CN108118091A - Available for kit of the detection with the relevant PRMT6 gene promoter zone methylations degree of the carcinoma of the rectum and its application - Google Patents
Available for kit of the detection with the relevant PRMT6 gene promoter zone methylations degree of the carcinoma of the rectum and its application Download PDFInfo
- Publication number
- CN108118091A CN108118091A CN201711172986.0A CN201711172986A CN108118091A CN 108118091 A CN108118091 A CN 108118091A CN 201711172986 A CN201711172986 A CN 201711172986A CN 108118091 A CN108118091 A CN 108118091A
- Authority
- CN
- China
- Prior art keywords
- prmt6
- rectum
- carcinoma
- detection
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Abstract
The invention discloses being to include a pair of PRMT6 gene promoter areas fluorescent quantitation methylation-specific amplimer available for detection and the kit and its application, feature of the relevant PRMT6 gene promoter zone methylations degree of the carcinoma of the rectum, specific nucleotide sequence is as follows：Sense primer：5'‑AGCGATTAGATGTTGGAATG‑3'；Anti-sense primer：5'CCACACCATAATACTACTTCAC 3', the kit is applied in detection carcinoma of the rectum reagent or auxiliary diagnosis carcinoma of the rectum reagent is prepared, advantage is that easy to detect, with strong points, Detection accuracy is high, gene PRMT6 baseizations are horizontal negatively correlated with the illness rate of the carcinoma of the rectum, can be by measuring the auxiliary diagnosis carcinoma of the rectum to sample DNA methylation level.
Description
Technical field
The present invention relates to a kind of detection kits of the auxiliary diagnosis carcinoma of the rectum, can be used for detecting more particularly, to one kind and straight
The kit of the relevant PRMT6 gene promoter zone methylations degree of intestinal cancer and its application.
Background technology
Colorectal cancer is that the third-largest malignant tumour, China in Recent Years colon cancer morbidity are increased sharply by 7% to 13% in the world.
Colorectal Cancer and life style, heredity, Colorectal Adenomas etc. are in close relations, and age of onset becomes astogeny.Carcinomebryonic antigen
(CEA) as one of most widely used tumor markers, research points out that its sensibility and specificity is not enough to be used for
The diagnosis of colorectal cancer, particularly early diagnoses.Occult blood test (FOBT) is widely used in the noninvasive of colorectal cancer detection
Method generally includes two kinds of gFOBT and iFOBT.The former detects easily is influenced by factors such as food, drugs；If the latter is from adopting
Sample to laboratory treatment time more than 5 days, verification and measurement ratio will decline.Although colonoscopy has higher sensitivity and spy
The complication such as the opposite sex, but intestinal bleeding, enterobrosis, infection still have, while patient is poor to its compliance.In addition, knot is straight
Intestinal cancer is a kind of disease of complexity, mainly by inherent cause (such as：Proto-oncogene and DNA-repair gene mutation, tumor suppression base
Because function is lost) and such environmental effects.As the bridge factor of science of heredity and environment, epigenetic modification passes through DNA methyl
Change, genomic imprinting, the controlling genes expression such as histone modification.In addition, DNA methylation is as a kind of important epigenetics
Method of modifying, be widely applied with cancer screening, diagnosis and treatment in.Numerous studies show the anomalous variation of DNA methylation
The change of genome knob structure, DNA conformations, DNA stability and DNA and protein interaction mode can be caused, so as to
Gene expression is controlled, triggers cancer.Therefore, epigenetics change plays important work during tumour formation and development
With.There is research to point out to methylate in the early and late aberrant gene that all has recorded of colorectal cancer, it is possible that may be used as tying
The carcinoma of the rectum preferably screens biomarker.
Quantitative fluorescent PCR is the specific probe by fluorescent dye or fluorescent marker, PCR product is marked with
Track can monitor reaction process in real time, and combine the round pcr that corresponding software carries out product analysis.This method is compared with other tradition
Methylation detecting method significantly reduces in time, meanwhile, the change on the DNA gene levels of denier can be detected
With it is quantitative.Therefore, early diagnosis of the epigenetic variation to tumour of DNA in being organized in tumor patient is quantitatively detected, curative effect is commented
Estimate, the researchs such as mechanism are of great significance, be more suitable for hospital or scientific research institutions' operation.
Arginine N- transmethylases 6 (PRMT6) gene for encoding arginine N- transmethylase family proteins is located at dye
On colour solid 1p13.3.The major function of PRMT is the enzyme of protein of methylating in arginine residues, and lot of experiments is found
Its histone that can methylate, this is believed to the generation and the progress that influence cancer.In addition, it has been reported that；With chromatin knot
The member of the arginine N- transmethylases family of conjunction serves as transcriptional co-activator or corepressor, and in different cancers
It is found in disease type (such as prostate cancer, breast cancer and lung cancer).At present, disclose not yet both at home and abroad any on straight in knot
With the detection kit correlative study report of real-time fluorescence quantitative PCR detection PRMT6 gene promoter zone methylation degree in intestinal cancer
Road.
The content of the invention
The technical problems to be solved by the invention be to provide it is a kind of it is easy to detect, with strong points, Detection accuracy is high
Available for kit of the detection with the relevant PRMT6 gene promoter zone methylations degree of the carcinoma of the rectum and its application, wherein gene
PRMT6 baseizations are horizontal negatively correlated with the illness rate of the carcinoma of the rectum, can be straight by measuring auxiliary diagnosis to sample DNA methylation level
Intestinal cancer.
Technical solution is used by the present invention solves above-mentioned technical problem：It is relevant with the carcinoma of the rectum available for detecting
The kit of PRMT6 gene promoter zone methylation degree methylates including a pair of of PRMT6 gene promoter areas fluorescent quantitation
Specificity amplification primer, specific nucleotide sequence are as follows：Sense primer：5'-AGCGATTAGATGTTGGAATG-3'；
Anti-sense primer：5'-CCACACCATAATACTACTTCAC-3'.
It is above-mentioned to can be used for detection and the kit of the relevant PRMT6 gene promoter zone methylations degree of the carcinoma of the rectum, including
Fluorescent quantitation methylation status of PTEN promoter reaction system, consisting of：5 μ L SYBR Green I Master, 0.25 μ L concentration are
The sense primer of 62.3 μ g/mL, 0.25 μ l concentration are the anti-sense primer of 66.0 μ g/mL, 0.5 μ L DNA profilings and 4 μ L ddH2O；
Fluorescent quantitation methylation status of PTEN promoter reaction condition is as follows：1) 95 DEG C 10 minutes, then 95 DEG C 20 seconds, 59 DEG C 30 seconds, 72 DEG C
1 Xun Huan of 30 seconds 45 Xun Huans；2) 95 DEG C 15 seconds, the melting curve analysis of 58 DEG C of 1 minute and 0.11 DEG C per second to 95 DEG C
1 cycle in be carried out continuously；3) the final cooling stage of 10 minutes is carried out at 40 DEG C.Every sample sets three multiple holes, Human
For Methylated and Non-methylated DNA as positive, negative control, water is blank control.
It is above-mentioned that detection and the kit of the relevant PRMT6 gene promoter zone methylations degree of the carcinoma of the rectum can be used for prepare
The application in carcinoma of the rectum reagent or auxiliary diagnosis carcinoma of the rectum reagent is detected, the kit is opened including a pair of PRMT6 genes
Mover area fluorescent quantitation methylation-specific amplimer, specific nucleotide sequence are as follows：Sense primer：5'-
AGCGATTAGATGTTGGAATG-3'；Anti-sense primer：5'-CCACACCATAATACTACTTCAC-3'.
Compared with prior art, the advantage of the invention is that：Present invention firstly discloses available for detection and carcinoma of the rectum phase
The kit of the PRMT6 gene promoter zone methylation degree of pass and its prepare detection carcinoma of the rectum reagent or auxiliary diagnosis it is straight
Application in intestinal cancer reagent, the immue quantitative detection reagent box that methylates include to detect PRMT6 gene promoter areas CpG islands
A pair of of the specificity amplification primer to methylate is detected by SYBR Green fluorescent quantitations methylation status of PTEN promoter (qMSP)
PMRT6 gene promoter zone methylation changes in modification in subject's tissue is joined by the percentage that methylates for calculating PRMT6 genes
Number is with auxiliary diagnosis colorectal cancer.Relatively traditional colorectal cancer detection technique, which has, finds early, high sensitivity, and the cycle is short, simple
Convenient, detection efficiency is high, with strong points, testing result accurately and reliably, flexibly quick and economy the advantages of, it is straight to be conducive to knot
The early detection of intestinal cancer and in time treatment.
Description of the drawings
Fig. 1 is the correlation analysis according to TCGA database PRMT6 gene methylations and corresponding mRNA data；
Fig. 2 is the extension increasing sequence for the PRMT6 methylation assays downloaded according to UCSC data.A is that UCSC databases (GRCh37) expand
Increase the genomic locations and functional annotation of segment.Wherein qMSP primers underline, a CpG sites gray.F represents forward direction
Primer；R represents reverse primer.B is the sequencing result of PRMT6qMSP products.First behavior original series of sequence；The of sequence
The transformed sequence of two behaviors.C is the result of Capillary Electrophoresis.First row represents mark band；Secondary series represents blank；3rd row
Represent PRMT6 genophores.Electrophoresis result confirms that fragment length is 64bp, with being expected unanimously；
Fig. 3 is SYBR Green I fluorescent quantitation PCR amplification curves；
Fig. 4 is the representative graph of SYBR Green I fluorescent quantitation PCR solubility curves；
Fig. 5 for comparison of the PRMT6 gene promoter methylations level between cancerous tissue, cancer beside organism and normal person's intestinal tissue its
Middle tumor represents cancerous tissue, and median PMR is 0.3693；Para-tumor represents cancer beside organism, and median PMR is
0.6312；Normal represents normal person's intestinal tissue, and median PMR is 5.0655.PMR：Methylate percentage parameter；
Fig. 6 is ROC curve wherein (A) colorectal cancer tumor tissues and cancer of the PRMT6 gene methylations when diagnosing colorectal cancer
Between the tissue of side, between (B) colorectal cancer and normal intestinal tissue, PRMT6 is low between tissue and normal intestinal tissue by (C) tumour
The ROC curve of the diagnostic value to methylate.Tumor represents cancerous tissue；Para-tumor represents cancer beside organism；Normal is represented
Normal person's intestinal tissue；ROC：Receiver operating curves.AUC：Area under a curve.
Specific embodiment
The present invention is described in further detail below in conjunction with attached drawing embodiment.
1st, the collection of research object and sample
Collect First People's Hospital of Shaoxin City, Zhejiang Prov. Tumor Hospital, the 3rd affiliated hospital of Nanjing University of Traditional Chinese Medicine in August, 2011
Colorectal Carcinoma and each 121 of Carcinoma side normal tissue accordingly matching in January, 2015 general surgery excision.Suffer from
61.62 ± 11.55 years old person's age, wherein male 78, women 41；Tumor size：≤ 5cm 80,>5cm 40.Tissue
Differentiation degree：Differentiated or middle differentiation 101, it is low to break up or without differentiation 17；Without lymphatic metastasis 63, there is lymphatic metastasis
56.Wherein cancerous tissue is derived from the center of tumor tissues, and cancer beside organism is apart from more than cancerous tissue 5cm and is non-cancer tissue,
It non-row radiation and chemotherapy and is confirmed before all ODP in operation through histopathologic examination.In addition, it is received from Zhejiang Prov. Tumor Hospital
The colorectal carcinoma of 22 people taking physical examinations is collected as control.It is all to participate in the equal per rectum spectroscopy of experimenter and pathology inspection
It looks into and makes a definite diagnosis.Microexamination shows the cancer cell for having at least 80% in each freezing neoplasmic tissue sample, and in pairing
Tumour cell is not present in adjacent normal tissue sample.Cancer beside organism gathers with neoplasmic tissue sample in identical block and layer.
It is transported immediately in liquid nitrogen container after taken sample is in vitro, is then present in -80 DEG C of refrigerators.
Inclusion criteria：1. the Colon and rectum patient just controlled；2. intestines lesion is through proved by pathology；3. the requirement of intestines lesion is original
Morbidity stove rather than metastatic lesion；4. preoperative non-row chemicotherapy；5. without other malignant tumour medical histories.
Exclusion criteria：1. the Colon and rectum portion lesion of proved by pathology can not be obtained；2. there is serious unsteered internal disease
Or acute infection person；3. gestation or women breast-feeding their children.
It is all enter group objects inform and sign informed consent form.
2nd, the extraction of complete genome DNA
Using QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) DNA extraction kit extraction tissue full-length genome
DNA, then gained is detected by NanoDrop2000 ultramicrospectrophotometers (Thermo Fisher Scientific, the U.S.)
The concentration of DNA, for the detection of PRMT6 gene methylations level.
3rd, methylate modification
Using EZ DNA Methylation GoldTMKit methylates conversion reagent box (Zymo research, the U.S.), sternly
Lattice illustrate that step is operated according to kit.After this step, it is phonetic to be changed into urine for unmethylated cytimidine (C) in DNA sequence dna
Pyridine (U).
4th, TCGA databases PRMT6 methylates and corresponds to the correlation analysis of mRNA data
In order to assess PRMT6 methylate mRNA express between associating, download TCGA Colon and rectum gland cancer queues in 372
Valid data (the http of sample://www.cbioportal.org/).Understand PRMT6 gene methylations data and expression data
Apparent negative correlation is presented, as shown in Figure 1.
5th, methylated primers and probe design
From UCSC websites (http://genome.ucsc.edu/) download PRMT6, ACTB gene order (as shown in Figure 2).Fluorescence
Quantification PCR primer and probe are by 5.0 Software for Design of Primer Premier.Design standard：Primer amplification segment is in 80-150
Bp, primer length 17-25bp, G/C content approach as far as possible in 40%-70%, the Tm values of two primers.Avoid inside primer or it
Between formed more than 3bp complementary series.Probe length 20-30bp, the Tm values of probe are 5 DEG C -10 DEG C higher than primer, probe internal standard or
The complementary series of more than 3bp is avoided the formation of between probe and primer.
6th, SYBR Green fluorescent quantitations methylation status of PTEN promoter (qMSP)
Beta-actin (ACTB) is selected as internal reference, the difference of quality and quantity between correcting sample.Pass through excess
SssI transmethylases by human spermatogoa DNA exhaustive methylations be positive control.For negative control, we add to each hole
The water of nuclease free is entered.All bisulphite modified DNA are used as the template during qMSP is measured, and react
It is carried out in 384 orifice plates of LightCycler480.Reaction system composition final 10 μ l is 5 μ L SYBR Green I Master
(Roche, Basel, SUI), 0.25 μ L concentration are the sense primer of 62.3 μ g/mL, and 0.25 μ l concentration is under 66.0 μ g/mL
Swim primer, 0.5 μ L DNA profilings and 4 μ L ddH2O.And PCR is carried out under the following conditions：1) 95 DEG C 10 minutes, then 95 DEG C
20 seconds, 59 DEG C 30 seconds, 72 DEG C 30 seconds 45 cycle 1 cycle；2) 95 DEG C 15 seconds, 58 DEG C 1 minute and 0.11 DEG C it is per second extremely
It is carried out continuously in 1 Xun Huan of 95 DEG C of melting curve analysis；3) the final cooling stage of 10 minutes is carried out at 40 DEG C.
QMSP primer sequences are as follows：
Nucleotide sequence wherein shown in the fluorescent quantitation Methylation-specific primer of target gene PRMT6 promoter regions is as follows：
Sense primer：5'-AGCGATTAGATGTTGGAATG-3'；
Anti-sense primer：5'-CCACACCATAATACTACTTCAC-3'；
Nucleotide sequence wherein shown in the fluorescent quantitation Methylation-specific primer of reference gene ACTB is as follows：
Sense primer：5'-TGGTGATGGAGGAGGTTTAGTAAGT-3'；
Anti-sense primer：5'-AACCAATAAAACCTACTCCTCCCTTAA-3'.
7th, the data that methylate calculate
Real-time amplification curve (Fig. 3) and the solubility curve (figure formed according to the fluorescence signal collected in quantitative fluorescent PCR
4) PRMT6 genes, are calculated and methylate percentage parameter (PMR) accordingly with auxiliary diagnosis colorectal cancer.Computational methods：Methyl
Change percentage parameter=2-ΔΔCt, wherein Δ Δ Ct=sample DNA (CtPRMT6-CtACTB control)-exhaustive methylation DNA
(CtPRMT6-CtACTB control)。
Wherein, Ct values are meant that：Fluorescence signal in each reaction tube reaches the cycling undergone during the thresholding of setting
Number.Ct values are smaller, show that the concentration of target sequence is higher, and the PMR values for representing methylation level can directly exist
It is drawn in LightCycler480 softwares.CtPRMT6Represent the period of target gene；CtACTB controlIt represents positive with reference to ACT
The period of 1 B gene.
8th, interpretation of result
This experiment carries out finishing analysis using SPSS 18.0 to data.Inventor carries out PRMT6CpG islands methylation level
Rank sum test and independent sample rank sum test are matched, is found：PRMT6 gene methylations are horizontal less than group by cancer in cancerous tissue
It knits, PRMT6 gene methylations are horizontal in cancerous tissue is less than normal person's intestinal tissue, and PRMT6 gene methylations are horizontal in cancer beside organism
Less than normal person's intestinal tissue, and difference is respectively provided with statistical significance (P values are respectively less than 0.01, see Fig. 5).In order to quantitatively reflect
PRMT6 gene methylations diagnose the accuracy size of Risk of Colorectal Cancer, and it is special that inventor further analyzes its subject work
Levy curve (ROC curve).It is shown by Fig. 6, between tumor tissues and cancer beside organism, qMSP detection PRMT6 gene methylations are examined
Area (AUC) is 0.644 (95%CI=0.596- 0.733) under the ROC curve of disconnected Risk of Colorectal Cancer, and specificity is
53.7%, sensitivity is 74.4% (Fig. 6 A).Between tumor tissues and normal control, PRMT6 hypomethylations AUC is 0.958
(95%CI=0.919-0.999), specificity are 95.5%, and sensitivity is 78.5% (Fig. 6 B).In addition, in cancer beside organism and
Between normal control, PRMT6 hypomethylations generate significant AUC as 0.899 (95%CI=0.825-0.972), and specificity is
95.5%, sensitivity is 78.5% (Fig. 6 C), the statistically significant (P of difference<0.01), prompt to detect the gene methyl with qMSP
Change higher for the value of diagnosis of colorectal carcinoma.
Kit of the present invention detects colorectal cancer using SYBR Green fluorescent quantitations methylation status of PTEN promoter (qMSP) method
PRMT6 gene methylation degree in patient tissue sample and normal person's intestinal tissue has following distinguishing feature：It is (1) easy to operate,
Cycle is short.The kit can measure 96 samples simultaneously, greatly shorten detection time, be suitble to hospital or research institute's large-scale promotion
Using.(2) stability.The kit can preserve 12 months at a temperature of -20 DEG C, and sensitivity and specificity all do not decline.
The development plan of this project is using in the analysis postoperative cancerous tissue of colorectal cancer patients and cancer beside organism and normal person's intestinal tissue DNA
PRMT6 gene methylation degree, with reference to modern biology information technology and Principle of Statistics, provide easy to operate, high sensitivity,
The methylated quantitative detection method that cycle is short, testing result is reliable and stable, while carried for the follow up and prognosis evaluation of patient
For scientific basis.
In the present invention, the DNA sample can derive from any biological sample；It is highly preferred that the DNA choosings to be measured
Self-organizing (including paraffin-embedded tissue), cell, blood, serum, blood plasma, saliva, sperm, urine, excrement and other secretion.
Above description is not limitation of the present invention, and the present invention is also not limited to the example above.The art it is common
Technical staff is in the essential scope of the present invention, the variations, modifications, additions or substitutions made, should also belong to the protection of the present invention
Scope, protection scope of the present invention are subject to claims.
Sequence table
<110>University Of Ningbo
<120>Available for kit of the detection with the relevant PRMT6 gene promoter zone methylations degree of the carcinoma of the rectum and its application
<130>
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>PRMT6 gene promoter areas fluorescent quantitation methylation-specific amplification sense primer
<400> 1
5'- AGCGATTAGATGTTGGAATG-3' 20
<210> 2
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>PRMT6 gene promoter areas fluorescent quantitation methylation-specific amplification anti-sense primer
<400> 2
5'- CCACACCATAATACTACTTCAC-3' 22
<210> 4
<211> 25
<212> DNA
<213>Artificial sequence
<220>
<223>ACTB gene by fluorescence quantitative methylation-specific expands sense primer
<400> 4
5'- TGGTGATGGAGGAGGTTTAGTAAGT-3' 25
<210> 5
<211> 27
<212> DNA
<213>Artificial sequence
<220>
<223>ACTB gene by fluorescence quantitative methylation-specific expands anti-sense primer
<400> 5
5'- AACCAATAAAACCTACTCCTCCCTTAA-3' 27
Claims (3)
1. available for detection and the kit of the relevant PRMT6 gene promoter zone methylations degree of the carcinoma of the rectum, it is characterised in that
Including a pair of of PRMT6 gene promoter areas fluorescent quantitation methylation-specific amplimer, specific nucleotide sequence is as follows：Upstream
Primer：5'- AGCGATTAGATGTTGGAATG-3'；
Anti-sense primer：5'- CCACACCATAATACTACTTCAC-3'.
2. according to claim 1 can be used for detection and the relevant PRMT6 gene promoter zone methylations degree of the carcinoma of the rectum
Kit, it is characterised in that including fluorescent quantitation methylation status of PTEN promoter reaction system, consisting of：5 μL SYBR
Green I Master, 0.25 μ L concentration are the sense primer of 62.3 μ g/mL, and 0.25 μ l concentration is under 66.0 μ g/mL
Swim primer, 0.5 μ L DNA profilings and 4 μ L ddH2O；Fluorescent quantitation methylation status of PTEN promoter reaction condition is as follows：1）95℃
10 minutes, then 95 DEG C 20 seconds, 59 DEG C 30 seconds, 1 cycles of 72 DEG C of 30 seconds 45 cycles；2）95 DEG C 15 seconds, 58 DEG C 1 minute
It is carried out continuously in 1 Xun Huan of 0.11 DEG C per second to 95 DEG C of melting curve analysis；3）10 minutes final is carried out at 40 DEG C
Cooling stage.
3. it can be used for detection and the relevant PRMT6 gene promoter areas of the carcinoma of the rectum according to any one of claim 1-2
Application of the kit of methylation in detection carcinoma of the rectum reagent or auxiliary diagnosis carcinoma of the rectum reagent is prepared, feature exist
In：The kit includes a pair of PRMT6 gene promoter areas fluorescent quantitation methylation-specific amplimer, specific nucleosides
Acid sequence is as follows：Sense primer：5'- AGCGATTAGATGTTGGAATG-3'；Anti-sense primer：5'-
CCACACCATAATACTACTTCAC-3'。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711172986.0A CN108118091B (en) | 2017-11-22 | 2017-11-22 | Kit for detecting methylation degree of PRMT6 gene promoter region related to colorectal cancer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711172986.0A CN108118091B (en) | 2017-11-22 | 2017-11-22 | Kit for detecting methylation degree of PRMT6 gene promoter region related to colorectal cancer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108118091A true CN108118091A (en) | 2018-06-05 |
| CN108118091B CN108118091B (en) | 2020-12-15 |
Family
ID=62227895
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711172986.0A Active CN108118091B (en) | 2017-11-22 | 2017-11-22 | Kit for detecting methylation degree of PRMT6 gene promoter region related to colorectal cancer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108118091B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1852974A (en) * | 2003-06-09 | 2006-10-25 | 密歇根大学董事会 | Compositions and methods for treating and diagnosing cancer |
| WO2011096210A1 (en) * | 2010-02-03 | 2011-08-11 | Oncotherapy Science, Inc. | Prmt1 and prmt6 for target genes of cancer therapy and diagnosis |
| CN105125571A (en) * | 2015-07-17 | 2015-12-09 | 四川大学 | Application of PRMT1 (protein arginine N-methyltransferase 1) inhibitor to preparation of drug for treating cocaine addiction |
| CN105950723A (en) * | 2016-05-04 | 2016-09-21 | 王红卫 | Noninvasive methylation quantitative detection kit used for early diagnosis on colorectal cancer |
| US20160271149A1 (en) * | 2015-03-16 | 2016-09-22 | Epinova Therapeutics Corp. | Therapeutic compounds that suppress protein arginine methyltransferase activity for reducing tumor cell proliferation |
| CN106232833A (en) * | 2014-01-30 | 2016-12-14 | 加利福尼亚大学董事会 | The haplotyping that methylates (MONOD) for non-invasive diagnostic |
-
2017
- 2017-11-22 CN CN201711172986.0A patent/CN108118091B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1852974A (en) * | 2003-06-09 | 2006-10-25 | 密歇根大学董事会 | Compositions and methods for treating and diagnosing cancer |
| WO2011096210A1 (en) * | 2010-02-03 | 2011-08-11 | Oncotherapy Science, Inc. | Prmt1 and prmt6 for target genes of cancer therapy and diagnosis |
| CN106232833A (en) * | 2014-01-30 | 2016-12-14 | 加利福尼亚大学董事会 | The haplotyping that methylates (MONOD) for non-invasive diagnostic |
| US20160271149A1 (en) * | 2015-03-16 | 2016-09-22 | Epinova Therapeutics Corp. | Therapeutic compounds that suppress protein arginine methyltransferase activity for reducing tumor cell proliferation |
| CN105125571A (en) * | 2015-07-17 | 2015-12-09 | 四川大学 | Application of PRMT1 (protein arginine N-methyltransferase 1) inhibitor to preparation of drug for treating cocaine addiction |
| CN105950723A (en) * | 2016-05-04 | 2016-09-21 | 王红卫 | Noninvasive methylation quantitative detection kit used for early diagnosis on colorectal cancer |
Non-Patent Citations (5)
| Title |
|---|
| DIANE N SINGHROY等: "Automethylation of protein arginine methyltransferase 6 (PRMT6) regulates its stability and its anti-HIV-1 activity", 《RETROVIROLOGY》 * |
| MASANORI YOSHIMATSU等: "Dysregulation of PRMT1 and PRMT6, Type I arginine methyltransferases, is involved in various types of human cancers", 《CANCER CELL BIOLOGY》 * |
| 陈滢等: "循环核小体中组蛋白修饰与结直肠癌", 《现代肿瘤医学》 * |
| 马炯等: "结直肠肿瘤DNA甲基化标志的筛选及诊断价值", 《中华胃肠外科杂志》 * |
| 麻苗苗等: "蛋白质精氨酸甲基转移酶与肿瘤干预治疗", 《医学综述》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108118091B (en) | 2020-12-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108350504A (en) | The diagnostic method of carcinoma of urinary bladder | |
| CN108866192A (en) | Tumor marker STAMP-EP1 based on methylation modification | |
| WO2023071890A1 (en) | Methylation biomarker related to lymph node metastasis of gastric cancer, and combination and detection kit thereof | |
| TWI730429B (en) | HOXA7 methylation detection reagent | |
| TWI775168B (en) | Combination of gene markers and use thereof | |
| CN109554476A (en) | Tumor marker STAMP-EP3 based on methylation modification | |
| CN110257525A (en) | There is the marker and application thereof of conspicuousness to diagnosing tumor | |
| CN109456968A (en) | Tumor marker STAMP-EP5 based on methylation modification | |
| JP6381020B2 (en) | Method for obtaining information on colorectal cancer, and marker and kit for obtaining information on colorectal cancer | |
| US20080241842A1 (en) | Gene Methylation as a Biomarker in Sputum | |
| CN109652541A (en) | Tumor marker STAMP-EP6 based on methylation modification | |
| CN117431321A (en) | Nucleic acid composition for detecting prostatic cancer or precancerous lesions, kit and application | |
| Liu et al. | Multiple biomarker-combined screening for colorectal cancer based on bisulfate conversion-free detection of fecal DNA methylation | |
| CN107574248A (en) | A kind of the non-small cell lung cancer auxiliary diagnosis based on GALNT2 genes, prognostic evaluation kit and its application method | |
| Yu et al. | Urinary and plasma cell-free DNA comparison for lung cancer patients treated with epidermal growth factor receptor—thyroxine kinase inhibitors | |
| CN111662980A (en) | Lung cancer detection reagent and kit | |
| TWI775169B (en) | Lung cancer detection reagent and kit | |
| CN108118091A (en) | Available for kit of the detection with the relevant PRMT6 gene promoter zone methylations degree of the carcinoma of the rectum and its application | |
| CN106498062A (en) | A kind of product of diagnosis of prostate cancer and its application | |
| CN102732516B (en) | Multiplex nested methylation specific PCR (polymerase chain reaction) amplification primer and use method and application thereof | |
| CN102732637B (en) | Multiplex nested methylation specific PCR (Polymerase Chain Reaction) detection kit, using method and application thereof | |
| CN106282366A (en) | A kind of molecular marked compound relevant to carcinoma of prostate and application thereof | |
| CN109988844A (en) | Tumor marker STAMP-EP7 and its application based on methylation modification | |
| Schmidt et al. | A blood-based DNA test for colorectal cancer screening | |
| CN110055330A (en) | Tumor marker STAMP-EP9 and its application based on methylation modification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |