation Sanger Order-checking, sequencing primer is step 6) described pcr amplification primer thing.

8) to step 7) described sequencing result use auxiliary software seqscape v2.7 is to its order-checking peak figure (as shown in Figure 2 Then sequenator can provide order-checking peak figure according to testing result specific recognition A, tetra-kinds of particular bases of T, G, C;If same position Point occurs that set peak illustrates that this loci gene type is these two kinds of base type heterozygosis, if this site occurs that a kind of peak illustrates this site Genotype is that this kind of base type is isozygotied) carry out artificial statistics and analysis, two groups of idiotype analytic statistics result such as table 1 institutes Show (wherein 00 is loss of learning).

9) by step 8) analytic statistics result uses plink software to be associated analyzing with antiviral character to it, labelling SNP, (aminoacid coded by base sequence shown in SEQ ID NO.1 at 5 ' the 858th bases of end as shown in SEQ ID NO.1 At 286th aminoacid of sequence).

By association analysis, find that antiviral colony TF gene frequency of A in SNP10005421-858 is significantly high In virus sensitive population TM, show SNP10005421-858 and Concha Ostreae ntiviral characteristic significant correlation, can be disease-resistant as Concha Ostreae The labelling of poison characteristic character assisted Selection, and make Concha Ostreae have Concha Ostreae blister sore at SNP10005421-858 allele A The resistance that poison one type (OsHV-1) is higher.

SEQ ID NO.1:

ATGATGCGGAAAGGAATAATGATGCTTTCTAGCCTATCTGTATTCTTAATGTTGATGTTTCTTGCTGGT TTATGTGACATGTGCCCCGTCTTACAGTGGGCAGGAAACAATGAAACAACTCTGAAATTTCTTACAAGGATGAAGAT TGTTTCAAACGACACGTTTAGTAATTGCGACAAAAGTGTTCACCATCTCTTAATGGATGACTTAGGAATAGAAGAGG TTTCCCACAATGCATTAGAAGATTTCTATAACCTGAAATCTTTATCGTTATCAGGAAATTATATTTCCGCGCTGTCA CCATTTTTACTGGAATACAAAAGAGGGTTGGAGTCTTTCAACATCGCAAATAATCGGCTCGAACGTATTGAGGACGG AACTTTTGAATATCTGGACAACGTAAAGGTAATTGAGCTCCAGTTTAACAACATTTCCTTTATCGGACCAGACGCTT TCTCAAGGAACCTCCGAGTTTTACAAACTGTAAACGTTTCCCATAATGCTCTAACATACGGAGAACCATGGCCATTT ATACCGGAAGCGGACCCAACGGACGGCGAGGATTTGGTGTTTGACCTCGAATACAATCATATCTCGGAATTCCGGAA CTCGCCTAACTGGACATACGATCTGGTTTCGCCCTTTGAGTACGACGTCAAGTTAAGTTTTAACAACATAACAAACA TTCATATTGATGATGTTGTACATATATTCAATCCGGGTTTCCAAGGAAATACATTCGTAGAATACTTGTCTTTTAAA ATCAATGCTTCTGAAAACCCTTTTTTCTGTGACTGTAATGTATATCCGTTTGCATCTTATTTGCGCGATTCGCTGTT TTATTTCTATAGAGTGGAAGAGTTCCGATACCGGTGTAACTCTCCTGATTCCTTGTCTCAAGAAGATTTCCTTCATG ATATTCCCCTTGAGCAGTTTGTGTGTAACGTCACCGAAAACTGTCCCGACGGCTGTATCTGTCAGGAGCGGCCTTAT TATGGATATCTTCACGTGAACTGTAGTTTCATGTACGGTTCTAACCAACAACCAATGAACACACTCCCTTTAACTCT TCCAACGTCCAAGAACGGCAAGATATCCTTACATCTGGATGGACACTACATCGCGTTACTAGAACAAAGGGGTTACC TTCCACAACTCGTAAATCTAACTCTCTCCTTCAACAAACTAGTACATATTGATCCAAAAGCTCTCACGTCCATGTCT GACAGACAATATCTAGATCTCTCACATAATTATCTCAAGTATGTGCCGAAAGAAATCCAGTATTTCAAGACGAATAA GGTTCGCATCGGTTCCAATCGCTTTGAGTGTAACTGCAACATGACTTGGATGGCCCAGTGGTTAAATCTGGATTCAA ACGCTCCTGCTTACAATGCCCAGTGTGAATACGATGACGGCAGCGAGCGTTATTTTATACGCGACATCACCGATTCT TTGCTCAAATGCAGCTTTGAGAACCTCATCATTATAATCAGTGTCGTCGTTGGCATCCTCATCGCAATAATCATCGG GGCAGCCGTCACGGCCAGACGGTGTCCGTACGAGACAAAGGTTCTGATGTTTCGACTCTTCGGAGTGCACCCTGCCG ACAAGTATCGCGTGGATTTGGAAGAACCACGTCAATACGACATCTATGTATCCCATTACGAACACGATTTACAGGCT AGACAATGGGTGAAATCAAAGTTCCTTCGCAAACTGGAAGAAAATCAAAAAAGAAAGTTCAAAGTCTTTTATTTCGA GCGAGATCTCAATGCTGGTACAGATATGTACGATGAATTAGTCACCCATATGAAACAATGCAGACGAATAGTGTTTA TACTAACTAATGATTTTTTCAATGATGAAAAGAATATCTTTGAGGCAGATCAAGCAGAGATAGAACATCGAGCGAGC GACAATCTGCATGGACGTGTCATATATTTGTTATGGAACGAGAGCGTGCGAGAAAAAATAAAATTGGACCCATGGAA GTCTCGAATGGAGGGTAAACGCGTGCTCTGTCCAGACGACAAGTTCTTCTGGTCTAAGATGAGATACGAACTGCCTT TCAAGGGGGTGCCTTAA

Length: 2088bp

Type: nucleic acid

Chain: double-strand

Topological structure: linear

Molecule type: DNA

Property name: cDNA

Source: long Concha Ostreae

Table 1

Embodiment 2

In test kit, each one-tenth is grouped into as follows:

Long Concha Ostreae individuality gill tissue's genomic DNA (15ng/ul);

Specific primer F;

Specific primer R;

Premixed type EXTaq polymerase Premix TaqTM(TaKaRa);

ddH2O。

The amplification system that in test kit, PCR reaction uses is calculated as with 25 μ l: 2ul long Concha Ostreae individuality gill tissue genomic DNA, 12.5ul premixed type EXTaq polymerase Premix TaqTM(TaKaRa), 0.5ul forward primer F, 0.5ul reverse primer R, surplus For distilled water;

Forward primer sequence F:5 '-GAATATTATCTATTCACTACATACCTGACATG-3 ';

Reverse primer sequences R:5 '-GGATCAATATGTACTAGTTTGTTGAAGG-3 '

Wherein, PCR reaction condition be: 94 DEG C 4 minutes;94 DEG C 10 seconds, 55 DEG C 30 seconds, 72 DEG C 2 seconds, 35 circulations;72 DEG C 10 minutes.

Reaction products therefrom contains the sequence of SNP site for the purpose of being, sequence, as shown in SEQ ID NO.1, detects this sequence Base on 2088bp site, thus the genotype of judgment sample.

Although, used general explanation, detailed description of the invention and test, the present invention made detailed retouching Stating, but on the basis of the present invention, can make some modifications or improvements it, this is apparent to those skilled in the art 's.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to claimed Scope.

Claims (5)

1. a SNP marker relevant to long Concha Ostreae ntiviral characteristic, it is characterised in that: SNP marker is positioned at long Concha Ostreae TLR immunity In path in the mono-exon genes of TLR2-1;
Described SNP marker is positioned at 5 ' the 858th bases of end shown in SEQ ID NO.1, and base type is A or C.
2. the SNP marker relevant to long Concha Ostreae ntiviral characteristic as described in claim 1, it is characterised in that: described SNP marker It is positioned at leucine enrichment C end identification domain (the Leucine rich repeat C-of TLR2-1 gene protein molecule Terminal domain) on.
3. the SNP marker relevant to long Concha Ostreae ntiviral characteristic as described in claim 1, it is characterised in that: described SNP is at base Because the genotype in group DNA is A/A, A/C or C/C.
4. the specific primer being used for the detection SNP marker relevant to long Concha Ostreae ntiviral characteristic, it is characterised in that: special Property primer is:
Forward primer sequence F:5 '-GAATATTATCTATTCACTACATACCTGACATG-3 ';
Reverse primer sequences R:5 '-GGATCAATATGTACTAGTTTGTTGAAGG-3 '.
5. the test kit being used for the detection SNP marker relevant to long Concha Ostreae ntiviral characteristic, it is characterised in that: test kit contains Have
Forward primer sequence F:5 '-GAATATTATCTATTCACTACATACCTGACATG-3 ';
Reverse primer sequences R:5 '-GGATCAATATGTACTAGTTTGTTGAAGG-3 '.
CN201410723155.8A 2014-12-02 2014-12-02 SNP marker associated with oyster antiviral properties and application thereof CN104450697B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410723155.8A CN104450697B (en) 2014-12-02 2014-12-02 SNP marker associated with oyster antiviral properties and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410723155.8A CN104450697B (en) 2014-12-02 2014-12-02 SNP marker associated with oyster antiviral properties and application thereof

Publications (2)

Publication Number Publication Date
CN104450697A CN104450697A (en) 2015-03-25
CN104450697B true CN104450697B (en) 2017-01-11

Family

ID=52897448

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410723155.8A CN104450697B (en) 2014-12-02 2014-12-02 SNP marker associated with oyster antiviral properties and application thereof

Country Status (1)

Country Link
CN (1) CN104450697B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1633888A2 (en) * 2003-06-17 2006-03-15 Keygene N.V. Means and method for the detection of target nucleotide sequences using ligation assays with improved oligonucleotide probe pairs
KR20080043164A (en) * 2006-11-13 2008-05-16 대한민국(관리부서:농촌진흥청) Identification of clubroot resistance gene using rapd marker in chines cabbage
WO2007097574A8 (en) * 2006-02-24 2009-11-05 Fnp Corp., Ltd. Molecular marker associated with tmv resistance and use thereof
CN101760532A (en) * 2008-12-19 2010-06-30 曹淑兰 Research on marker of powdery mildew resistance gene Pm23
EP2302070A2 (en) * 2005-06-23 2011-03-30 Keygene N.V. Strategies for high throughput identification and detection fo polymorpisms

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101886132B (en) * 2009-07-15 2013-09-18 北京百迈客生物科技有限公司 Method for screening molecular markers correlative with properties based on sequencing technique and BSA (Bulked Segregant Analysis) technique
US8609928B2 (en) * 2010-07-15 2013-12-17 Vilmorin & Cie Squash leaf curl virus (SLCV) resistance in cucurbits

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1633888A2 (en) * 2003-06-17 2006-03-15 Keygene N.V. Means and method for the detection of target nucleotide sequences using ligation assays with improved oligonucleotide probe pairs
EP2302070A2 (en) * 2005-06-23 2011-03-30 Keygene N.V. Strategies for high throughput identification and detection fo polymorpisms
WO2007097574A8 (en) * 2006-02-24 2009-11-05 Fnp Corp., Ltd. Molecular marker associated with tmv resistance and use thereof
KR20080043164A (en) * 2006-11-13 2008-05-16 대한민국(관리부서:농촌진흥청) Identification of clubroot resistance gene using rapd marker in chines cabbage
CN101760532A (en) * 2008-12-19 2010-06-30 曹淑兰 Research on marker of powdery mildew resistance gene Pm23

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Accession NO: EKC28748.1,Protein toll [Crassostrea gigas];Zhang,G.等;《GenBank》;20120919;全文 *
Identification and Utility of Markers Linked to the Zucchini Yellow Mosaic Virus Resistance Gene in Watermelon;Karen R. Harris,et al;《J. AMER. SOC. HORT. SCI》;20091231;全文 *

Also Published As

Publication number Publication date
CN104450697A (en) 2015-03-25

Similar Documents

Publication Publication Date Title
Parchman et al. Genome‐wide association genetics of an adaptive trait in lodgepole pine
Bártfai et al. Genetic analysis of two common carp broodstocks by RAPD and microsatellite markers
Shapiro et al. A paleogenomic perspective on evolution and gene function: new insights from ancient DNA
Zane et al. Strategies for microsatellite isolation: a review
Norris et al. Parentage and relatedness determination in farmed Atlantic salmon (Salmo salar) using microsatellite markers
Congiu et al. Identification of interspecific hybrids by amplified fragment length polymorphism: the case of sturgeon
Kohlmann et al. Genetic variability and structure of common carp (Cyprinus carpio) populations throughout the distribution range inferred from allozyme, microsatellite and mitochondrial DNA markers
Hellgren et al. Diversity and phylogeny of mitochondrial cytochrome B lineages from six morphospecies of avian Haemoproteus (Haemosporida: Haemoproteidae)
Abdul-Muneer Application of microsatellite markers in conservation genetics and fisheries management: recent advances in population structure analysis and conservation strategies
Cheng et al. Ecological genomics of Anopheles gambiae along a latitudinal cline: a population-resequencing approach
Beaumont et al. Biotechnology and genetics in fisheries and aquaculture
Huvet et al. Mitochondrial and nuclear DNA phylogeography of Crassostrea angulata, the Portuguese oyster endangered in Europe
Streelman et al. Hybridization and contemporary evolution in an introduced cichlid fish from Lake Malawi National Park
Fernandez et al. Cryptic species within the cosmopolitan desiccation-tolerant moss Grimmia laevigata
Baxter et al. Convergent evolution in the genetic basis of Müllerian mimicry in Heliconius butterflies
CARRERAS‐CARBONELL et al. Population structure within and between subspecies of the Mediterranean triplefin fish Tripterygion delaisi revealed by highly polymorphic microsatellite loci
Strandh et al. Major histocompatibility complex class II compatibility, but not class I, predicts mate choice in a bird with highly developed olfaction
Foighil et al. Differences in mitochondrial 16S ribosomal gene sequences allow discrimination among American [Crassostrea virginica (Gmelin)] and Asian [C. gigas (Thunberg) C. ariakensis Wakiya] oyster species
Smith et al. Allozyme and microsatellite DNA markers of toothfish population structure in the Southern Ocean
Kanno et al. Microsatellite analysis of Japanese sea cucumber, Stichopus (Apostichopus) japonicus, supports reproductive isolation in color variants
Chow et al. Phylogenetic relationships among Thunnus species inferred from rDNA ITS1 sequence
Islam et al. Randomly amplified polymorphic DNA analysis of four different populations of the Indian major carp, Labeo rohita (Hamilton)
Bantock et al. New and improved molecular sexing methods for museum bird specimens
O’rorke et al. PCR enrichment techniques to identify the diet of predators
Vadopalas et al. Application of real-time PCR for simultaneous identification and quantification of larval abalone

Legal Events

Date Code Title Description
PB01 Publication
C06 Publication
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant