CN108148922A - For the SSR primers and identification method of the identification of grain rains scented tea tree and application - Google Patents

For the SSR primers and identification method of the identification of grain rains scented tea tree and application Download PDF

Info

Publication number
CN108148922A
CN108148922A CN201810106703.0A CN201810106703A CN108148922A CN 108148922 A CN108148922 A CN 108148922A CN 201810106703 A CN201810106703 A CN 201810106703A CN 108148922 A CN108148922 A CN 108148922A
Authority
CN
China
Prior art keywords
primer
seq
sites
tea tree
grain rains
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810106703.0A
Other languages
Chinese (zh)
Other versions
CN108148922B (en
Inventor
韦朝领
安焱林
刘升锐
郭凌霄
密孝增
程道杰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anhui Agricultural University AHAU
Original Assignee
Anhui Agricultural University AHAU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anhui Agricultural University AHAU filed Critical Anhui Agricultural University AHAU
Priority to CN201810106703.0A priority Critical patent/CN108148922B/en
Publication of CN108148922A publication Critical patent/CN108148922A/en
Application granted granted Critical
Publication of CN108148922B publication Critical patent/CN108148922B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of SSR primers for the identification of grain rains scented tea tree and identification method and applications.5 pairs of primers：Primer 1 upstream TACCCACACAGTAGACCAGA, 1 downstream AAACCACGAGATGAAGAAGA；2 upstream ATAACTTGGATTTTTGAACGCCT, 2 downstream ATAGTAGTTATGGTGGTGGCGT, 3 upstream GTGTTAGGGGACAGGGTAGG, 3 downstream TGGGGGGTCAATATGTATGG；4 upstream ACTGAAATCAGGCCAAAATC, 4 downstream ATCATAGCAGACCAACGACT；5 upstream TGGGTTTCTTAGAGGGGATA, 5 downstreams：TGGAGACAATGGAGGTAATG.It can accurately differentiate grain rains perfume (or spice) tea tree breed.

Description

For the SSR primers and identification method of the identification of grain rains scented tea tree and application
Technical field
The present invention relates to technical field of molecular biology more particularly to a kind of SSR primers for the identification of grain rains scented tea tree And identification method and application.
Background technology
Grain rains perfume (or spice) be using the seed bud mutation of group of Shucheng County as original material, with single plant systematic selection since 2006, Vegetative propagation selection and breeding form.From 2010 Shucheng County of Anhui Province, buried hill, to the east of etc. tests in a county level kind.2013 one 2016 years in Shucheng County Relax 916 tea plantation of tea progress variety comparative test in county.Beginning in 2010 is planted experimentally in Shucheng County, buried hill, Dongzhi County, variety comparative test and is planted experimentally Show：The kind is high-quality, special early life, cold-resistant is drought-enduring, yield is higher, wide adaptation range.Famous green tea processed is fitted, is promoted and applied economical Benefit is preferable, suitable for the north and the cultivation of other excellent green tea areas.Grain rains perfume (or spice) category shrub type, tree performance half is opened a business, branch is closeer, bud-leaf Density is closeer, leaf length average 6.5cm, leaf width 2.9cm, leaf area 18.85cm2, leaflet class, leaf ellipse, leaf slightly carries on the back volume, vein Mostly 7 pairs, the food value of leaf is soft, glossy, and leaf color is light green, and young tender shoots light green color, fine hair are medium, blade slightly on sideling give birth to, blade tip is tapering, Leaf margin microwave, the micro- protuberance in blade face, leaf-teeth are sharp, close, shallow, full-bloom stage mid-November, and flower amount is medium, and 5, calyx, green has fine hair, Petal white 5, diameter 3cm, quality is medium, and ovary has a fine hair, style length 0.9cm, and it is medium that column cap splits position, 3 crackings, gynoecium Height, setting percentage is not high, fruit triangular form shape, diameter 2.4cm, pericarp 0.07 ㎝ of thickness, and shape of the seed is spherical, plants diameter mean value 1.4cm plants skin brown, hundred seeds weight 11.5g, three leaf hundred-bud weight 35.Og of a bud.Grain rains perfume (or spice) tea-making quality is excellent, the special early, cold-resistant of germination It is drought-enduring.916 tea plantation production practices, various regions are introduced a fine variety exemplary scenario and are shown：By one or two leaf standard of a bud, one season of spring tea per acre may be used Fresh leaf 100kg is picked, the output value is 1.5 times of other kinds or so up to 7000 yuan.Therefore, grain rains perfume (or spice) has higher popularization Value.
As country is constantly perfect to Plant new variety protection system, more and more breeders weigh new varieties and protect Consciousness enhancing, actively apply for New variety protection.Fine processing and screening, institute carry out grain rains perfume (or spice) fresh leaf with Famous High-quality Tea preparation method Into famous green tea made of the higher grain rains perfume (or spice) of tea quality, unique flavor, flavour is dense strong, Yin Hou throats sweet and cool-natured, have stomach invigorating, Aid digestion, acute decompression, protection hypoxic cardiac muscle, improves body dynamic endurance, reduces cholesterol, subtracts cardiac stimulant enhancing myocardial contraction Fertilizer and other effects is a kind of unique health-care beverage of function, the particularly ideal health care product of Elderly patients.On the market, often There are many kinds of fake and forged tealeaves and pretends to be famous green tea kind in Nian Douhui, and consumer is that can not distinguish true only with visually observing Puppet for the protection to high-quality breeding-grain rains perfume (or spice) kind power, while identifies grain rains perfume, and the kind for preventing other similar is pretended to be, Consumers in general are cheated, damage the right of breeder.
Therefore, researcher attempts to identify grain rains perfume (or spice) improved seeds by SSR fingerprint pattern technologies, in DNA Molecular level gives new tea cultivar grain rains fragrant unique Fingerprint Identity, so as to reach the mesh of protection grain rains perfume (or spice) improved seeds power , safeguard the right of consumer and breeder.
Invention content
In view of this, an embodiment of the present invention provides a kind of SSR primers and identification method for the identification of grain rains scented tea tree And application, main purpose be solution must not precise Identification grain rains perfume (or spice) tea tree breed the problem of.
In order to achieve the above objectives, invention broadly provides following technical solutions：
On the one hand, an embodiment of the present invention provides a kind of SSR primers for the identification of grain rains scented tea tree, the SSR primers Comprising 5 pairs of primers, respectively：Primer 1：
Sense primer：TACCCACACAGTAGACCAGA；
Downstream primer：AAACCACGAGATGAAGAAGA；
Primer 2：
Sense primer：ATAACTTGGATTTTTGAACGCCT；
Downstream primer：ATAGTAGTTATGGTGGTGGCGTG；
Primer 3：
Sense primer：GTGTTAGGGGACAGGGTAGG；
Downstream primer：TGGGGGGTCAATATGTATGG；
Primer 4：
Sense primer：ACTGAAATCAGGCCAAAATC；
Downstream primer：ATCATAGCAGACCAACGACT；
Primer 5：
Sense primer：TGGGTTTCTTAGAGGGGATA；
Downstream primer：TGGAGACAATGGAGGTAATG.
Preferably, the 1 corresponding specific site SSR1 sequences such as SEQ ID NO.11 of primer；The SSR1 sites two The left side sequence of side conserved sequence such as SEQ ID NO.12, the right flanks such as SEQ ID of SSR1 sites both sides conserved sequence NO.13。
Preferably, the corresponding specific site SSR2 sequences such as SEQ ID NO.14 of the primer 2；The SSR2 sites two The left side sequence of side conserved sequence such as SEQ ID NO.15, the right flanks such as SEQ ID of SSR2 sites both sides conserved sequence NO.16。
Preferably, the 3 corresponding specific site SSR3 sequences such as SEQ ID NO.17 of primer；The SSR3 sites two The left side sequence of side conserved sequence such as SEQ ID NO.18, the right flanks such as SEQ ID of SSR3 sites both sides conserved sequence NO.19。
Preferably, the 4 corresponding specific site SSR4 sequences such as SEQ ID NO.20 of primer；The SSR3 sites two The left side sequence of side conserved sequence such as SEQ ID NO.21, the right flanks such as SEQ ID of SSR4 sites both sides conserved sequence NO.22。
Preferably, the 5 corresponding specific site SSR5 sequences such as SEQ ID NO.23 of primer；The SSR3 sites two The left side sequence of side conserved sequence such as SEQ ID NO.24, the right flanks such as SEQ ID of SSR5 sites both sides conserved sequence NO.25.On the other hand, it an embodiment of the present invention provides a kind of identification method, the described method comprises the following steps：
Extract sample to be tested total DNA；
Using 5 pairs of SSR primers of claim 1, the genomic DNA of the sample to be tested is expanded；
Record the DNA cloning banding pattern of each pair of primer of the sample to be tested；
Judge whether the sample to be tested is grain rains scented tea tree according to the DNA cloning banding pattern.
Preferably, the extracting method of the total DAN of sample is the CTAB methods using improvement；Reaction total system is 10 μ L, Wherein, the 1 μ L of DNA solution of 50ng/ μ L, each 0.5 μ L, 2 × Es Taq MasterMix (Dye), 5 μ L of 10 μM of upstream and downstream primers, ddH2O 3μL。
Preferably, the process of the amplification is：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C Extend 45s, 35 cycles, 72 DEG C of extension 10min；The annealing temperature of 1 sense primer of primer is 50.3 DEG C, 1 downstream primer of primer Annealing temperature be 51.9 DEG C；The annealing temperature of primer 2 sense primer is 54.3 DEG C, and the annealing temperature of primer 2 downstream primer is 58℃；The annealing temperature of 3 sense primer of primer is 55.9 DEG C, and the annealing temperature of 3 downstream primer of primer is 57.8 DEG C；On primer 4 The annealing temperature for swimming primer is 54.3 DEG C, and the annealing temperature of 4 downstream primer of primer is 52.8 DEG C；The annealing of 5 sense primer of primer Temperature is 54.1 DEG C, and the annealing temperature of 5 downstream primer of primer is 52.8 DEG C.
In another aspect, the application an embodiment of the present invention provides above-mentioned SSR primers in grain rains perfume (or spice) tea tree breed is identified.
Compared with prior art, the beneficial effects of the invention are as follows：
The primer that the present invention is developed is built upon on tea tree genome, compared with EST-SSR, has polymorphism height, number Measure the characteristics of more；It is final to determine 5 pairs of core primers for the identification to grain rains perfume (or spice) kind also by a large amount of primer screening.
The present invention using SSR fingerprint pattern technologies, the technology is developed recently as Development of Molecular Biology A kind of application genetic germplasm analysis method got up has the characteristics of stability is good, easy to operate, and accuracy rate is high, to grain rains The identification of fragrant improved seeds provide one accurately and fast, simple method.
Material selected by the present invention is not limited by season, environment and testing time, and grain rains perfume (or spice) kind can be grown It arbitrary organ in any period or makes the dry tea of storage a period of time and carries out DNA extractions, do not affect its identification knot Fruit.
The present invention selected by primer screening is being the full-automatic capillary electrophoresis systems of Fragment Analyzer TM, should System has the characteristics that high throughput, safe ready, high sensitivity, is risen to building a set of fast, accurately SSR fingerprint pattern technologies To very big effect, and shorten the period of grain rains perfume (or spice) improved seeds identification.
Description of the drawings
Fig. 1 is the grain rains perfume (or spice) fresh leaf of extraction provided in an embodiment of the present invention and dry tea DNA agarose gel electrophoresis figures；
Fig. 2A -2E are 5 pairs of core primers provided in an embodiment of the present invention to (A-E is corresponding in turn to primer pair 1-5) 92 tea Set the PCR amplification Capillary Electrophoresis figure of kind；
Fig. 3 A-3B are that 5 pairs of core primers provided in an embodiment of the present invention repeat capillary three times to grain rains perfume (or spice) fresh leaf and dry tea Electrophoresis tube glue figure；
Fig. 4 A-4E are 5 pairs of core primers provided in an embodiment of the present invention to (A-E is corresponding in turn to primer pair 1-5) grain rains perfume Capillary Electrophoresis peak figure is repeated three times；
Fig. 5 new tea cultivar grain rains perfume (or spice) finger-prints.
Specific embodiment
Further to illustrate the present invention technological means and effect taken to reach predetermined goal of the invention, below with compared with Good embodiment to specific embodiment, technical solution, feature and its effect applied according to the present invention, is described in detail as after.Under State it is bright in multiple embodiments in special characteristic, structure or feature can be combined by any suitable form.
Embodiment 1 (extraction tealeaves total DNA)
(1) tea tree breed selected is shown in Table 1；
(2) using selected tea tree breed as material, total DNA, specific operation process are extracted using CTAB methods：
1. 2ml centrifuge tubes is taken to add the dry tea powder 0.1g ground, add 900mL CTAB extracting solutions (being preheated to 65 DEG C in advance), Add 20mL beta -mercaptoethanols, 65 DEG C of water-bath 20min gently shake up several times up and down every 10min, and then plus 10mLRNAase is placed on 65 DEG C of water-bath 15min shake up several times up and down every 5min；
2. 13000r/min centrifuges 10min, takes supernatant 800mL, add 400mL Tris balance phenols, add isometric The chloroform of (800mL)：To 2mL, turn upside down isoamyl alcohol mixing, 13000r/min, centrifuges 10min, takes supernatant 650mL to newly 2ml pipes in, chlorination is imitated：Isoamyl alcohol 650mL, overturns mixing, and 13000r/min centrifuges 5min, supernatant 500mL is taken to be placed in newly 2ml pipes in；
3. plus at ethyl alcohol (absolute ethyl alcohol and to be positioned in -20 DEG C of refrigerators, be finished and be put into refrigerator in time) to 2ml, on It overturns down (to have floccule to occur) to be placed in -20 DEG C of refrigerators several times and stands 5min (time can lengthen), outwell in pipe Ethyl alcohol is added at ethyl alcohol to 2ml, and gently mixing outwells ethyl alcohol (when of falling ethyl alcohol not outwell DNA) afterwards several times up and down, then 8000r/min, 30s outwell remaining ethyl alcohol；
4. plus 500mLddH2O, be placed on 37 DEG C of water-bath dissolving DNAs, general 4min is put and 5min is pre-chilled on ice, adds cold ethyl alcohol extremely 2mL, gently turn upside down mixing.Centrifuge 3min, 13000r/min, void column centrifugation 2min, 8000r/min, if seeing precipitation Object is not that Transparent color repeats step 4；
5. blank pipe is placed on vacuum pump extracting 15min, see that solid surplus adds 200mlddH2O measures its nucleic acid content, And with 0.8% agarose electrophoresis；
Embodiment 2 (selection in SSR sites and the primary dcreening operation of primer)
In 100,000 sequences containing SSR sites are obtained, polybase base weight is relatively abundanter and more in tea tree genome again The higher microsatellite type of state property, thus choose 4000 sequences containing SSR sites, successfully devise 450 pairs of primers (by General biosynthesis), the principle of wherein SSR primer screenings is as follows：
1. the length of primer is 18-23bp, target fragment is in 250bp-380bp or so；
2. G/C content is 45%-60%, three or four continuous bases are avoided the occurrence of in primer sequence；
3. fiery temperature is at 50 DEG C -58 DEG C, preferably at 55 DEG C or so, upstream and downstream primer Tm values are not much different in 4 DEG C；
4. the end of object 3 ' avoids the occurrence of 3 or more continuous bases, primer dimer and hairpin structure are avoided as possible.
Embodiment 3 (PCR amplification and the full-automatic Capillary Electrophoresis primary dcreening operations of Fragment AnalyzerTM)
Reaction total system is 10 μ L, the DNA solution 1 μ L, 10 μM of upstream and downstream primers each 0.5 μ L, 2 × Es of wherein 50ng/ μ L Taq MasterMix(Dye)5μL,ddH23 μ L of O (reagent source is biotech firm in health)；
PCR response procedures are:94 DEG C of pre-degeneration 5min, (94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C are prolonged 35 cycles Stretch 45s), 72 DEG C of extension 10min, 4 DEG C of preservations, wherein annealing temperature is determined according to each primer.PCR product is passed through The full-automatic Capillary Electrophoresis of Fragment AnalyzerTM carries out the first of primer by the way that electrophoresis result and target fragment are compared Sieve (the capillary electrophoresis detection accuracy that this experiment uses is very high, can meet this experiment purpose, without sequencing).
(the Fragment Analyzer of embodiment 4TMFull-automatic capillary electrophoresis system secondary screening)
Concrete operations flow is：
1. the preparation of reagent：
1) with glue：Add the Inter calating Dye of 2 μ L in 40mL dsDNA 800Separation Gel, it is fully mixed It is even；
2)5×930dsDNA Inter Buffer：5 × Inter Buffer are diluted 5 times；
3)5×Capillary conditioning solution：By 5 × Capillary conditioning Solution dilutes 5 times, and 1mL Capillary conditioning solution are separately added into 96 orifice plates, are avoided out Existing bubble；
4)Marker：30 μ L 35bp-500bp Markers are separately added into 96 orifice plates, 20 microlitres are added in each hole Mineral oil are sealed, centrifugation；
5) sample preparation：Each 20 μ L Dilution buffer of Kong Lijia and 2 μ L PCR products in 96 orifice plates, finally One hole adds in 24 μ L 35-500bp Range DNA Ladder, and centrifugation avoids the occurrence of bubble；
Sample preparation：Each 20 μ L Dolution buffer of Kong Lijia and 2 μ L PCR products, H12 holes in 96 orifice plates 24 μ L 35-500bp Range DNA Ladder are added in, centrifugation avoids the occurrence of bubble；
2. operating procedure：The prepared reagent of institute is put into instrument designated position, clicks the operation program of instrument；
3. data record and interpretation of result：The highest band of peak value is chosen in per band, records concrete numerical value size；To drawing The requirement standard of object secondary screening has the following：1) master tape is clear, without extra miscellaneous band, 2) polymorphism value is high, and loci is more, and 3) Band difference size is greater than 4bp between two similar locis, and 4) primer for meeting front three-point is weighed three times Renaturation expands, and the good primer of selection repeatability, stability, the core for finally choosing 5 pairs of primers as identification grain rains perfume (or spice) kind is drawn Object, it is as shown in table 2 that 92 kinds of primer pair amplify specific loci：
2. 5 pairs of primers of table count (size to 92 parts of tea tree breed Capillary Electrophoresis bands respectively:bp)
The present invention can quickly precise Identification grain rains be fragrant from 92 kinds of tealeaves shown in table 1, and primer repeats capillary three times Electrophoresis fingerprint is shown in Fig. 4, due to Fragment AnalyzerTMAutomatically capillary electrophoresis system is minimum is distinguished as 2bp, because The band institute allowed band point that this primer 1 amplifies grain rains perfume (or spice) kind is ± 3bp.
The present invention develops a kind of SSR primers identified for grain rains scented tea tree, above-mentioned SSR by above-described embodiment 1-4 Primer includes 5 pairs of primers, respectively：Primer 1：
Sense primer：TACCCACACAGTAGACCAGA(SEQ ID NO.1)；
Downstream primer：AAACCACGAGATGAAGAAGA(SEQ ID NO.2)；
1 corresponding specific site SSR1 sequences of primer pair：AAAGAAAAGAAAAGAAAAGAAAAGAAAAGA(SEQ ID NO.11)；
Sequence (SEQ ID NO.12) on the left of the conserved sequence of SSR1 sites both sides：
GCCTTCTTCCCAAAATGTAACGTATAATTTGGGCGTGTGATCCTACCATAGTCATCATACTCACATGATTCAATTTG TTTATTTTATTGAATTTTTAAGTAAATTATTTAGAAAAAAAAATGGATTGATTCGATAATTACCTAATTTTATTATA TTTGTTTTTAAAAAATGATGATAAAAATTAGATTGATAGCCTTTGTTGATCCATGCATCGAAACTATACCTGTCTAC CCACACAGTAGACCAGAGAAAAATTTAAATAAAAATAAATATGAAAAATAAAGTGTAAAATTCCACAAG；
SSR1 sites both sides conserved sequence right flanks (SEQ ID NO.13)：
AAAGGAAAAGGAGAGAAAAGAAGGCCCACTTTCACTGCATCAAGGGCTCTATTTTATGATTCGTCACAGTTCTTGCG ATGGTGCTCCACCTTTTCTTTTCTTCTTCATCTCGTGGTTTTTTGTACATAAGGTGGCTTTAAATAAAGAAAGTTCT TTAAAGTGAGACATCCCATGATTTTGACAACCAAAGGAAAAAGGTGTATACATTACATTATTACATCTCATCCATGA CTCCGAAAAAGATCATGTTATTTTAAAATGCCCCTGCTCCACCAAATGAAGAGTACCCTTAAAATTTTA；
Primer 2：
Sense primer：ATAACTTGGATTTTTGAACGCCT(SEQ ID NO.3)；
Downstream primer：ATAGTAGTTATGGTGGTGGCGTG(SEQ ID NO.4)；
2 corresponding specific site SSR2 sequences (SEQ ID NO.14) of primer pair：CACCACCACCACCACCAC
Sequence (SEQ ID NO.15) on the left of the conserved sequence of SSR2 sites both sides：
AAATTTTCAAAATAGAACTGCAAGCGACCGTTAAAGTGGTTGAAACCATCCATAACAATAGCGGGCCGGGCTTGTCT AGGCAAGTCTGTTGATAACTTGGATTTTTGAACGCCTCTACATGGTTGTATATAACCTATTCGCCACAGCCAT；
SSR2 sites both sides conserved sequence right flanks (SEQ ID NO.16)：
TCTTAACACTGCCACTGTCATTACCGCCACCATCACGCCACCACCATAACTACTATCACCGCTTCCACCCCTCCACC ATCATCACCACTCGTACCACCGCCATCAGCACCACCACCACCAGAACCTCAACTTCCACTATTATCATATCTT；
Primer 3：
Sense primer：GTGTTAGGGGACAGGGTAGG(SEQ ID NO.5)；
Downstream primer：TGGGGGGTCAATATGTATGG(SEQ ID NO.6)；
3 corresponding specific site SSR3 sequences (SEQ ID NO.17) of primer pair：
GTTTGGTTTGGTTTGGTTTGGTTTGGTTTG；
Sequence (SEQ ID NO.18) on the left of the conserved sequence of SSR3 sites both sides：
ATTAGGAATGAGTATATTCGAGAATGGATAGGAGTAGCACCGATAGATAAGTTGAGAGAGATCAATTGAGATGGTTT GGTCATATTTAACAGAGACCAACACAGACAGTAGTGAAGAGATGCAATGCTGTAACGATAGATGGAAGTGTTAGGGG ACAGGGTAGGCTTAGATTAACGTTGGCTAGCATTGTAAATAGAGATATGGATATACTTAATTTGACTAACAAAATGG CCTTTGATAGGGCCGCGTGGAGAAGAATGATTCATGTAACCGAGTCCATTTGATGGAACTTAAGGCTTA；
SSR3 sites both sides conserved sequence right flanks (SEQ ID NO.19)：
TTATGGTAAACTTTTTCATTAATCTATAATAATTTTTAATGATTATCATGGAAAGGTAATTTCCTCAAAAAAAGAGG GGGTGTTAATTACACTAAGTCCCCTCAACTATCAACGAATATCACTTTACTCCATCATCTATGAACCATACATATTG ACCCCCCACAACTATAAAAAATCGAACAAATACATTTTTATAGTTGAGGAGTTCAAAATGTACGGTTCATAAGTGAG CAAATACATTTTTATAGTTGAGGAGTTCAAAATGTACGGTTCATAAGTGAGGTGGAAGAAGTGATTTCA；
Primer 4：
Sense primer：ACTGAAATCAGGCCAAAATC(SEQ ID NO.7)；
Downstream primer：ATCATAGCAGACCAACGACT(SEQ ID NO.8)；
4 corresponding specific site SSR4 sequences (SEQ ID NO.20) of primer pair：CGCCTCGCCTCGCCTCGCCT；
Sequence (SEQ ID NO.21) on the left of the conserved sequence of SSR4 sites both sides：
CGAAGTCGATGAAGGGCCCAGATGATTCGAACTGAAATCAGGCCAAAATCTAATGACGCGTCGCTTCTTTTCGCCTC ACGCTTCATCGCCTAAGCCTCGCGTCTCCATCGCCTCACCATTTCACCTCGCCTCGCCTTAAGGTGTGTGAAG；
SSR4 sites both sides conserved sequence right flanks (SEQ ID NO.22)：
CGCTTAGCGCTTAGGCTCGCCTCTGATAACAGTGGTATAGAATGAGGAGAGTCGTTGGTCTGCTATGATGTCCCCTG TCTCTACTGACCGCTCAGTATTACTGTCTGCTCCTCGAGATGGCCTCAGCCTGACTCCCATCCCTTCGTCTGC；
Primer 5：
Sense primer：TGGGTTTCTTAGAGGGGATA(SEQ ID NO.9)；
Downstream primer：TGGAGACAATGGAGGTAATG(SEQ ID NO.10).
5 corresponding specific site SSR5 sequences (SEQ ID NO.23) of primer pair：
CACCATCACCATCACCATCACCATCACCATCACCAT；
Sequence (SEQ ID NO.24) on the left of the conserved sequence of SSR5 sites both sides：
GTCTAAGGAGATGAAAGTGATACATTTTTACAGTTGAGGGGTTCAAAATGTGTGGGTTTCTTAGAGGGGATATTTGG CCATAACTCCTTCCTAGAGCCCCTTTTTCTTGAAAAGGACAAGTTATAATTTTTTTGCTCATAAACTCCTCCAAAAT AAAGAAATCTTGTAAGAAGGACAAAATTTTCAGATTTATATTTTATGTGACAAATTTACCCCCTTACACACACACTT TCTATCTCCATCAATTTGTCATCTCTCTCTCAGCTCTTTCTTTCTCTATCTTTTTCTAAGAGCTCTCTC；
SSR5 sites both sides conserved sequence right flanks (SEQ ID NO.25)：
CTCCACTACCATGACTACCATCATTTACATTACCTCCATTGTCTCCACCAACACCGTCTCAACCACCGGCACCATTC GTCACCGCGCCACTACCGTTTCGCACCACCATCTCAACCACAAGCGCCATTCGATGTCACTGTACCACGGGCAACCA CCATCGTCATCCTTAGCATCTAAGATCTCAGATCTGAGATTGACGACCTCAGATTTGAGATCTATCATCTCAGATCT GTATTCTCTCCCTCTTTTTCCCTTTGTCTCATCATGTTCTATTTTTCAGACAACAAAATTTTACTCTAG。
Identification method：It after core primers are chosen, is expanded according to the PCR system of embodiment 3, then according to embodiment 4 System carry out Capillary Electrophoresis, finally count stripe size, error is classified as a type of strip ± 3bp's, to go out occurrence The most electrophoresis result of number is counted, and records stripe size, then according to the amplification of 5 pairs of primers, compares combination banding pattern, In table 2, often capable banding pattern is combined, all not exactly the same, so as to identify specific tea tree breed.
Part, those skilled in the art can not select from the prior art to the greatest extent in the embodiment of the present invention.
Disclosed above is only the specific embodiment of the present invention, but protection scope of the present invention is not limited thereto, and is appointed What those familiar with the art in the technical scope disclosed by the present invention, can readily occur in change or replacement, all should It is included within the scope of the present invention.Therefore, protection scope of the present invention should using above-mentioned scope of the claims as It is accurate.
Sequence table
<110>Agricultural University Of Anhui
<120>A kind of SSR primers identified for grain rains scented tea tree and identification method and application
<160> 25
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
tacccacaca gtagaccaga 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
aaaccacgag atgaagaaga 20
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ataacttgga tttttgaacg cct 23
<210> 4
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
atagtagtta tggtggtggc gtg 23
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
gtgttagggg acagggtagg 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
tggggggtca atatgtatgg 20
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
actgaaatca ggccaaaatc 20
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
atcatagcag accaacgact 20
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
tgggtttctt agaggggata 20
<210> 10
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
tggagacaat ggaggtaatg 20
<210> 11
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
aaagaaaaga aaagaaaaga aaagaaaaga 30
<210> 12
<211> 300
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
gccttcttcc caaaatgtaa cgtataattt gggcgtgtga tcctaccata gtcatcatac 60
tcacatgatt caatttgttt attttattga atttttaagt aaattattta gaaaaaaaaa 120
tggattgatt cgataattac ctaattttat tatatttgtt tttaaaaaat gatgataaaa 180
attagattga tagcctttgt tgatccatgc atcgaaacta tacctgtcta cccacacagt 240
agaccagaga aaaatttaaa taaaaataaa tatgaaaaat aaagtgtaaa attccacaag 300
<210> 13
<211> 300
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
aaaggaaaag gagagaaaag aaggcccact ttcactgcat caagggctct attttatgat 60
tcgtcacagt tcttgcgatg gtgctccacc ttttcttttc ttcttcatct cgtggttttt 120
tgtacataag gtggctttaa ataaagaaag ttctttaaag tgagacatcc catgattttg 180
acaaccaaag gaaaaaggtg tatacattac attattacat ctcatccatg actccgaaaa 240
agatcatgtt attttaaaat gcccctgctc caccaaatga agagtaccct taaaatttta 300
<210> 14
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
caccaccacc accaccac 18
<210> 15
<211> 150
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
aaattttcaa aatagaactg caagcgaccg ttaaagtggt tgaaaccatc cataacaata 60
gcgggccggg cttgtctagg caagtctgtt gataacttgg atttttgaac gcctctacat 120
ggttgtatat aacctattcg ccacagccat 150
<210> 16
<211> 150
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
tcttaacact gccactgtca ttaccgccac catcacgcca ccaccataac tactatcacc 60
gcttccaccc ctccaccatc atcaccactc gtaccaccgc catcagcacc accaccacca 120
gaacctcaac ttccactatt atcatatctt 150
<210> 17
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
gtttggtttg gtttggtttg gtttggtttg 30
<210> 18
<211> 300
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 18
attaggaatg agtatattcg agaatggata ggagtagcac cgatagataa gttgagagag 60
atcaattgag atggtttggt catatttaac agagaccaac acagacagta gtgaagagat 120
gcaatgctgt aacgatagat ggaagtgtta ggggacaggg taggcttaga ttaacgttgg 180
ctagcattgt aaatagagat atggatatac ttaatttgac taacaaaatg gcctttgata 240
gggccgcgtg gagaagaatg attcatgtaa ccgagtccat ttgatggaac ttaaggctta 300
<210> 19
<211> 300
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 19
ttatggtaaa ctttttcatt aatctataat aatttttaat gattatcatg gaaaggtaat 60
ttcctcaaaa aaagaggggg tgttaattac actaagtccc ctcaactatc aacgaatatc 120
actttactcc atcatctatg aaccatacat attgaccccc cacaactata aaaaatcgaa 180
caaatacatt tttatagttg aggagttcaa aatgtacggt tcataagtga gcaaatacat 240
ttttatagtt gaggagttca aaatgtacgg ttcataagtg aggtggaaga agtgatttca 300
<210> 20
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 20
cgcctcgcct cgcctcgcct 20
<210> 21
<211> 150
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 21
cgaagtcgat gaagggccca gatgattcga actgaaatca ggccaaaatc taatgacgcg 60
tcgcttcttt tcgcctcacg cttcatcgcc taagcctcgc gtctccatcg cctcaccatt 120
tcacctcgcc tcgccttaag gtgtgtgaag 150
<210> 22
<211> 150
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 22
cgcttagcgc ttaggctcgc ctctgataac agtggtatag aatgaggaga gtcgttggtc 60
tgctatgatg tcccctgtct ctactgaccg ctcagtatta ctgtctgctc ctcgagatgg 120
cctcagcctg actcccatcc cttcgtctgc 150
<210> 23
<211> 36
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 23
caccatcacc atcaccatca ccatcaccat caccat 36
<210> 24
<211> 300
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 24
gtctaaggag atgaaagtga tacattttta cagttgaggg gttcaaaatg tgtgggtttc 60
ttagagggga tatttggcca taactccttc ctagagcccc tttttcttga aaaggacaag 120
ttataatttt tttgctcata aactcctcca aaataaagaa atcttgtaag aaggacaaaa 180
ttttcagatt tatattttat gtgacaaatt taccccctta cacacacact ttctatctcc 240
atcaatttgt catctctctc tcagctcttt ctttctctat ctttttctaa gagctctctc 300
<210> 25
<211> 300
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 25
ctccactacc atgactacca tcatttacat tacctccatt gtctccacca acaccgtctc 60
aaccaccggc accattcgtc accgcgccac taccgtttcg caccaccatc tcaaccacaa 120
gcgccattcg atgtcactgt accacgggca accaccatcg tcatccttag catctaagat 180
ctcagatctg agattgacga cctcagattt gagatctatc atctcagatc tgtattctct 240
ccctcttttt ccctttgtct catcatgttc tatttttcag acaacaaaat tttactctag 300

Claims (10)

1. for the SSR primers of grain rains scented tea tree identification, which is characterized in that the SSR primers include 5 pairs of primers, respectively：Draw Object 1：
Sense primer：TACCCACACAGTAGACCAGA；
Downstream primer：AAACCACGAGATGAAGAAGA；
Primer 2：
Sense primer：ATAACTTGGATTTTTGAACGCCT；
Downstream primer：ATAGTAGTTATGGTGGTGGCGTG；
Primer 3：
Sense primer：GTGTTAGGGGACAGGGTAGG；
Downstream primer：TGGGGGGTCAATATGTATGG；
Primer 4：
Sense primer：ACTGAAATCAGGCCAAAATC；
Downstream primer：ATCATAGCAGACCAACGACT；
Primer 5：
Sense primer：TGGGTTTCTTAGAGGGGATA；
Downstream primer：TGGAGACAATGGAGGTAATG.
2. as described in claim 1 for the SSR primers of grain rains scented tea tree identification, which is characterized in that the primer 1 is corresponding Specific site SSR1 sequences such as SEQ ID NO.11；The left side sequence such as SEQ ID of SSR1 sites both sides conserved sequence NO.12, the right flanks such as SEQ ID NO.13 of SSR1 sites both sides conserved sequence.
3. as described in claim 1 for the SSR primers of grain rains scented tea tree identification, which is characterized in that the primer 2 is corresponding Specific site SSR2 sequences such as SEQ ID NO.14；The left side sequence such as SEQ ID of SSR2 sites both sides conserved sequence NO.15, the right flanks such as SEQ ID NO.16 of SSR2 sites both sides conserved sequence.
4. as described in claim 1 for the SSR primers of grain rains scented tea tree identification, which is characterized in that the primer 3 is corresponding Specific site SSR3 sequences such as SEQ ID NO.17；The left side sequence such as SEQ ID of SSR3 sites both sides conserved sequence NO.18, the right flanks such as SEQ ID NO.19 of SSR3 sites both sides conserved sequence.
5. as described in claim 1 for the SSR primers of grain rains scented tea tree identification, which is characterized in that the primer 4 is corresponding Specific site SSR4 sequences such as SEQ ID NO.20；The left side sequence such as SEQ ID of SSR3 sites both sides conserved sequence NO.21, the right flanks such as SEQ ID NO.22 of SSR4 sites both sides conserved sequence.
6. as described in claim 1 for the SSR primers of grain rains scented tea tree identification, which is characterized in that the primer 5 is corresponding Specific site SSR5 sequences such as SEQ ID NO.23；The left side sequence such as SEQ ID of SSR3 sites both sides conserved sequence NO.24, the right flanks such as SEQ ID NO.25 of SSR5 sites both sides conserved sequence.
7. utilize the identification method of SSR primer pair grain rains scented tea trees described in claim 1, which is characterized in that the method packet Include following steps：
Extract sample to be tested total DNA；
Using 5 pairs of SSR primers of claim 1, the genomic DNA of the sample to be tested is expanded；
Record the DNA cloning banding pattern of each pair of primer of the sample to be tested；
Judge whether the sample to be tested is grain rains scented tea tree according to the DNA cloning banding pattern.
8. the identification method of grain rains scented tea tree as claimed in claim 2, which is characterized in that the extraction side of the total DAN of sample Method is the CTAB methods using improvement；Reaction total system is 10 μ L, wherein, the 1 μ L of DNA solution of 50ng/ μ L, 10 μM of upstream and downstream are drawn Object each 0.5 μ L, 2 × Es Taq MasterMix (Dye) 5 μ L, ddH2O 3μL。
9. the identification method of grain rains scented tea tree as claimed in claim 2, which is characterized in that the process of the amplification is：94℃ Pre-degeneration 5min, 94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 45s, 35 cycles, 72 DEG C extend 10min；On primer 1 The annealing temperature for swimming primer is 50.3 DEG C, and the annealing temperature of 1 downstream primer of primer is 51.9 DEG C；The annealing of primer 2 sense primer Temperature is 54.3 DEG C, and the annealing temperature of primer 2 downstream primer is 58 DEG C；The annealing temperature of 3 sense primer of primer is 55.9 DEG C, is drawn The annealing temperature of 3 downstream primer of object is 57.8 DEG C；The annealing temperature of 4 sense primer of primer is 54.3 DEG C, 4 downstream primer of primer Annealing temperature is 52.8 DEG C；The annealing temperature of 5 sense primer of primer is 54.1 DEG C, and the annealing temperature of 5 downstream primer of primer is 52.8℃。
10. application of the SSR primers described in claim 1 in grain rains perfume (or spice) tea tree breed is identified.
CN201810106703.0A 2018-02-02 2018-02-02 SSR primer for identifying Valley-flavored tea trees, identification method and application Active CN108148922B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810106703.0A CN108148922B (en) 2018-02-02 2018-02-02 SSR primer for identifying Valley-flavored tea trees, identification method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810106703.0A CN108148922B (en) 2018-02-02 2018-02-02 SSR primer for identifying Valley-flavored tea trees, identification method and application

Publications (2)

Publication Number Publication Date
CN108148922A true CN108148922A (en) 2018-06-12
CN108148922B CN108148922B (en) 2020-11-20

Family

ID=62459656

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810106703.0A Active CN108148922B (en) 2018-02-02 2018-02-02 SSR primer for identifying Valley-flavored tea trees, identification method and application

Country Status (1)

Country Link
CN (1) CN108148922B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108841981A (en) * 2018-06-20 2018-11-20 安徽农业大学 A method of identifying the big tea kind of persimmon using SSR finger-print
CN110669866A (en) * 2019-11-14 2020-01-10 安徽农业大学 InDel marker for identifying purple tea tree varieties and combination and application thereof
CN112997796A (en) * 2021-03-08 2021-06-22 安徽农业大学 Tea tree selfing breeding method
CN114574622A (en) * 2022-03-28 2022-06-03 安徽农业大学 SSR molecular marker combination for identifying teal new strain No.1, fingerprint spectrum and application of SSR molecular marker combination
CN115896333A (en) * 2022-11-24 2023-04-04 安徽农业大学 Method for identifying Jinyu No. 1 tea tree strain by using SSR fingerprint

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104004756A (en) * 2014-06-06 2014-08-27 中国农业科学院茶叶研究所 SSR (Simple Sequence Repeat) core primer group and method thereof for identifying tea variety
CN105624320A (en) * 2016-03-28 2016-06-01 安徽农业大学 Method for identifying Shuchazao tea tree variety by utilizing SSR fingerprint
CN105624321A (en) * 2016-03-28 2016-06-01 安徽农业大学 Method for identifying Huangkui tea tree variety by utilizing SSR fingerprint

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104004756A (en) * 2014-06-06 2014-08-27 中国农业科学院茶叶研究所 SSR (Simple Sequence Repeat) core primer group and method thereof for identifying tea variety
CN105624320A (en) * 2016-03-28 2016-06-01 安徽农业大学 Method for identifying Shuchazao tea tree variety by utilizing SSR fingerprint
CN105624321A (en) * 2016-03-28 2016-06-01 安徽农业大学 Method for identifying Huangkui tea tree variety by utilizing SSR fingerprint

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LI-QIANG TAN等: "Fingerprinting 128 Chinese clonal tea cultivars using SSR markers provides new insights into their pedigree relationships", 《TREE GENETICS & GENOMES》 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108841981A (en) * 2018-06-20 2018-11-20 安徽农业大学 A method of identifying the big tea kind of persimmon using SSR finger-print
CN110669866A (en) * 2019-11-14 2020-01-10 安徽农业大学 InDel marker for identifying purple tea tree varieties and combination and application thereof
CN112997796A (en) * 2021-03-08 2021-06-22 安徽农业大学 Tea tree selfing breeding method
CN114574622A (en) * 2022-03-28 2022-06-03 安徽农业大学 SSR molecular marker combination for identifying teal new strain No.1, fingerprint spectrum and application of SSR molecular marker combination
CN114574622B (en) * 2022-03-28 2023-08-18 安徽农业大学 SSR molecular marker combination for identifying tea tree No.1 of teal peak, fingerprint and application thereof
CN115896333A (en) * 2022-11-24 2023-04-04 安徽农业大学 Method for identifying Jinyu No. 1 tea tree strain by using SSR fingerprint
CN115896333B (en) * 2022-11-24 2024-06-07 安徽农业大学 Method for identifying Jinyu No. 1 tea tree strain by utilizing SSR fingerprint

Also Published As

Publication number Publication date
CN108148922B (en) 2020-11-20

Similar Documents

Publication Publication Date Title
CN108148922A (en) For the SSR primers and identification method of the identification of grain rains scented tea tree and application
Rukundo et al. Storage root formation, dry matter synthesis, accumulation and genetics in sweetpotato
CN105624320B (en) Identify the method for the tea morning tea tree breed that relaxes using SSR finger-print
Azimi et al. Genetic variation of Iranian Iris species using morphological characteristics and RAPD markers.
US20180077887A1 (en) Hybrid pepper plant named hmx5177
Fernandez Genetic resources of saffron and allies (Crocus spp.)
CN108841981A (en) A method of identifying the big tea kind of persimmon using SSR finger-print
PINAR et al. Morphological, molecular, and self-(in) compatibility characteristics of new promising apricot genotypes
CN109392698A (en) A kind of Black Rice selection
Caetano-Anollés et al. DNA amplification fingerprinting and marker screening for pseudo-testcross mapping of flowering dogwood (Cornus florida L.)
US20200253143A1 (en) Iplants of justicia and their uses
CN106171948A (en) A kind of selection of wide handle mustard cytoplasm male sterility line
CN110804675A (en) Microsatellite DNA marker fingerprint spectrum of non-heading Chinese cabbage and application thereof
CN112813180B (en) Molecular marker and primer pair for identifying cabbage leaf wax powder character and application thereof
Tiago et al. Phenotypic characterization of cassava ethno-varieties in the state of Mato Grosso, Brazil.
CN105377022A (en) Onion which have less pungent taste and does not form lachrymatory factor
Costa et al. Breeding methods to obtain superior genotypes of okra
Sharma Advances in breeding of peach, plum and apricot
KR102019041B1 (en) A method of determining the drought tolerance in Maize
Ii et al. Screening of sex in asparagus at early growth stages
CN110506625B (en) I2A breeding method of high-quality three-line sterile line
CN110506626B (en) Breeding method of high-quality fragrant three-line sterile line I6A
CN114438239B (en) Molecular marker for identifying large 10 of mulberry variety Yuehong, identification primer group, kit and application
CN116814839B (en) Molecular marker AhyCs1 closely linked with peanut seed coat color speckles and application thereof
Alam et al. Molecular and Morphological Characterisation of Pakistani Guava Germplasm: Study of Pakistani Guava Germplasm

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant