CN111662980A

CN111662980A - Lung cancer detection reagent and kit

Info

Publication number: CN111662980A
Application number: CN202010494277.XA
Authority: CN
Inventors: 李仕良; 吴孝林; 张志伟; 吴幽治; 陈新周; 肖丽雯; 邹鸿志
Original assignee: Guangzhou Kliming Biotechnology Co ltd
Current assignee: Guangzhou Kliming Biotechnology Co ltd
Priority date: 2020-06-03
Filing date: 2020-06-03
Publication date: 2020-09-15
Also published as: TWI815044B; TW202146662A; WO2021243905A1

Abstract

The invention belongs to the field of gene detection, and particularly relates to a lung cancer detection reagent and a kit. The test proves that the reagent of the invention can detect and diagnose the lung cancer with high sensitivity and high specificity, and has extremely high clinical application value.

Description

Lung cancer detection reagent and kit

Technical Field

The invention belongs to the field of gene detection, and particularly relates to a lung cancer detection reagent and a kit.

Background

Lung cancer is a malignant tumor of the lung that originates in the bronchial mucosa, glands or alveolar epithelium. The classification can be made according to the type of pathology: 1) small Cell Lung Cancer (SCLC): lung cancer, a pathological type of special, has a clear tendency to distant metastasis with a poor prognosis, but most patients are sensitive to radiotherapy and chemotherapy; 2) non-small cell lung cancer (non-small cell lung cancer, NSCLC): other pathological types of lung cancer besides small cell lung cancer include squamous cell carcinoma, adenocarcinoma, large cell carcinoma, and the like. There are certain differences in biological behavior and clinical course. According to the occurrence position, the method can be divided into the following steps: 1) central lung cancer (central lung cancer): lung cancer that grows in and above the segmental bronchiectasis; 2) peripheral lung cancer (periheral lung cancer): lung cancer that grows beyond the bronchial opening of the segment.

In recent years, the incidence and mortality of the lung cancer in China are gradually increased year by year due to the influence of factors such as aging population, air pollution, smoking and the like, and according to the annual report of 2017 Chinese tumor registration issued by the national cancer center, about 7 people per minute are diagnosed with the cancer nationally, wherein the incidence and mortality of the lung cancer are the first. China has become the world with the largest number of lung cancers, and experts predict that the number of lung cancers in China will reach 100 ten thousand in 2025. And according to epidemiological studies show that: smoking is an important factor causing lung cancer. About 80% -90% of lung cancers worldwide can be attributed to smoking. Compared with non-smokers, 1-19 cigarettes and more than 20 cigarettes smoked per day in the age of 45-64 years have relative risk of lung cancer of 4.27 and 8.61 respectively, and compared with non-smokers, 1-19 cigarettes and more than 20 cigarettes smoked per day for a long time have relative risk of lung cancer death of 6.14 and 10.73 respectively. Although the treatment technology of the lung cancer is changed day by day, the 5-year survival rate is only increased from 4% to about 12%, the existing antitumor drugs still only have the function of relieving the disease condition, the non-progress survival time of the patient is only prolonged by 3 months to 5 months on average, and for the first-stage lung cancer patient, the 5-year survival rate after the operation is as high as about 60% to 70%. Therefore, early diagnosis and early surgery of lung cancer are one of the most effective methods for improving 5-year survival rate and reducing mortality rate of lung cancer.

The current clinical auxiliary diagnosis of lung cancer mainly comprises the following diagnosis methods, but the diagnosis methods cannot completely realize early detection and early diagnosis:

(1) biochemical examination of blood: for primary lung cancer, there is currently no specific blood biochemical examination. The increase of blood alkaline phosphatase or blood calcium in lung cancer patients takes into account the possibility of bone metastasis, and the increase of blood alkaline phosphatase, glutamic-oxalacetic transaminase, lactate dehydrogenase or bilirubin takes into account the possibility of liver metastasis.

(2) Tumor marker examination: 1) CEA: abnormally high levels of CEA are found in the serum of 30-70% of lung cancer patients, but are found mainly in later stage lung cancer patients. The current examination of CEA in serum is mainly used to estimate lung cancer prognosis and to monitor the course of treatment. 2) NSE: the kit is a preferred marker for small cell lung cancer, is used for diagnosing the small cell lung cancer and monitoring the treatment response, and has different reference values according to different detection methods and used reagents. 3) CYFRA 21-1: the first choice marker of the non-small cell lung cancer has the sensitivity of 60 percent on the diagnosis of the squamous cell lung cancer, and the reference value is different according to different detection methods and used reagents.

(3) Imaging examination: 1) chest X-ray examination: chest orthoses and lateral pieces should be included. In primary hospitals, the positive chest radiograph is still the most basic and preferred image diagnosis method for the initial diagnosis of lung cancer. Once lung cancer is diagnosed or suspected, a chest CT examination is performed. 2) And (3) CT examination: chest CT is the most common and important examination method for lung cancer, and is used for diagnosis and differential diagnosis, staging and follow-up after treatment of lung cancer. CT guided lung biopsy is an important diagnostic technique for lung cancer, and a conditional hospital can be used for the diagnosis of lung lesions which are difficult to characterize and the clinical diagnosis of lung cancer needs cytological and histological verification and other methods are difficult to obtain materials. In recent years, multi-slice helical CT and Low Dose CT (LDCT) have been effective screening tools for early lung cancer and reduced mortality, and national lung cancer screening studies (NLST) in the united states have shown that LDCT can reduce lung cancer mortality by 20% compared to chest X-ray screening. Low dose helical CT is recommended as an important tool for early stage lung cancer screening, but human influence factors are more, and the false positive rate is very high. 3) Ultrasonic examination: the kit is mainly used for finding whether the vital organs of the abdomen, the abdominal cavity and the retroperitoneal lymph nodes are transferred or not, and is also used for detecting the cervical lymph nodes. For lung lesions or chest wall lesions close to the chest wall, the cyst solidity can be identified and puncture biopsy can be carried out under ultrasonic guidance; ultrasound is also commonly used for pleural effusion extraction positioning. 4) Bone scanning: the sensitivity to the detection of the bone metastasis of the lung cancer is high, but the false positive rate is certain. The following can be used: preoperative examination of lung cancer; patients with local symptoms.

(4) Other checks: 1) sputum cytology examination: the lung cancer is a simple and convenient noninvasive diagnosis method at present, the positive rate can be improved by about 60 percent through continuous smear examination, and the method is a routine diagnosis method for suspicious lung cancer cases. 2) Fiberbronchoscopy: one of the most important means in lung cancer diagnosis plays an important role in the qualitative and localized diagnosis of lung cancer and the selection of surgical schemes. Is a necessary routine examination item for a patient to be treated by surgery. And the bronchoscopy biopsy (TBNA) is beneficial to staging before treatment, but the technical difficulty and risk are higher, so that a person in need should go to a higher hospital for further examination. 3) And others: such as percutaneous lung puncture biopsy, thoracoscope biopsy, mediastinoscopic biopsy, hydrothorax cytology examination, etc., under the condition of an adaptation, the diagnosis can be assisted according to the existing conditions.

Multi-slice helical CT and Low Dose CT (LDCT) in imaging examinations are effective screening tools for finding early lung cancer and reducing mortality, and the national lung cancer screening study (NLST) in the united states has shown that LDCT can reduce mortality of 20% of lung cancer compared to chest X-ray screening. In clinical practice work, the success or failure of any lung cancer screening project is proved to depend on the identification of high risk groups, and a risk prediction model fusing multiple high risk factors is universally accepted as one of the methods for identifying the high risk groups of lung cancer. The risk model further improves the efficacy of lung cancer patients by assisting clinicians in improving interventions or treatments. Although the world has agreed that screening for high risk populations could reduce the current high mortality rate of lung cancer, high risk population definition remains an elusive problem. In order to maximize the benefit-to-injury ratio of lung cancer screening, the first critical issue is how to define the population at high risk; and secondly, screening the population by using what method, including definition of high risk factors, quantitative summarization of overall risks and selection of screening benefit threshold.

With the rapid development of the technology, the tumor marker detection becomes a new field of tumor diagnosis and treatment after the imaging diagnosis and the pathological diagnosis, and can have great influence on the diagnosis, the detection and the treatment of tumors. The tumor marker can be detected in body fluid or tissues and can reflect the existence, differentiation degree, prognosis estimation, personalized medicine, treatment effect and the like of tumors. Early lung cancer patients have no obvious symptoms and are difficult to detect by doctors and patients, and in addition, the early lung cancer patients have no obvious specific markers on blood or biochemical projects, so that early detection and early diagnosis are difficult to perform through a conventional diagnosis method, and the early lung cancer diagnosis, especially the screening of large-scale application population is difficult.

More and more studies have shown that two broad classes of mechanisms are involved in the process of tumor formation. One is the formation of mutations by changes in the nucleotide sequence of the DNA, a genetic mechanism. Tumors have been identified in the field of molecular biology as a genetic disease. Another is the epigenetic (epigenetics) mechanism, i.e., the change of gene expression level independent of DNA sequence change, and the role of it in the process of tumor formation is increasingly emphasized. The two mechanisms of genetics and epigenetics exist in a mutual crossing way, and the formation of tumors is promoted together. Aberrant methylation of genes occurs early in tumorigenesis and increases in the course of tumor progression. Analysis of the genome of 98 common primary human tumors revealed at least 600 abnormally methylated CpG islands per tumor.

Many studies have shown that promoter abnormal methylation is a frequent early event in the development of many tumors, and thus the methylation status of tumor-associated genes is an early sensitive indicator of tumorigenesis and is considered to be a promising molecular biomarker (biomarker). More importantly, the cancerous cells can release DNA into the peripheral blood. Free DNA is present in normal human peripheral blood on the nanogram scale. The research finds that abnormal methylation of the promoter of the tumor-related gene existing in the tumor tissue can be detected in peripheral blood plasma/serum and tumor-involved organ-related body fluid (such as saliva, sputum and the like). The biological samples are easy to obtain, and DNA in the biological samples can be sensitively detected after being massively amplified by a PCR technology, so that the methylation state of the promoter regions of certain tumor-related genes can be detected, and very valuable information can be provided for early diagnosis of tumors. There are many advantages to detecting promoter abnormal methylation compared to other types of tumor molecular markers. The abnormal methylation regions of the promoter of a certain gene in different types of tumors are the same, so that the detection is more convenient; in addition, compared to markers such as allelic deletion, aberrant methylation is a positive signal and is readily distinguishable from the negative background in normal tissue. Esteller et al examined the abnormal methylation state of the promoter regions of genes such as p16, DAPK, GSTP1 and MGM T in 22 cases of non-small cell lung cancer (NSCLC) tumor tissues and serum, and found that 68% (15/22) tumor tissues have promoter methylation of at least one gene; in 15 cases of tissue positivity, the presence of abnormal promoter methylation was also detected in the serum in 11 cases. In addition, many researchers have also detected the methylation of the promoters of some tumor-related genes from tumor tissues and sera of patients with liver cancer, head and neck cancer, esophageal cancer and colon cancer, respectively.

The existing lung cancer detection technology is mainly low in sensitivity, high in false positive and invasive, and the existing conventional detection technology is difficult to detect early lung cancer.

Noninvasive detection of lung cancer, such as sputum, is more difficult. Although some researchers research the tumor markers in the sputum of lung cancer patients, the success rate of sputum samples is very low when compared with the detection and evaluation of tumor markers of blood samples of other tumor patients. This is mainly due to the following reasons: firstly, the components of the sputum are relatively complex, and the differences of the components, the viscosity and the like of the sputum are relatively large under different diseases or environments of different people; sputum contains more components of non-lung cancer cells such as tracheal epithelial cells, bacteria, oral mucosa cells and the like, and a general sample processing method cannot effectively enrich sufficient DNA from lung cancer sources; ③ many smoking patients do not show expectoration. A study of the past 10 references by A J Hubers et al in molecular analysis for the diagnosis of lung cancer revealed that the median methylation degree of markers in lung cancer tissues was 48% and the median methylation degree of sputum was 38%, and the results showed that the detection rate of methylated markers in tissues was significantly higher than that of sputum. Meanwhile, Rosalia cirinilone (metabolism profile in tumor and particulate samples of lung cancer treated by particulate computer) reported that the detection rates of RARBeta2, P16 and RASSF1A in lung cancer tissues reach 65.5%, 41.4% and 51.7%, respectively, but only 44.4%, 5% and 5% in sputum.

At present, the omission rate of lung cancer is high. Especially, for the adenocarcinoma type, noninvasive detection of sputum is more difficult and has extremely low detection rate. This is because most of adenocarcinoma originates in small bronchi, and is peripheral lung cancer, and exfoliated cells in the deep lung are more difficult to expectorate by sputum. Therefore, the sputum detection means of the adenocarcinoma is almost zero at present.

Reducing the miss rate is particularly important in early tumor screening. If an early tumor screening product cannot screen all or most patients, missed patients will not be prompted with sufficient risk, thereby delaying the opportunity for treatment, which is a significant loss to the patient.

Although some tumor markers related to lung cancer have been found in the prior art, the detection reagent or detection means for these tumor markers are limited, so that the sensitivity and specificity of these tumor markers cannot meet the requirement, and therefore, further research on screening means capable of being applied to lung cancer in a practical manner is still needed in the art. However, while non-invasive screening has the unique advantage of sampling, it also has some limitations in other areas, for example, adenocarcinoma in lung cancer, which is generally considered by those skilled in the art to be unsuitable for non-invasive screening, due to the difficulty of expectoration of exfoliated cells from deep lung portions by sputum. On the other hand, even for other types of lung cancer, the non-invasive screening method reported at present is difficult to meet the requirements of clinical use. Although relevant research has progressed for many years, there is no noninvasive screening method for lung cancer that can be clinically advanced to date.

Disclosure of Invention

In one aspect, the invention provides a polypeptide as set forth in SEQ ID NO: 4 (hereinafter referred to as "nucleic acid fragment") in the preparation of a lung cancer detection reagent or kit. The "use" includes the use of SEQ ID NO: 4, that is to say, the nucleic acid sequence of SEQ ID NO: 4 (e.g., a smaller fragment) in the preparation of a lung cancer detection reagent or kit, are within the scope of the present application.

In some embodiments, the present invention provides a polypeptide as set forth in SEQ ID NO: 20 in the preparation of a lung cancer detection reagent or kit.

In one aspect, the invention also provides a primer selected from the group consisting of SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO: 8. SEQ ID NO:9, and at least any one of their complements.

In some embodiments, the primer is selected from SEQ ID No.: 1 and SEQ ID NO: 2; SEQ ID NO:5 and SEQ ID NO: 6; and SEQ ID NO:8 and SEQ ID NO: 9.

In some embodiments, the primer is selected from SEQ ID NO:1 and SEQ ID NO:2, and (b) a primer set shown in (2).

In one aspect, the invention also provides a probe selected from the group consisting of SEQ ID NOs: 3. SEQ ID NO: 7. SEQ ID NO: 10, and at least any one of their complements.

In some embodiments, the probe is selected from SEQ ID NOs: 3, and (b) is the sequence shown in the specification.

On one hand, the invention also provides application of the primer and/or the probe in preparation of a lung cancer detection reagent or kit.

The "detection" and diagnosis in the present invention include, in addition to early diagnosis of lung cancer, diagnosis of lung cancer at the intermediate and late stages, and also include screening of lung cancer, risk assessment, prognosis, disease identification, diagnosis of disease stage, and selection of therapeutic targets.

As an alternative embodiment to the stage of the condition, diagnosis may be made by measuring the degree of methylation of the nucleic acid fragments obtained from the sample as the progression of lung cancer at different stages or stages. A particular stage of lung cancer in a sample can be detected by comparing the degree of methylation of the nucleic acid fragment isolated from the sample at each stage of lung cancer to the degree of methylation of the nucleic acid fragment in one or more nucleic acids isolated from a sample that is free of cell proliferative abnormalities.

In another aspect, the present invention provides a lung cancer detection reagent comprising SEQ ID NO: 4.

"reagent for detecting methylation of nucleic acid fragment" includes the following: reagents for detecting the sequence of the nucleic acid fragment or any sequence smaller/shorter in the nucleic acid fragment. That is, any detection and detection reagent directed to any site (e.g., a smaller fragment) within the nucleic acid fragment is within the scope of the present application.

In some embodiments, the sequence of the nucleic acid fragment is as set forth in SEQ ID NO: shown at 20.

Methylation is caused by adding one more methyl group on cytosine, and cytosine can be changed into uracil after being treated by bisulfite or hydrazinate, because uracil is similar to thymine and can be identified as thymine when PCR amplification is carried out, namely cytosine which is not methylated is changed into thymine (C is changed into T) on a PCR amplification sequence, and methylated cytosine (C) is not changed. The technique for detecting methylated genes by PCR is usually MSP, and primers are designed for the treated methylated fragments (i.e. unchanged C in the fragments) to carry out PCR amplification, wherein if amplification exists, methylation is shown to occur, and if amplification does not exist, methylation does not exist.

In some embodiments, the methylation detection reagent detects the sequence of the nucleic acid fragment after bisulfite or hydrazine modification.

In some embodiments, the sequence of the nucleic acid fragment is detected after bisulfite modification.

In some embodiments, the methylation detection reagent comprises a sequence directed to SEQ ID NO: 4, and/or a primer and/or a probe for detecting methylation of the nucleic acid fragment shown in the specification.

In some embodiments, the upstream primer of the primers has any one of the nucleotide sequences shown below:

I. has the nucleotide sequences shown as SEQ ID NO. 1, SEQ ID NO. 5 and SEQ ID NO. 8; and

II. The complement of the sequence shown in I.

In some embodiments, the downstream primer of the primers has any one of the nucleotide sequences shown below:

III, has nucleotide sequences shown as SEQ ID NO 2, SEQ ID NO 6 and SEQ ID NO 9; and

IV, the complementary sequence of the sequence shown in III.

The primer is used for amplifying the nucleic acid fragment. It is well known in the art that successful design of primers is crucial for PCR. Compared with the general PCR, in the methylation detection, the design influence of the primer is more critical, because the methylation reaction promotes the conversion of 'C' in a DNA chain into 'U', the GC content is reduced, long continuous 'T' appears in the sequence after the PCR reaction, the DNA chain is easy to break, and the selection of the primer with a proper Tm value and stability is difficult; on the other hand, in order to distinguish between DNA that is treated with and without sulfurization and not treated completely, a sufficient number of "C" s are required for the primers, which all increase the difficulty in selecting stable primers. Therefore, in the detection of DNA methylation, the selection of the amplified fragment to which the primer is directed, such as the length and position of the amplified fragment, the selection of the primer, and the like, all influence the sensitivity and specificity of the detection. The inventor also finds that different amplified target fragments and primer pairs have different detection effects through experiments. Many times, some genes or nucleic acid fragments are found to have expression difference between tumor and non-tumor, however, the distance is converted into a tumor marker, and the application in clinic still has a long distance. The main reason is that the detection sensitivity and specificity of the potential tumor marker cannot meet the detection requirement due to the limitation of detection reagents, or the detection method is complex in operation and high in cost, and is difficult to apply in large scale in clinic.

In some embodiments, the probe has any one of the nucleotide sequences shown below:

v, having the sequence of SEQ ID NO: 3. SEQ ID NO: 7 and SEQ ID NO: 10;

VI, and the sequence complementary to the sequence shown in V.

In some embodiments, the reagents comprise detection reagents that include an internal reference gene.

In some embodiments, the reference gene is β -actin.

In some embodiments, the detection reagent for the reference gene is a primer and a probe for the reference gene.

In some embodiments, the reference gene detection reagent is SEQ ID NO: 11 and SEQ ID NO: 12 and the primer set shown in SEQ ID NO: 13, and (c) a probe as shown in fig. 13.

In some embodiments, the reagent further comprises at least one of bisulfite, or hydrazonium salts to modify the nucleic acid fragments, although it may not be.

In some embodiments, the reagents comprise DNA polymerase, dNTPs, Mg²⁺One or more of ions and buffer solution, preferably DNA polymerase, dNTPs, Mg²⁺And the PCR reaction system of ions and buffer solution is used for amplifying the modified nucleic acid fragment.

The sample to be detected by the detection/diagnostic reagent of the present invention may be selected from at least one of alveolar lavage fluid, tissue, pleural fluid, sputum, blood, serum, plasma, urine, prostatic fluid, or feces.

In some embodiments, the sample is selected from at least one of alveolar lavage fluid, tissue, sputum.

In some embodiments, the sample is selected from at least one of alveolar lavage fluid or sputum.

In one aspect, the invention also provides a kit comprising the primer, the probe or the lung cancer detection reagent.

In some embodiments, the kit comprises: a first vessel comprising a primer pair for amplification; a second container comprising a probe.

The tissue targeted by the detection reagent of the present invention is selected from lung cancer tissue and paracancerous normal tissue (or benign lung disease tissue).

In some embodiments, the lung cancer is selected from small cell lung cancer and non-small cell lung cancer.

In some embodiments, the non-small cell lung cancer is selected from squamous cell carcinoma, adenocarcinoma.

In one aspect, the present invention also provides a method for detecting methylation of the nucleic acid fragment, comprising the steps of:

(1) processing a sample to be detected by bisulfite or hydrazine to obtain a modified sample to be detected;

(2) carrying out methylation detection on the nucleic acid fragment of the modified sample to be detected in the step (1) by using the reagent or the kit;

in a preferred embodiment, in step (2), the detection is performed by real-time fluorescence quantitative methylation-specific polymerase chain reaction.

In another aspect, the invention also provides a lung cancer detection system. The system comprises:

seq ID NO: 4, and,

b. and (5) a result judgment system.

In some embodiments, the system comprises:

seq ID NO: 20, and,

d. a result judgment system;

in some embodiments, the methylation detection means comprises a detection reagent or kit as described above.

In some embodiments, the result determination means is for determining the presence of a nucleic acid molecule according to SEQ ID NO: 4, and outputting the risk of lung cancer and/or the type of lung cancer.

In some embodiments, the result determination means is for determining the presence of a nucleic acid molecule according to SEQ ID NO: 20, and outputting the risk of lung cancer and/or the type of lung cancer.

In some embodiments, the disease risk is determined by comparing the methylation results of the test sample and the normal sample according to the result determination, and when the methylation of the test sample and the methylation of the normal sample have a significant difference or a very significant difference, the result determines that the disease risk of the test sample is high.

In some embodiments, if the nucleic acid fragment is methylated positively, it indicates that the provider of the test sample is a lung cancer high-risk or lung cancer patient. In a preferred embodiment, the positive result is obtained by comparing the test result with the test result of a normal sample, and the donor of the test sample is positive when the amplification result of the test sample is significantly or very significantly different from the amplification result of the normal sample.

In some embodiments, the criteria of the decision system include: and judging the lung cancer specimen and the normal specimen according to the threshold value.

In some embodiments, the Cp value and/or the △ Cp value according to the target gene, i.e., the nucleic acid fragment (△ Cp value — Cp value)_{Targeted genes}-Cp_{Internal reference gene}) To determine the methylation level of the specimen.

In some embodiments, the Cp values in the specimen range from 35 to 39% and the Δ Cp values range from 4 to 12%.

In some embodiments, the cutoff value for Δ Cp value in tissue specimen is 5.4, the cutoff value for Cp value in sputum specimen is 36.9, and the cutoff value for Δ Cp value in lavage specimen is 11.2.

In some embodiments, a lung cancer specimen is determined if the tissue and lavage specimen have a Δ Cp value less than the cutoff value for the Δ Cp value, and a normal specimen is determined if the tissue and lavage specimen have a Δ Cp value greater than or equal to the cutoff value for the Δ Cp value. And if the Cp value of the sputum specimen is smaller than the critical value of the Cp value, judging the sputum specimen as a lung cancer specimen, and if the Cp value of the sputum specimen is larger than or equal to the critical value of the Cp value, judging the sputum specimen as a normal specimen.

The invention has the beneficial effects that:

although, in the prior art, methylation of some gene markers has been reported as one of the tumor markers of lung cancer. However, there are many reports on tumor markers of lung cancer, and the reports are really clinically applicable, but few of the reports are used as markers for lung cancer detection. The detection reagent aiming at the specific nucleic acid segment has high sensitivity and specificity to the lung cancer, and is very hopeful to be used as a tumor marker for clinical diagnosis of the lung cancer.

Based on the nucleic acid fragment and the detection reagent, the detection rate of lung cancer in a tissue specimen can reach 100% of specificity and 73.1% of sensitivity. Wherein squamous carcinoma can be detected completely. In the most difficult adenocarcinoma to detect, the specificity reaches 100.0%, and the sensitivity reaches 78.9%.

In addition, the nucleic acid segment of the invention has high specificity and sensitivity for different types of lung cancer, including squamous cell carcinoma and adenocarcinoma in small cell lung cancer and non-small cell lung cancer, has wide application range, and can be used as tumor markers of all lung cancers basically. The existing lung cancer markers for clinical use can only be generally applicable to detection of one type of lung cancer, such as NSE used for diagnosis of small cell lung cancer and monitoring of treatment response, while CYFRA21-1 is the first choice marker for non-small cell lung cancer.

The detection reagent and the method aiming at the specific nucleic acid fragment can conveniently and accurately judge the lung cancer and benign lung disease patients, and the gene detection method is expected to be converted into a gene detection kit and is used for screening, clinical detection and prognosis monitoring of the lung cancer.

Drawings

FIG. 1 is a ROC curve of the nucleic acid fragment detected in the tissue specimen in example 1;

FIG. 2 is a ROC curve of the nucleic acid fragment detected in the sputum specimen in example 2;

FIG. 3 is a ROC curve detected in a sample of the nucleic acid fragment lavage fluid of example 3;

FIG. 4 is a graph showing the amplification curve of the nucleic acid fragment in example 3.

Detailed Description

The technical solutions of the present invention are further illustrated by the following specific examples, which do not represent limitations to the scope of the present invention. Insubstantial modifications and adaptations of the present invention by others of the concepts fall within the scope of the invention.

In this application, a "normal" sample refers to a sample of the same type isolated from an individual known to be free of the cancer or tumor.

Samples for methylation detection in the present application include, but are not limited to, DNA, or RNA, or mRNA-containing DNA and RNA samples, or DNA-RNA hybrids. Wherein the DNA or RNA may be single-stranded or double-stranded.

As used herein, "methylation level" as well as "degree of methylation" can generally be expressed as a percentage of methylated cytosines, which is the number of methylated cytosines divided by the sum of the number of methylated cytosines and the number of unmethylated cytosines; and the methylation level is generally expressed by dividing the number of methylation target genes by the number of internal reference genes at present; and other prior art methylation level representation methods.

In this application, "sample" is the same as "specimen".

Example 1:

the inventor screens hundreds of gene markers and nucleic acid fragments, researches the distribution condition of methylation sites of each gene, and designs a primer probe for detection to be respectively used for real-time fluorescent quantitative methylation-specific polymerase chain reaction (qMSP) detection. Screening in a tissue sample, taking a beta-actin gene as an internal reference gene, and finally obtaining the polypeptide shown in SEQ ID NO: 4, the detection result of the nucleic acid fragment shown in the figure is better. Converting SEQ ID NO: comparing the detection effect of the 4 fragments with that of common lung cancer detection gene markers (PCDHGA12 and HOXD8), and detecting primer probes of each gene are as follows:

the detection primers and probes of the nucleic acid fragments are as follows:

SEQ ID NO:1, primer F: TTCGTCGTTTTCGTTATCATTC

SEQ ID NO:2, primer R: TACTAACCGCCTCGCTAC

SEQ ID NO: 3, a probe P: FAM-CGGGTTTTTGCGTCGTTATTCGTC-BQ1

The detection primers and probes of the PCDHGA12 are as follows:

SEQ ID NO: 14PCDHGA12 primer F: TTGGTTTTTACGGTTTTCGAC

SEQ ID NO: 15PCDHGA12 primer R: AAATTCTCCGAAACGCTCG

SEQ ID NO: 16PCDHGA12 probe P: FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1

The detection primers and probes for HOXD8 were:

SEQ ID NO: 17HOXD8 primer F: TTAGTTTCGGCGCGTAGC

SEQ ID NO: 18HOXD8 primer R: CCTAAAACCGACGCGATCTA

SEQ ID NO: 19HOXD8 probe P: FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1

The detection primer and the probe of the beta-actin are as follows:

SEQ ID NO: 11 beta-actin primer F: GGAGGTTTAGTAAGTTTTTTGGATT

SEQ ID NO: 12 beta-actin primer R: CAATAAAACCTACTCCTCCCTTA

SEQ ID NO: 13 β -actin probe P: FAM-TTGTGTGTTGGGTGGTGGTT-BQ1

The experimental process comprises the following steps:

1) extraction of DNA

Collecting the specimens of lung cancer patients and non-lung cancer patients, which respectively comprise paraffin tissue specimens, sputum specimens and lavage fluid specimens. After the sample is pretreated and the cells are separated, DNA extraction is carried out according to the instruction of HiPure FFPE DNAkit (D3126-03) of the kit of Meiji biological company.

2) DNA modification

EZ DNA Methylation using ZYMO RESEARCH Biochemical kit^TMKIT (D5002) indicates that bisulfite modification was performed.

3) Amplification and detection

TABLE 1 compounding System

An amplification system: see table 2 for amplification system.

TABLE 2 amplification System for nucleic acid fragments and beta-actin

TABLE 3 amplification systems for PCDHGA12 and HOXD8

4) The result of the detection

Sample information: the total number of lung tissue samples was 169, including 91 normal tissue samples, 78 cancer tissue samples, 27 squamous cell carcinomas, 38 adenocarcinoma, 3 small cell carcinomas, 4 large cell carcinomas, 1 composite carcinoma, 5 non-well-classified lung carcinomas, and 77 cancer and paracancer control samples among 78 cancer group samples.

The calculation method comprises the following steps:

nucleic acid fragment ACTB as reference gene and △ Cp value (△ Cp value Cp) of target gene, i.e. nucleic acid fragment_{Nucleic acid fragments}-Cp_ACTB) The methylation level of the specimen is judged, the threshold value line of the nucleic acid fragment is △ Cp value being 5.4, when the detection result is △ Cp value<5.4, the test was positive, and when the Cp value of △ was not less than 5.4, the test was negative.

PCDHGA12, HOXD 8: the Cp value of the threshold line of PCDHGA12 is 25.9, the Cp value of the threshold line of HOXD8 is 27.4, and each marker detection result is greater than or equal to the corresponding threshold line, and the marker is determined to be negative; if the marker detection result is less than the corresponding threshold line, it can be determined as positive.

The ROC graph 1 shows the detection of nucleic acid fragments in all tissue specimens according to this standard. The statistical results of the detection of each gene in the tissues are shown in Table 3.

TABLE 3 results of the assays in the organization

From the above results, it can be seen that the specificity of the nucleic acid fragment in the tissue sample for each analysis group was as high as 100%, and the sensitivity was 73.1% in the case of 100% in the normal group compared with the whole cancer group; compared with the normal group and the adenocarcinoma group, the sensitivity reaches 78.9 percent. The nucleic acid fragment still has higher sensitivity under the condition of zero false positive. While other gene markers still present the problem of false positives when testing tissue samples.

The sputum is used as a non-invasive detection sample and has more significance in lung cancer diagnosis, and therefore, the inventor detects the nucleic acid fragment in the sputum.

Example 2: detection in sputum samples

Sample information: the total number of sputum samples tested was 107, wherein 51 samples of the normal control group, 56 samples of the cancer group, 20 samples of squamous cell carcinoma, 8 samples of small cell carcinoma, 20 samples of adenocarcinoma, 1 sample of large cell carcinoma, 1 sample of giant cell carcinoma, and 6 samples of lung cancer which is not classified clearly.

The test process comprises the following steps:

in this example, the primer probe sequence of the nucleic acid fragment, the primer probe sequence of β -actin, and the DNA modification were the same as in example 1.

a. Sputum specimens of lung cancer patients and non-lung cancer patients were collected, and after being de-thickened with NaOH, cells were separated by centrifugation and pelleted, and washed 2 times with PBS, and then DNA was extracted using the DNA extraction Kit (HiPureFFPE DNA Kit, D3126-03) of Genetian (magenta).

b. The liquid preparation system is as follows:

TABLE 4 liquid formulation system

c. The amplification system was as follows:

TABLE 5 amplification System for nucleic acid fragments and beta-actin

TABLE 6 amplification systems for PCDHGA12 and HOXD8

d. The detection results are as follows:

nucleic acid fragment(s): determining the methylation level of the sample according to the Cp value of a target gene, namely a nucleic acid fragment by taking ACTB as an internal reference gene, wherein the threshold line of the nucleic acid fragment is as follows: cp value 36.9. If the Cp value is less than 36.9, the result is positive, and if the Cp value is more than or equal to 36.9, the result is negative.

PCDHGA12, HOXD 8: the Cp value of the threshold line of PCDHGA12 is 23.48, the Cp value of the threshold line of HOXD8 is 26.4, and each marker detection result is greater than or equal to the corresponding threshold line, and the marker is determined to be negative; if the marker detection result is less than the corresponding threshold line, it can be determined as positive.

TABLE 7 detection results in sputum

The ROC curve of the nucleic acid fragment detected in the sputum sample is shown in FIG. 2, the statistical results are shown in Table 7, and the results show that the detection rate of the nucleic acid fragment on all lung cancers is 64.3% and the detection rate on all squamous carcinomas can reach 80.0% under the condition that the specificity in the sputum sample is as high as 96.1%.

Example 3: detection in lavage fluids

Sample information: the total number of alveolar lavage fluid samples tested was 176, 94 samples in the normal control group, 82 samples in the cancer group, 20 squamous carcinomas, 40 adenocarcinoma, 9 small cell carcinomas, and 13 uncertain lung cancer types in the 82 cancer group. The gene detection primer probes are as follows:

the detection primers and probes of the nucleic acid fragments are as follows:

SEQ ID NO:1, primer F: TTCGTCGTTTTCGTTATCATTC

SEQ ID NO:2, primer R: TACTAACCGCCTCGCTAC

SEQ ID NO: 3, a probe P: FAM-CGGGTTTTTGCGTCGTTATTCGTC-BQ1

The detection primer and the probe of the beta-actin are as follows:

SEQ ID NO: 11 beta-actin primer F: GGAGGTTTAGTAAGTTTTTTGGATT

SEQ ID NO: 12 beta-actin primer R: CAATAAAACCTACTCCTCCCTTA

SEQ ID NO: 13 β -actin probe P: texas Red-TTGTGTGTTGGGTGGTGGTT-BQ2

The test process comprises the following steps:

a. alveolar lavage fluid specimens of patients with confirmed lung cancer and non-lung cancer were collected, cells were centrifuged, and then DNA was extracted using a DNA extraction Kit from Meiji Bio Inc. (HiPure FFPE DNA Kit, D3126-03).

b. The bisulphite modification of DNA was carried out using the DNA conversion Kit (EZ DNA Methylation Kit, D5002) from ZYMO RESEARCH Bio Inc.

c. The amplification detection system is as follows:

TABLE 8 amplification System

d. The detection system is as follows:

TABLE 9 amplification System

e. The detection results are as follows:

ACTB was used as an internal reference gene, and the target gene, i.e., the nucleic acid fragment, showed △ Cp value (△ Cp value — Cp value)_{Nucleic acid fragments}-Cp_ACTB) The methylation level of the specimen is judged, the threshold value line of the nucleic acid fragment is △ Cp value being 11.2, when the detection result is △ Cp value<11.2, positive, △ Cp value ≥ 11.2, and 176 lavage samples:

TABLE 10 test results

The ROC curve for nucleic acid fragment detection in lavage fluid samples is shown in FIG. 3, the amplification curve is shown in FIG. 4, and the statistics are shown in Table 10. From the results, the sensitivity of the nucleic acid fragment to all lung cancer groups reaches 69.5% under the high specificity of 97.9% for detection; according to the comparative analysis of the subtype of the lung cancer, the detection rate of the nucleic acid fragments in the squamous cell carcinoma group is 65.0 percent. Particularly, the detection effect on the adenocarcinoma is achieved, and the detection sensitivity of the nucleic acid fragment is as high as 80.0%, so that the breakthrough has great significance on the detection of the adenocarcinoma. Since adenocarcinomas are generally peripheral, alveolar lavage fluid does not easily reach the alveoli or cancerous tissues in the deep lung due to the dendritic physiology of the bronchi.

Example 4 Effect of primer probes on the detection Effect

The primers and the probes also have great influence on the detection effect of the tumor marker, and in the research process, the inventor designs a plurality of pairs of primers and corresponding probes to find the probes and the primers which improve the detection sensitivity and specificity as much as possible, so that the detection reagent can be practically applied to clinical detection. The partial primers and probes are shown in Table 11 below, and the results of the measurements are shown in Table 11 below.

TABLE 11 primers and probes

All the liquid preparation systems are consistent, and the liquid preparation systems are as shown in the table 4; the amplification procedures were identical and are shown in Table 5.

Different primer probe combinations are detected in 40 sputum samples, wherein 15 samples in a normal control group and 25 samples in a cancer group have the following detection results of the primer probes in each group:

TABLE 11 test results in sputum samples (Normal group vs. all cancer groups)

Group of	Specificity of	Sensitivity of the reaction
			F1，R1，P1	93.3％	72.0％
F2，R2，P2	93.3％	44.0％
			F3，R3，P3	93.3％	68.0％

The results show that different primer pairs aiming at the same region can influence the detection result. Under the condition of consistent specificity, the primer and probe combination of F1, R1 and P1 has higher sensitivity.

Sequence listing

<110> Congliming Biotechnology, Inc. of Guangzhou City

<120> lung cancer detection reagent and kit

<160>20

<170>SIPOSequenceListing 1.0

<210>1

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ttcgtcgttt tcgttatcat tc 22

<210>2

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tactaaccgc ctcgctac 18

<210>3

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

cgggtttttg cgtcgttatt cgtc 24

<210>4

<211>1176

<212>DNA

<213>Homo sapiens

<400>4

tcctatcgat ccgcccgcgg ttccattcat ctctgacaag tccctctgcg cacccgccct 60

ctagctctgg acgcctcctc tctcacccct acccttcccc atccagctgc agagaaaagc 120

cccaagctct gtgctctggc ccccgtatgg gttccccttt cgagacggag cccccaaccc 180

gccagtaacc taactcccca tagagacgca gggtgctagc gctccctccc gccgagggga 240

ggagactggg gcctttggaa ggtacagaat gctgggcaga ggtgaggcag aacaggaggg 300

ctacaccggg agccccaact tcttaaggga tctagggttt gcgctctgcc tagcgcccca 360

acaggccctc cagtcgcaac ctgcgcgcgc tctctctctc gctctctctc tgatcccgga 420

gagagcgagg caaggagggg gtcgccccgc aggagcccta tgtaaatcct ggtgttgggt 480

gggtgggtgg ggagggggaa gggaagaagg ggaaataaac ctctttggct ggagtggggt 540

ccgggtgagc agatttcctt atccgggaat cgcaggcggg gcggccattg gctcggagga 600

tcacgtgggc gcctaacttt gttcacttga cagtaagtag gagggctttc ggaaacagga 660

aaacgagtca ggggtcggaa taaattttag tatattttgt gggcaattcc cagaaattaa 720

tggctatgag ttcttttttg atcaactcaa actatgtcga ccccaagttc cctccatgcg 780

aggaatattc acagagcgat tacctaccca gcgaccactc gcccgggtac tacgccggcg 840

gccagaggcg agagagcagc ttccagccgg aggcgggctt cgggcggcgc gcggcgtgca 900

ccgtgcagcg ctacgcggcc tgccgggacc ctgggccccc gccgcctccg ccaccacccc 960

cgccgccccc gccaccgccc ggtctgtccc ctcgggctcc tgcgccgcca cccgccgggg 1020

ccctcctccc ggagcccggc cagcgctgcg aggcggtcag cagcagcccc ccgccgcctc 1080

cctgcgccca gaaccccctg caccccagcc cgtcccactc cgcgtgcaaa gagcccgtcg 1140

tctacccctg gatgcgcaaa gttcacgtga gcacgg 1176

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

attcgttcgg gtattacgtc 20

<210>6

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ccaaaatccc gacaaaccg 19

<210>7

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

cggttagagg cgagagagta gttt 24

<210>8

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

cgggtttcgg gcggcgcgc 19

<210>9

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

cgaacgataa cgaaaacgac g 21

<210>10

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

cgtgtatcgt gtagcgttac gcgg 24

<210>11

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ggaggtttag taagtttttt ggatt 25

<210>12

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

caataaaacc tactcctccc tta 23

<210>13

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ttgtgtgttg ggtggtggtt 20

<210>14

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

ttggttttta cggttttcga c 21

<210>15

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

aaattctccg aaacgctcg 19

<210>16

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

attcggtgcg tataggtatc gcgc 24

<210>17

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

ttagtttcgg cgcgtagc 18

<210>18

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

cctaaaaccg acgcgatcta 20

<210>19

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

aaaacttacg atcgtctacc ctccg 25

<210>20

<211>344

<212>DNA

<213>Homo sapiens

<400>20

acctacccag cgaccactcg cccgggtact acgccggcgg ccagaggcga gagagcagct 60

tccagccgga ggcgggcttc gggcggcgcg cggcgtgcac cgtgcagcgc tacgcggcct 120

gccgggaccc tgggcccccg ccgcctccgc caccaccccc gccgcccccg ccaccgcccg 180

gtctgtcccc tcgggctcct gcgccgccac ccgccggggc cctcctcccg gagcccggcc 240

agcgctgcga ggcggtcagc agcagccccc cgccgcctcc ctgcgcccag aaccccctgc 300

accccagccc gtcccactcc gcgtgcaaag agcccgtcgt ctac 344

Claims

1. As shown in SEQ ID NO: 4 in the preparation of a lung cancer detection reagent or kit.

2. A primer selected from the group consisting of SEQ ID NOs: 1. SEQ ID NO: 2. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO: 8. SEQ ID NO:9, and at least any one of their complements;

preferably, the primer is selected from SEQ ID NO:1 and SEQ ID NO: 2; SEQ ID NO:5 and SEQ ID NO: 6; and SEQ ID NO:8 and SEQ ID NO:9, at least one pair of primers;

preferably, the primer is selected from SEQ ID NO:1 and SEQ ID NO:2, and (b) a primer set shown in (2).

3. A probe selected from the group consisting of SEQ ID NOs: 3. SEQ ID NO: 7. SEQ ID

NO: 10, and at least any one of their complements;

preferably, the probe is selected from SEQ ID NO: 3, and (b) is the sequence shown in the specification.

4. Use of the primer and/or probe of claim 2 or 3 in the preparation of a lung cancer detection reagent or kit.

5. A reagent for detecting lung cancer, wherein the reagent comprises SEQ ID NO: 4.

6. The use of claim 1 or the reagent of claim 5, wherein the nucleic acid fragment has a sequence as set forth in SEQ ID NO: shown at 20.

7. The lung cancer detection reagent according to claim 5 or 6, wherein the methylated detection reagent comprises a sequence directed to SEQ ID NO: 4, and/or a primer and/or a probe for detecting methylation of the nucleic acid fragment shown in the figure;

preferably, the methylated detection reagent comprises a sequence directed to SEQ ID NO: 20, and/or a primer and/or a probe for methylation detection of the nucleic acid fragment shown in the figure;

preferably, the upstream primer of the primers has any one of the nucleotide sequences shown as follows:

II. The complementary sequence of the sequence shown in I;

preferably, the downstream primer in the primers has any one of the nucleotide sequences shown as follows:

IV, complementary sequences of the sequences shown in III;

preferably, the probe has any one of the nucleotide sequences shown below:

v, having the sequence of SEQ ID NO: 3. SEQ ID NO: 7 and SEQ ID NO: 10;

VI, a sequence complementary to the sequence shown in V;

preferably, the probe is selected from the group consisting of SEQ ID NO: 3, and (b) is the sequence shown in the specification.

8. The reagent for detecting lung cancer according to claim 5, wherein the detection sample of the reagent is at least one selected from alveolar lavage fluid, tissue, pleural fluid, sputum, blood, serum, plasma, urine, prostatic fluid and feces;

preferably, the sample is selected from at least one of alveolar lavage fluid, sputum, tissue;

preferably, the sample is selected from at least one of alveolar lavage fluid or sputum.

9. A kit comprising the primer of claim 2, or the probe of claim 3, or the lung cancer detection reagent of any one of claims 4 to 7;

preferably, the kit comprises: a first vessel comprising a primer pair for amplification; a second container comprising a probe.

10. The use or the reagent or the kit for detecting lung cancer according to any one of claims 1, 5 and 9, wherein the lung cancer is selected from small cell lung cancer and non-small cell lung cancer;

preferably, the non-small cell lung cancer is selected from squamous cell carcinoma, adenocarcinoma.

11. A system for detecting lung cancer, said system comprising:

seq ID NO: 4, and,

b. a result judgment system;

preferably, the system comprises:

seq ID NO: 20, and,

d. a result judgment system;

preferably, the methylation detection means comprises a detection reagent according to any one of claims 4 to 7 or a kit according to claim 8;

preferably, the result judging means is used for judging whether the sequence is determined according to the sequence of SEQ ID NO: 4, outputting the lung cancer disease risk and/or lung cancer type;

preferably, the result judging means is used for judging whether the sequence is determined according to the sequence of SEQ ID NO: 20, outputting the risk of lung cancer and/or the type of lung cancer;

preferably, the disease risk is that the methylation results of the to-be-detected sample and the normal sample are compared according to the result, and when the methylation of the to-be-detected sample and the methylation of the normal sample have a significant difference or an extremely significant difference, the result judges that the disease risk of the to-be-detected sample is high.