CN108841981A - A method of identifying the big tea kind of persimmon using SSR finger-print - Google Patents
A method of identifying the big tea kind of persimmon using SSR finger-print Download PDFInfo
- Publication number
- CN108841981A CN108841981A CN201810639841.5A CN201810639841A CN108841981A CN 108841981 A CN108841981 A CN 108841981A CN 201810639841 A CN201810639841 A CN 201810639841A CN 108841981 A CN108841981 A CN 108841981A
- Authority
- CN
- China
- Prior art keywords
- tea
- persimmon
- ssr
- big
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method for identifying the big tea kind of persimmon using SSR finger-print, the conserved sequence such as SEQ ID NO in the special site SSR and its two sides in related tea tree full-length genome:1-SEQ ID NO:3.Using the big tea excellent variety of four portions of persimmons as sample material, including the big tea of persimmon 1, the big tea of persimmon 2, the big tea of persimmon 6 and the Shi great tea yellow race, 450 pairs of SSR primers are chosen in tea tree full-length genome carries out polymorphism screening, the process of identification mainly has tea tree Genome DNA extraction, the design of primer, PCR amplification, polymorphic allele statistics, 1 pair of primer is finally established as kind of a core primers for identification, effectively the big tea kind of four kinds of persimmons is distinguished completely, not only contribute to the protection and popularization to the big tea kind of persimmon, simultaneously, it various is declared using the big fresh tea leaves of persimmon as tealeaves made of raw material for what is sold in the market, provide one quickly, accurate discrimination method.
Description
Technical field
The invention belongs to technical field of molecular biology, it is related to a kind of identifying the big tea kind of persimmon using SSR finger-print
Method.
Background technique
The big tea of persimmon, the provincial improved tea variety in Anhui Province.Sexual propagation system is tea specific to the Taiping Houkui Tea tea place of production of Huangshan District
Kind is set, shrub type, great Ye class, middle bud kind are belonged to.It is the suitable best kind for making Taiping Houkui Tea in traditional well-known tea, and development
One of the necessary condition of Taiping Houkui Tea tea production.The big tea plant of persimmon is moderate, and tree performance half opens, and branch is diluter, and internode is shorter, blade
Slightly upper ramp-like growth, blade is plump, and elliptic leaf is similar to the lobe of the lung, dark green leaf color, rich gloss, blade face protuberance, food value of leaf softness.Bud-leaf is raw
It is strong to educate power, it is good to hold tender property.Winter resistance, adaptable, robustness is weak, is suitble to be grown in the hilly country Di Shan, every per mu yield 100Kg
Left and right.Tealeaves is rich in nutriment, and spring tea two leaves and a bud dry sample is containing about amino acid 3.6%, tea polyphenols 23.8%, catechin total amount
13.6%, caffeine 4.0%.Green tea processed is fitted, Taiping Houkui Tea processed, shape is straight and upright, and flat neat and well spaced, big and tall heavy reality, color is verdant, whole body
Pekoe, containing without revealing, vein is in " roxburgh peristrophe herb ", and millet paste apricot is green limpid, delicate fragrance, and flavour is mellow tasty and refreshing, and tea residue is yellowish green bright, plump
It is soft.It is the irreplaceable production raw material of well-known tea Taiping Houkui Tea.
The demand of this China Ji Nian Famous High-quality Tea is increasing constantly cultivates successfully with new tea cultivar, and only the big tea of persimmon has been just
Many new varieties such as the big tea of persimmon 1, the big tea of persimmon 2, the big tea of persimmon 6 and the Shi great tea yellow race are cultivated, with the big tea production of different persimmons
Famous green tea out is also not quite similar in quality and price, and consumer is only with being visually difficult to be to discriminate between it from mode of appearance
True and false and production raw material difference.As country is constantly perfect to Plant new variety protection system, more and more breedings
Person enhances the consciousness of new varieties power protection, actively applies for New variety protection.
Summary of the invention
The purpose of the present invention is to provide a kind of methods for identifying the big tea kind of persimmon using SSR finger-print, are referred to using SSR
Line graphical spectrum technology distinguishes four kinds of big tea of persimmon, and one unique Fingerprint Identity of the big tea kind of four kinds of persimmons is given on DNA level,
To achieve the purpose that protect persimmon big tea excellent variety power, be beneficial to the protection and popularization to the big tea excellent variety of persimmon, also for
The true and false identification for selling the big tea of persimmon in the market provides a fast and accurately method.
Its specific technical solution is：
A method of identifying the big tea kind of persimmon using SSR finger-print, be related in tea tree genome one it is special micro-
The site satellite SSR, the repetitive unit in the site are by six base compositions, degree of variation highest in tea tree genome, specifically
Site SSR site sequence such as SEQ ID NO:Shown in 1；
The special site SSR two sides conserved sequence such as SEQ ID NO in above-mentioned tea tree genome:Shown in 2；
Sequence such as SEQ ID NO on the left of conserved sequence:Shown in 3.
Further, the primer sequence according to designed by SSR design of primers principle is：
Upstream：5'TGGGTTTCTTAGAGGGGATA 3'Tm：54.1℃
Downstream：5'TGGAGACAATGGAGGTAATG 3'Tm：52.8℃.
Further, the screening step of the primer is as follows：The extraction of tea tree total DNA, according to tea tree whole genome sequence
Carry out the selection in the site SSR and the design screening of primer, PCR amplification and Fragment AnalyzerTMFull-automatic capillary electricity
Swimming system primary dcreening operation, filters out core primers according to electrophoresis result.
Further, the tea tree Genome DNA extraction be with the CTAB method of improvement to the fresh leaf that source area is adopted be material into
Row extracts.The tea tree whole genome sequence carries out the selection and design of primers screening in the site SSR, is specifically obtaining 100,000
In sequence containing the site SSR, hexabasic base is in tea tree genome compared with the abundant and higher microsatellite type of polymorphism.Therefore root
3000 sequences containing the site SSR are chosen according to following principle, successfully devise 450 pairs of primers, wherein SSR primer screening
Principle is as follows：
1. the length of primer is 18-23bp, target fragment is in 250bp-380bp or so.
2. G/C content is 45%-55%, three or four continuous bases are avoided the occurrence of in primer sequence,
3. annealing temperature, at 45 DEG C -58 DEG C, preferably at 50 DEG C or so, upstream and downstream primer Tm value is not much different in 4 DEG C
4. the end of primer 3 ' avoids the occurrence of 3 or more continuous bases, primer dimer and hairpin structure are avoided as far as possible
Further, PCR product is specifically drawn 2 microlitres and passes through Fragment by PCR amplification and Capillary Electrophoresis primary dcreening operation
The full-automatic capillary electrophoresis system of AnalyzerTM carries out primary dcreening operation, and the primary dcreening operation of primer is carried out by comparing with target fragment, chooses
Amplification rate is high, band is bright, and the good PCR product of peak type passes through Fragment AnalyzerTMFull-automatic capillary electrophoresis system into
Row secondary screening can accurately reflect the difference between loci, filter out the high primer of polymorphism.
Compared with prior art, beneficial effects of the present invention：
1) primer that the present invention is developed is built upon on tea tree genome, compared with EST-SSR, high with polymorphism,
Feature more than quantity.It is final to determine a pair of of core primers for the identification to kind also by a large amount of primer screening.
2) for the present invention using SSR fingerprint pattern technology, which sent out recently as Development of Molecular Biology
A kind of application genetic germplasm analysis method that exhibition is got up has stability good, easy to operate, the high feature of accuracy rate, to not
With the identification of tea tree excellent variety provide one accurately and fast, simple method.
3) material selected by the present invention is not limited by season, environment and testing time, can be grown to kind any
Any organ in period or the dry tea for making storage a period of time carry out DNA extraction, do not affect its qualification result.
4) present invention selected by primer screening is the full-automatic capillary electrophoresis system of Fragment Analyzer TM,
The system has the characteristics that high throughput, safe ready, high sensitivity, to a set of fast, accurately SSR fingerprint pattern technology of building
Very big effect is played, and shortens the period to the identification of persimmon big tea excellent variety.
Detailed description of the invention
The big tea dry tea of four kinds of persimmons and fresh leaf DNA agarose gel electrophoresis figure that Fig. 1 is extracted；
The PCR product full-automatic Capillary Electrophoresis of Fragment Analyzer TM of four tea tree breeds of Fig. 2 primer pair is solidifying
Glue figure；
Fig. 3 primer repeats the big tea capillary electrophoresis fingerprint of four kinds of persimmons three times, wherein Fig. 3 A is the big tea of persimmon 1, Fig. 3 B
The big tea of persimmon 2, the big tea of Fig. 3 C persimmon 6, Fig. 3 D Shi great tea yellow race.
Specific embodiment
Technical solution of the present invention is described in more detail with specific embodiment with reference to the accompanying drawing.
The extraction of 1 fresh tea leaves total DNA of embodiment
(1) tea tree breed selected：The big tea of persimmon 1；The big tea of persimmon 2；The big tea of persimmon 6；The Shi great tea yellow race.By Agriculture of Anhui
University Guo river modern agriculture demonstration area Research Base provides
(2) using selected tea tree breed as material, total DNA is extracted using CTAB method, specific operation process is：
1. 2ml centrifuge tube is taken to add the dry tea powder 0.1g ground, add 900mL CTAB extracting solution (being preheated to 65 DEG C in advance),
Add 20mL beta -mercaptoethanol, 65 DEG C of water-bath 20min gently shake up several times up and down every 10min, and then plus 10mLRNAase is placed on
65 DEG C of water-bath 15min, shake up several times every 5min or more.
2. 13000r/min is centrifuged 10min, takes supernatant 800mL, add 400mL Tris balance phenol, add isometric
The chloroform of (800mL)：Isoamyl alcohol is to 2mL, mixing of turning upside down, 13000r/min, is centrifuged 10min, takes supernatant 650mL to newly
2ml pipe in, chlorination is imitative：Isoamyl alcohol 650mL, is mixed by inversion, 13000r/min, is centrifuged 5min, supernatant 500mL is taken to be placed in newly
2ml pipe in.
3. plus at ethyl alcohol (dehydrated alcohol and to be placed in -20 DEG C of refrigerators, be finished and be put into refrigerator in time) to 2ml, on
It overturns down (to have floccule to occur) several times and is placed on standing 5min (time can lengthen) in -20 DEG C of refrigerators, outwell in pipe
Ethyl alcohol adds at ethyl alcohol to 2ml, gently mixes up and down and outwells ethyl alcohol (when of falling ethyl alcohol not outwell DNA) afterwards several times, then
8000r/min, 30s outwell remaining ethyl alcohol.
4. plus 500mLddH2O, be placed on 37 DEG C of water-bath dissolving DNAs, general 4min is put and 5min is pre-chilled on ice, adds cold ethyl alcohol extremely
2mL, mixing of gently turning upside down.It is centrifuged 3min, 13000r/min, void column is centrifuged 2min, 8000r/min, if seeing precipitating
Object is not that Transparent color repeats step 4.
5. blank pipe is placed on vacuum pump extracting 15min, see that solid surplus adds 200mlddH2O measures its nucleic acid content,
And with 0.8% agarose electrophoresis.
The selection in the site embodiment 2SSR and the primary dcreening operation of primer
It is more and more as the site SSR of repetitive unit using Hexanucleotide in obtaining 100,000 sequences containing the site SSR
State property is higher.Therefore according to following principle choose 4000 sequences containing the site SSR, successfully devise 450 pairs of primers (by
General biosynthesis), wherein the principle of SSR primer screening is as follows：
1. the length of primer is 18-22bp, target fragment is between 250bp-380bp.
2. G/C content is 40%-60%, three or four continuous bases are avoided the occurrence of in primer sequence；
3. annealing temperature, at 45 DEG C -55 DEG C, preferably at 50 DEG C or so, upstream and downstream primer Tm value is not much different in 4 DEG C；
4. the end of primer 3 ' avoids the occurrence of 3 or more continuous bases, primer dimer and hairpin structure are avoided as far as possible.
Embodiment 3PCR amplification and Fragment AnalyzerTMFull-automatic capillary electrophoresis system primary dcreening operation
Reaction total system is 20 μ L, the wherein 2 μ L of DNA solution of 50ng/ μ L, 10 μM of upstream and downstream primers each 0.5 μ L, 10 ×
EasyTaq Buffer 2μL,EasyTaq DNA Polymerase 1units,2.5mM dNTP 2μL,ddH2O 12.8μL。
(reagent source is in Transgeng biotech firm)
PCR response procedures are:94 DEG C of initial denaturation 5min, (94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C are prolonged 30 circulations
Stretch 30s), 72 DEG C of extension 10min, 4 DEG C of preservations, wherein annealing temperature is determined according to each primer.PCR amplification and Capillary Electrophoresis
PCR product is specifically drawn 2 microlitres and is carried out by the full-automatic capillary electrophoresis system of Fragment AnalyzerTM by primary dcreening operation
Primary dcreening operation carries out the primary dcreening operation of primer by comparing with target fragment.Selection amplification rate is high, band is bright, and the good PCR product of peak type passes through
Fragment Analyzer TMFull-automatic capillary electrophoresis system carries out secondary screening, can accurately reflect the difference between loci
It is different, filter out the high primer of polymorphism.
Embodiment 4Fragment AnalyzerTMFull-automatic capillary electrophoresis system secondary screening
Concrete operations process is：
1. the preparation of reagent：
1) match glue：Add the Inter calating Dye of 2 μ L in 40mL dsDNA 800Separation Gel, it is sufficiently mixed
It is even.
2)5×930dsDNA Inter Buffer：5 × Inter Buffer is diluted 5 times
3)5×Capillary conditioning solution：By 5 × Capillary conditioning
Solution dilutes 5 times, and 1mL Capillary conditioning solution is separately added into 96 orifice plates, is avoided out
Existing bubble.
4)Marker：It is separately added into 30 μ L 35bp-500bp Markers in 96 orifice plates, is added 20 microlitres in each hole
Mineral oil is sealed, centrifugation.
5) sample preparation：Each 20 μ L Dilution buffer of Kong Lijia and 2 μ L PCR products in 96 orifice plates, finally
24 μ L 35-500bp Range DNA Ladder are added in one hole, and centrifugation avoids the occurrence of bubble.
2. operating procedure：The prepared reagent of institute is put into instrument designated position, clicks the operation program of instrument.
3. data record and interpretation of result：The highest band of peak value is chosen in every band, records specific value size.To drawing
The requirement standard of object secondary screening has the following：1) master tape is clear, without extra miscellaneous band, 2) polymorphism value is high, and loci is more, and 3)
Band difference size is greater than 4bp between two similar locis, and 4) primer for meeting front three-point is weighed three times
Renaturation amplification, the good primer of selection repeatability, stability, final primer 54 of choosing draw as the core of the identification big tea kind of persimmon
Object, the big tea kind of primer pair persimmon amplify two specific locis, are 202bp and 215bp respectively, can be accurate, quickly
The big tea kind of identification persimmon be shown in Table 1, primer repeats capillary electrophoresis fingerprint three times and sees Fig. 4, due to Fragment
Analyzer TMAutomatically capillary electrophoresis system is minimum is distinguished as 2bp, therefore the big tea of primer pair persimmon
The two band institute allowed bands that kind is amplified are 202 ± 3bp, 215 ± 3bp respectively.
The genotype that 1 primer of table is amplified in four tea tree breeds
The identification of the big tea tree variety authentication of 4 four kinds of persimmons of embodiment
1) material to be tested：Four parts of fresh samples of the big tea of persimmon for not being distinguished kind, the big tea of persimmon 1, the big tea of persimmon 2, the big tea of persimmon 6
With the Shi great tea yellow race, it is separately encoded as A, B, C, D.
2) test method：1. extracting DNA to four parts of tea samples respectively, 2. this two parts of DNA of primer pair carry out PCR amplification, 3. use
Fragment Analyzer TMFull-automatic capillary electrophoresis system analyzes PCR product.
3) results and discussion：By the comparison to the big tea kind peak value of four kinds of persimmons, the spy that four parts of tea samples occur is counted respectively
Anisotropic loci, due to Fragment AnalyzerTMAutomatically capillary electrophoresis system is minimum is distinguished as 2bp, therefore draws
The two band point errors that object amplifies the big tea kind of persimmon are in ± 3bp.If the size of the A polymorphism band amplified is 298
± 3bp, then tea sample A is the big tea of persimmon 1, if the size of the polymorphism band of the tea sample B amplified is 304 ± 3bp, tea sample B
For the big tea of persimmon 2, similarly, as the size of fruit tea sample C, D polymorphism band amplified be respectively 313 ± 3bp, 325 ± 3bp and
317 ± 3bp, 345 ± 3bp, then tea sample C and tea sample D is respectively the big tea of persimmon 6 and the Shi great tea yellow race.If the tea sample amplified
The size of polymorphism band be not belonging to above-mentioned all banding patterns, then we are assured that the tea sample is not the big tea product of four kinds of persimmons
Any one of kind.
The foregoing is only a preferred embodiment of the present invention, the scope of protection of the present invention is not limited to this, it is any ripe
Know those skilled in the art within the technical scope of the present disclosure, the letter for the technical solution that can be become apparent to
Altered or equivalence replacement are fallen within the protection scope of the present invention.
Sequence table
<110>Agricultural University Of Anhui
<120>A method of identifying the big tea kind of persimmon using SSR finger-print
<160> 5
<170> SIPOSequenceListing 1.0
<210> 3
<211> 36
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
caccatcacc atcaccatca ccatcaccat caccat 36
<210> 1
<211> 300
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
gtctaaggag atgaaagtga tacattttta cagttgaggg gttcaaaatg tgtgggtttc 60
ttagagggga tatttggcca taactccttc ctagagcccc tttttcttga aaaggacaag 120
ttataatttt tttgctcata aactcctcca aaataaagaa atcttgtaag aaggacaaaa 180
ttttcagatt tatattttat gtgacaaatt taccccctta cacacacact ttctatctcc 240
atcaatttgt catctctctc tcagctcttt ctttctctat ctttttctaa gagctctctc 300
<210> 2
<211> 300
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ctccactacc atgactacca tcatttacat tacctccatt gtctccacca acaccgtctc 60
aaccaccggc accattcgtc accgcgccac taccgtttcg caccaccatc tcaaccacaa 120
gcgccattcg atgtcactgt accacgggca accaccatcg tcatccttag catctaagat 180
ctcagatctg agattgacga cctcagattt gagatctatc atctcagatc tgtattctct 240
ccctcttttt ccctttgtct catcatgttc tatttttcag acaacaaaat tttactctag 300
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
tgggtttctt agaggggata 20
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
tggagacaat ggaggtaatg 20
Claims (5)
1. a kind of method for identifying the big tea kind of persimmon using SSR finger-print, which is characterized in that be related in tea tree genome one
The special site microsatellite SSR, the repetitive unit in the site be by six base compositions, degree of variation in tea tree genome most
Height, specific site SSR site sequence such as SEQ ID NO:Shown in 1；
The special site SSR two sides conserved sequence such as SEQ ID NO in above-mentioned tea tree genome:Shown in 2；
Sequence such as SEQ ID NO on the left of conserved sequence:Shown in 3.
2. the method according to claim 1 for identifying the big tea kind of persimmon using SSR finger-print, it is characterised in that according to
Primer sequence designed by SSR design of primers principle is：
Upstream：5'TGGGTTTCTTAGAGGGGATA 3'Tm：54.1℃
Downstream：5'TGGAGACAATGGAGGTAATG 3'Tm：52.8℃.
3. the method according to claim 2 for identifying the big tea kind of persimmon using SSR finger-print, it is characterised in that described to draw
The screening step of object is as follows：The extraction of tea tree total DNA carries out selection and the primer in the site SSR according to tea tree whole genome sequence
Design screening, PCR amplification and Fragment AnalyzerTMFull-automatic capillary electrophoresis system primary dcreening operation, is sieved according to electrophoresis result
Select core primers.
4. the method according to claim 3 for identifying the big tea kind of persimmon using SSR finger-print, which is characterized in that described
It is that material extracts to the fresh leaf that source area is adopted that tea tree Genome DNA extraction, which is with the CTAB method of improvement,；The tea tree full genome
Group sequence carries out the selection and design of primers screening in the site SSR.
5. the method according to claim 3 for identifying the big tea kind of persimmon using SSR finger-print, which is characterized in that PCR expands
PCR product is specifically drawn 2 microlitres and passes through the full-automatic capillary of Fragment AnalyzerTM by increasing and Capillary Electrophoresis primary dcreening operation
Electrophoresis tube system carries out primary dcreening operation, and the primary dcreening operation of primer is carried out by comparing with target fragment, and selection amplification rate is high, band is bright, peak type
Good PCR product passes through Fragment AnalyzerTMFull-automatic capillary electrophoresis system carries out secondary screening, can accurately reflect
Difference between loci filters out the high primer of polymorphism.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810639841.5A CN108841981A (en) | 2018-06-20 | 2018-06-20 | A method of identifying the big tea kind of persimmon using SSR finger-print |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810639841.5A CN108841981A (en) | 2018-06-20 | 2018-06-20 | A method of identifying the big tea kind of persimmon using SSR finger-print |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108841981A true CN108841981A (en) | 2018-11-20 |
Family
ID=64203082
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810639841.5A Pending CN108841981A (en) | 2018-06-20 | 2018-06-20 | A method of identifying the big tea kind of persimmon using SSR finger-print |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108841981A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112997796A (en) * | 2021-03-08 | 2021-06-22 | 安徽农业大学 | Tea tree selfing breeding method |
| CN114574622A (en) * | 2022-03-28 | 2022-06-03 | 安徽农业大学 | SSR molecular marker combination for identifying teal new strain No.1, fingerprint spectrum and application of SSR molecular marker combination |
| CN115896333A (en) * | 2022-11-24 | 2023-04-04 | 安徽农业大学 | Method for identifying Jinyu No. 1 tea tree strain by using SSR fingerprint |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624321A (en) * | 2016-03-28 | 2016-06-01 | 安徽农业大学 | Method for identifying Huangkui tea tree variety by utilizing SSR fingerprint |
| CN106490200A (en) * | 2016-10-31 | 2017-03-15 | 黄山夫子峰茶业有限责任公司 | The big tea breeding of persimmon makes black tea by spreading the leaves on withering racks to dry processing technology |
| CN108034754A (en) * | 2018-01-15 | 2018-05-15 | 四川农业大学 | Differentiate the method for purple handsome new tea cultivar using SSR finger-prints |
| CN108148922A (en) * | 2018-02-02 | 2018-06-12 | 安徽农业大学 | For the SSR primers and identification method of the identification of grain rains scented tea tree and application |
-
2018
- 2018-06-20 CN CN201810639841.5A patent/CN108841981A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624321A (en) * | 2016-03-28 | 2016-06-01 | 安徽农业大学 | Method for identifying Huangkui tea tree variety by utilizing SSR fingerprint |
| CN106490200A (en) * | 2016-10-31 | 2017-03-15 | 黄山夫子峰茶业有限责任公司 | The big tea breeding of persimmon makes black tea by spreading the leaves on withering racks to dry processing technology |
| CN108034754A (en) * | 2018-01-15 | 2018-05-15 | 四川农业大学 | Differentiate the method for purple handsome new tea cultivar using SSR finger-prints |
| CN108148922A (en) * | 2018-02-02 | 2018-06-12 | 安徽农业大学 | For the SSR primers and identification method of the identification of grain rains scented tea tree and application |
Non-Patent Citations (1)
| Title |
|---|
| 刘升锐等: "安徽省"太平猴魁"茶区柿大茶群体种遗传多样性的SSR 分析", 《安徽农业大学学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112997796A (en) * | 2021-03-08 | 2021-06-22 | 安徽农业大学 | Tea tree selfing breeding method |
| CN114574622A (en) * | 2022-03-28 | 2022-06-03 | 安徽农业大学 | SSR molecular marker combination for identifying teal new strain No.1, fingerprint spectrum and application of SSR molecular marker combination |
| CN114574622B (en) * | 2022-03-28 | 2023-08-18 | 安徽农业大学 | SSR molecular marker combination for identifying tea tree No.1 of teal peak, fingerprint and application thereof |
| CN115896333A (en) * | 2022-11-24 | 2023-04-04 | 安徽农业大学 | Method for identifying Jinyu No. 1 tea tree strain by using SSR fingerprint |
| CN115896333B (en) * | 2022-11-24 | 2024-06-07 | 安徽农业大学 | Method for identifying Jinyu No. 1 tea tree strain by utilizing SSR fingerprint |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105624320B (en) | Identify the method for the tea morning tea tree breed that relaxes using SSR finger-print | |
| Chen et al. | Genetic diversity and differentiation of Camellia sinensis L.(cultivated tea) and its wild relatives in Yunnan province of China, revealed by morphology, biochemistry and allozyme studies | |
| CN102031253B (en) | Molecular marker method for identifying indica type rice and japonica rice by using rice grain | |
| CN108841981A (en) | A method of identifying the big tea kind of persimmon using SSR finger-print | |
| CN108148922A (en) | For the SSR primers and identification method of the identification of grain rains scented tea tree and application | |
| CN104928396A (en) | Method for rapidly identifying hot pepper species and golden pepper purity degree by using EST-SSR molecular markers | |
| CN103993070B (en) | A kind of SSR primer for exquisite joint melon hybrid seed purity qualification and method | |
| KR101532566B1 (en) | Primer for the Identification of Sesame Cultivar and Method for Identifying Sesame Cultivar | |
| CN107723381A (en) | Banana crown rot bacterium LAMP detection primer and its detection method | |
| CN110484648A (en) | A kind of Indel molecular labeling of the raw inflorescence of the novel single cluster of identification capsicum, primer and application | |
| CN110804675A (en) | Microsatellite DNA marker fingerprint spectrum of non-heading Chinese cabbage and application thereof | |
| CN114574622B (en) | SSR molecular marker combination for identifying tea tree No.1 of teal peak, fingerprint and application thereof | |
| Mukhopadhyay et al. | Omics advances of tea (Camellia sinensis) | |
| Sharma | Advances in breeding of peach, plum and apricot | |
| CN105377022A (en) | Onion which have less pungent taste and does not form lachrymatory factor | |
| Ghafoor et al. | Molecular characterization of Ephedra species found in Pakistan | |
| Omar | Morphological and Genetical Characterisation of the main Palestinian olive (Olea europaea L.) cultivars | |
| Nikmah et al. | Morphological and genetic variation in populations of Desmos chinensis Lour.(Annonaceae) | |
| CN105734123B (en) | The PCR identification method and related PCR primer and kit of extra large rice crops chromosome based on extra large rice crops DNA variation label | |
| Sánchez-Lucas | The effect of increasing temperature on olive trees (Olea europaea L. subsp. europaea) biology: An integrated morphological, phenological and biomolecular study | |
| CN116814839B (en) | Molecular marker AhyCs1 closely linked with peanut seed coat color speckles and application thereof | |
| Aldo et al. | Clonal selection of vitis vinifera cv. malbec: Confluence of science and nature | |
| Wei et al. | Genetic diversity analysis of Youxi bitter tea resources based on ISSR molecular markers | |
| CN115896333B (en) | Method for identifying Jinyu No. 1 tea tree strain by utilizing SSR fingerprint | |
| KR102669820B1 (en) | Primer set for determining origin of angelica gigas, and method for determinig origin of angelica gigas using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |