CN108085411A - A kind of A rotavirus detection of nucleic acids standard substance and its preparation method and application - Google Patents

Abstract

The present invention discloses a kind of A rotavirus detection of nucleic acids standard substance and its preparation method and application.The RNA sequence of A rotavirus detection of nucleic acids standard substance of the present invention is as shown in SEQ ID No.1.Preparation method the invention further particularly discloses the A rotavirus detection of nucleic acids standard substance and the application in A rotavirus detection of nucleic acids as standard substance.A rotavirus detection of nucleic acids standard substance inanimate object infectiousness of the present invention is easily prepared, and has good uniformity and enough stability, and the standard substance has characteristic value that is accurate, can tracing to the source；It can not only be used for the positive control of A rotavirus nucleic acid qualitative detections, the external standards that can be detected again as A rotavirus nucleic acid quantification, it can also be used to evaluate new A rotavirus nucleic acid detection methods, material base is provided for A rotavirus detection of nucleic acids ability certification and accreditations, each laboratory can be widely used in.

Description

A kind of A rotavirus detection of nucleic acids standard substance and its preparation method and application

Technical field

The present invention relates to technical field of biological.More particularly, to a kind of A rotavirus detection of nucleic acids reference substance Matter and its preparation method and application.

Background technology

With the continuous improvement of living standards, food security has become the sanitarian key issue in the world, influences to eat The factor of product safety also increasingly attracts attention.In recent years, the accident of food security aspect occurs again and again, and wherein cause of disease is micro- Food origin disease caused by biology is the hemorrhagic large intestine Ai Xi Salmonellas of one of most important factor for influencing food security, such as Japan O157：H7 food poisoning, Europe propagate rabid ox disease, France occur listeria spp poisoning, Thailand outburst bird flu, ratio Occur bioxin events etc. when sharp.World commerce globalization also bring food safety risk, therefore, establish science, efficiently Food inspection means, it is ensured that food security and public health, be current social development the task of top priority.

Food-borne virus is the virus for causing mankind's illness using food as carrier.Food-borne virus be difficult to obtain always and When effectively monitor, not only constitute a serious threat to food hygiene and people's health, also food industry and national economy caused Very big influence.Rotavirus (Rotavirus, RV) is worldwide to cause acute diarrhea in children and children's severe diarrhea Most common virus.Since Dr.Bishop in 1973 has found RV, people are more and more clearer to the recognizing dangers of RV.According to Statistics, the whole world cause 52.7 ten thousand people death every year there are about 1.14 hundred million children's diarrhaes are related with RV.In China, RV diarrhea is big every year About cause 27000 less than 5 years old death of child；RV positive rates in less than the 5 years old children that nationwide internal cause diarrhea is admitted to hospital Up to 47.8%.

Fast and reliable detection ensures food-borne diarrhea, especially children's severe diarrhea caused by control rotavirus People's health promotes China's food import and export Trade Development to be of great significance.At present, the detection method of RV mainly includes Electronic Speculum Observation, cell culture, nucleic acid hybridization, enzyme linked immunological and molecular biology method etc..Nucleic acid amplification especially based on PCR Method is progressively applied in the detection of food-borne virus, shortens detection time, is the complete of food-borne virus detection method Kind, standardization and practical application bring development prospect.The detection sick to this of inspection and quarantine professional standard is also using based on PCR Fluorescent quantitative PCR (the Real-time Fluorescent Quantitative of technology Polymerase Chain Reaction, qRT-PCR), but more influence factor is still had in actual mechanical process, The residual of mortifier, band amplification target nucleus acid concentration, reverse transcription effect after random error, sample nucleic acid extraction such as experimenter's operation Rate etc. can influence amplification efficiency, cause testing result deviation.Therefore, reliable and stable, an and inanimate object infection risk Standard substance, for ensureing that RV nucleic acid amplifications detection quality is of great significance.

In the past mostly using Plasmid DNA or the positive sample containing virion, if diarrhea patient fecal specimens are as nucleic acid Positive control during augmentation detection.But Plasmid DNA can not control the process of viral RNA reverse transcription, for quantitatively dividing It is difficult the information of intuitive communicative viral level during analysis.Patient's fecal specimens have potential infectiousness, and homogeneity is poor, and it is tired to prepare transport Difficulty, and multigelation restrovirus carrying capacity can be substantially reduced.Vitro synthesized RNA inanimate object infectiousness, has good uniformity, can be to food source The reverse transcription and PCR of property viral diagnosis are monitored, and physics especially can be used in theory or chemical method is quantified, obtain To magnitude accurate and with traceability.At present, both at home and abroad still not using rotavirus RNA segment as raw material quantitative standard sample Product.

Therefore it provides a kind of external synthesis A rotavirus RNA segments have effectively played in laboratory and laboratory monitoring Quality control acts on, and has broad application prospects.

The content of the invention

First of the present invention be designed to provide it is a kind of there is excellent homogeneity, sufficiently stable property and can accurately trace to the source The A rotavirus detection of nucleic acids standard substances of the features such as characteristic value.

Second object of the present invention is to provide a kind of preparation side of above-mentioned A rotavirus detection of nucleic acids standard substance Method.

Third object of the present invention is to provide a kind of above-mentioned A rotavirus detection of nucleic acids standard substance in A groups of wheels Application in the detection of shape viral nucleic acid as standard substance.

In order to achieve the above objectives, the present invention uses following technical proposals：

The present invention provides a kind of A rotavirus detection of nucleic acids standard substances, and the RNA sequence of the standard substance is such as Shown in SEQ ID No.1.

Further, the characteristic value of the standard substance is (5.8 ± 1.5) × 10⁷Copy/μ L.

Invention further provides the preparation method of above-mentioned A rotavirus detection of nucleic acids standard substance, including following Step：

1) A rotavirus positives are screened, extract viral RNA, after reverse transcription, are amplified such as SEQ ID No.5 institutes The DNA fragmentation shown；

2) DNA fragmentation described in step 1) is connected construction recombination plasmid with plasmid vector；

3) by the recombinant plasmid transformed that step 2) obtains to competent cell, multiplication extracts recombinant plasmid；

4) recombinant plasmid obtained using restriction enzyme to step 3) extraction carries out single endonuclease digestion, obtains linearisation restructuring Plasmid；

5) to linearize recombinant plasmid as template, in-vitro transcription synthesis obtains A rotavirus detection of nucleic acids standard substances Candidate, dilution after uniformity, Detection of Stability, carry out definite value and uncertainty evaluation, you can.

The A rotavirus detection of nucleic acids standard substances inanimate object that the present invention is prepared by above method is infectious, avoids The problem of bio-safety, shows there is good uniformity and enough stability through uniformity, Detection of Stability；Through fixed Value research and uncertainty evaluation, characteristic value are (5.8 ± 1.5) × 10⁷Copy/μ L, can accurately trace to the source, and ensure to meet virus Quality Control and quantitative demand during detection of nucleic acids.

Further, the primer such as SEQ ID used in the DNA fragmentation as shown in SEQ ID No.5 are amplified in step 1) Shown in No.2 and SEQ ID No.3.

Further, the restriction enzyme is I restriction enzymes of HamH.

Further, the promoter of the in-vitro transcription is T7 promoters, and sequence is shown in SEQ ID No.6, transcription is Since first G in last three G of sequence.

The plasmid vector and competent cell do not require particularly in the present invention, as long as can meet the need of the present invention It will.In specific embodiment of the present invention, the plasmid vector is pcDNAII carriers；The competent cell is big Enterobacteria TOP10 bacterial strains.

The present invention further additionally provides above-mentioned A rotavirus detection of nucleic acids standard substance in A rotavirus nucleic acid Application in detection as standard substance.Such as can be the positive control of A rotavirus nucleic acid qualitative detections, A groups of colyliforms External perimysium reference substance that viral nucleic acid quantitatively detects etc..

The present invention also provides a kind of kits for including above-mentioned A rotavirus detection of nucleic acids standard substance.

Further, the kit further includes to detect the RT-ddPCR primer and probe groups of A rotavirus nucleic acid It closes, the RT-ddPCR primer and probes combination is comprising the primer as shown in SEQ ID No.2 and SEQ ID No.3 and such as SEQ Probe shown in ID No.4.

Wherein, the probe 5 ' holds flag F AM, 3 ' end mark BHQ.

Beneficial effects of the present invention are as follows：

A rotavirus detection of nucleic acids standard substance 1 of the present invention) inanimate object infectiousness, it easily prepares, has good equal Even property and enough stability, and the standard substance has characteristic value that is accurate, can tracing to the source；2) it can not only be used for A rotavirus The positive control of nucleic acid qualitative detection, and the external standards that can be detected as A rotavirus nucleic acid quantification, it may also be used for New A rotavirus nucleic acid detection methods are evaluated, substance base is provided for A rotavirus detection of nucleic acids ability certification and accreditations Plinth can be widely used in each laboratory.

Description of the drawings

The specific embodiment of the present invention is described in further detail below in conjunction with the accompanying drawings.

Fig. 1 shows that A rotavirus detection of nucleic acids standard substances candidate prepares scheme.

Fig. 2 shows the tem observation result of rotavirus positive sample.

Fig. 3 shows the real-time fluorescence RT-PCR testing result of fecal sample rotavirus RNA.

Fig. 4 shows pcDNAII Vector maps.

Fig. 5 shows recombinant plasmid structure diagram.

Fig. 6 shows linearisation recombinant plasmid size and purity, M：DNA Marker；1,2：The linearisation of A rotavirus Recombinant plasmid.

Fig. 7 shows the fluorescent PCR qualification result of in-vitro transcription RNA.

Fig. 8 shows in-vitro transcription RNA sizes and purity；Wherein, M：RNA Marker；1,2：A rotavirus turns in vitro The RNA of record.

Fig. 9 shows the uniformity of A rotavirus detection of nucleic acids standard substances.

Figure 10 shows the long-time stability of A rotavirus detection of nucleic acids standard substances.

Specific embodiment

In order to illustrate more clearly of the present invention, the present invention is done further with reference to preferred embodiments and drawings It is bright.Similar component is indicated with identical reference numeral in attached drawing.It will be appreciated by those skilled in the art that institute is specific below The content of description is illustrative and be not restrictive, and should not be limited the scope of the invention with this.

Embodiment 1 is used to develop the specific primer probe of A rotavirus detection of nucleic acids standard substances

The target sequence of A rotavirus Genotyping regional code binding protein VP2 is chosen, is existed by NCBI The Line tool carries out sequence analysis and comparison, is set using Prime Express softwares V4.0 (ABI, Foster City, CA, USA) It counts out more than 10 to combine primer and probe, by screening, finally obtains high specificity, is used to prepare the inspection of A rotavirus nucleic acid Survey standard substance and follow-up reverse transcription droplet type digital polymerase chain reaction (Reverse Transcript-droplet Digital Polymerase Chain Reaction, RT-ddPCR) detection method primer and probe combination it is each 1 set, sequence It is shown in Table 1.Its middle probe 5 ' end flag F AM, 3 ' end mark BHQ.Primer and probe is led to Trade Co., Ltd. by Beijing six directions and is closed Into.

1 primer probe sequence of table

The preparation of 2 A rotavirus detection of nucleic acids standard substance candidates of embodiment

The extraction viral RNA from the biological sample (being mostly fecal specimens) for be accredited as the A rotavirus positive, utilizes sieve The primer amplified selected goes out the DNA fragmentation as shown in SEQ ID No.5；Then the DNA fragmentation and plasmid vector are connected Construction recombination plasmid is connect, and by the recombinant plasmid transformed to competent escherichia coli cell, is built containing the big of recombinant plasmid Enterobacteria；By the multiplication of Escherichia coli, it can be achieved that a large amount of preparations of the recombinant plasmid of above-mentioned DNA fragmentation；Extract recombinant plasmid, Then single endonuclease digestion is carried out to recombinant plasmid using I restriction enzymes of HamH, forms in-vitro transcription template, pass through T7 promoters In-vitro transcription synthesis obtains A rotavirus detection of nucleic acids standard substance candidates.Wherein, the sequence of T7 (TAATACGACTCACTATA (GGG)) as shown in SEQ ID No.6, transcription be since first G in (GGG), because This, obtained A rotavirus detection of nucleic acids standard substance candidate sequences are as shown in SEQ ID No.1.Specific solution See Fig. 1, including two aspects of preparation procedure and Quality Control program, detailed step is as follows：

1. rotavirus positive sample is identified

Rotavirus positive excrement is obtained from BJ Children's Hospital, takes 10 μ L fecal specimens drop in the carbon-sprayed copper net of 200 mesh On, surplus liquid is abandoned with filter paper suction after 1min, 20s is dyed with 2% (w/v) acetic acid uranium, after putting air drying, in transmission electron microscope (TEM) as it can be seen that finding the common virion being dispersed in fecal specimens, virion is spherical in shape for observation under, and diameter 60nm~ 80nm, shape are in wheel shape, are typical rotaviral particles forms (Fig. 2).

2. the extraction of rotavirus RNA, reverse transcription and identification

The RNA being accredited as with TRIzol extractions in the sample of the rotavirus positive, then using Superscript^TM First-strand synthesis system for RT-PCR kits the reverse transcription reaction for extracting RNA is generated cDNA；The cDNA generated using qRT-PCR methods to reverse transcription is identified.It turns out that the RNA of positive fecal specimens extraction There is specificity fluorescent amplified signal, detection Ct values are 19.6, illustrate in the RNA extracted the A groups containing higher concentration respectively Rotavirus nucleic acid (Fig. 3).

The preparation of 3.A rotavirus recombinant plasmids

The RT-PCR amplifications of 3.1 target fragments

Using the primer shown in SEQ ID No.2 and SEQ ID No.3, expanded from the positive fecal specimens of rotavirus Go out the shown DNA fragment specific for 120bp such as SEQ ID No.5 length, the specific fragment is special for A rotavirus Property target fragment.

Contain 10 × PCR buffer solutions, 5 μ L, 4 μ L of dNTP (2.5mmol/L), sense primer and downstream in 25 μ L reaction systems Each 2 μ L of primer (10 μm of ol/L), 5 μ L of pyrobest enzymes (5U/ μ L) 0.5 μ L and cDNA template.It is pressed in ABI 9700PCR instrument The following conditions are reacted：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 45s, 53 DEG C of annealing 45s, 72 DEG C of extension 45s, 35 cycle, 72 DEG C, 8min, 4 DEG C preservations.The recycling of 3.2PCR products

PCR product is usedSV Gel and PCR Clean-Up System (promega) are recycled.PCR is taken to produce 2 μ L of object carry out 1.5% agarose gel electrophoresis, cut the Agarose plug (as small as possible) containing target fragment, are put into 1.5mL centrifugations Guan Zhong adds in film combination buffer solution by 10 μ L/10mg agarose gels, puts 50 DEG C~65 DEG C water-baths and is incubated 10min, is overturned per 2min Mixing once, until agarose blob of viscose melts completely.The glue of thawing is moved into adsorption column, places 1min, 16000g at room temperature 1min is centrifuged, the liquid in collecting pipe is discarded, adsorption column is put back in same collecting pipe.It is slow that 700 μ L washings are added in adsorption column Fliud flushing, 16000g centrifugation 1min, discards the liquid in collecting pipe, adsorption column is placed back in collecting pipe, 500 μ L washing buffers Liquid washes repeatedly once, and 16000g centrifugation 5min discard the liquid in collecting pipe, adsorption column is put back in collecting pipe, uncapped state Lower centrifugation 1min, to remove remaining ethyl alcohol.Adsorption column is put into clean 1.5mL centrifuge tubes, 50 μ L DEPC water are added to Adsorbed film center, stands 1min, and the liquid eluted (DNA) is put -20 DEG C and saved backup by room temperature 16000g centrifugation 1min. 3.3 coupled reaction

Carrier of the pcDNAII carriers for selecting to contain T7 promoters as recombinant plasmid, plasmid map are shown in Fig. 4.First will PcDNAII carriers carry out single endonuclease digestion using EcoRV, form linearized vector of the band there are two flat end, then expand RT-PCR Increase the target fragment to be inserted on pcDNAII carriers by flush end connection.Specific linked system includes 6 μ of PCR glue recovery product L, 1 μ L of buffer solution, 1 μ L of pcDNAII carriers, 1 μ L of ligase, Yi Shui are connected and supplies reaction system to 10 μ L.It is placed in 14 DEG C of connections Overnight.

RT-PCR is expanded into obtained A rotavirus target gene DNA fragmentation and is inserted into carrier EcoRV restriction enzyme sites Place, constructs the recombinant plasmid containing viral target gene, and the structure diagram of recombinant plasmid is shown in Fig. 5.

The conversion of 3.4 connection products

TOP10 competent cells are the competent cells that Escherichia coli TOP10 bacterial strains are handled through special process, can be used It is converted in the thermal shock of DNA, is a kind of bacterial strain for being usually used in plasmid cloning.- 80 DEG C of refrigerators take out the TOP10 competent cells of freezing (50 μ L/ pipes) melts on ice, and flicking tube wall makes its mixing.Draw 5 μ L connections liquid add in it is above-mentioned fill competent cell from In heart pipe；Flicking pipe outer wall makes its mixing, ice bath 30min；42 DEG C of thermal shock 40s add in 250 μ L SOC culture solutions, 37 DEG C of incubations 1h.40 μ L X-gal (20mg/mL) and 4 μ L IPTG (200mg/ are added on the LB tablets containing 50 μ g/mL Ampicillin ML), entire planar surface is spread evenly across with sterile glass spreader, after being dried up on superclean bench, takes 100 μ L bacteria suspensions It is coated on LB tablets, 37 DEG C of culture 12h are for use up to growing single bacterium colony.

The extraction of 3.5 recombinant plasmids

Aseptic inoculation ring random picking white single bacterium colony on conversion tablet, is inoculated into and contains 50 μ g/mL equipped with 3mL In the test tube of the LB culture solutions of Ampicillin, 220rpm, 37 DEG C of shaken cultivations increase bacterium overnight.Using Wizard Plus SV Minipreps DNAPurification System (promega) are extracted, and concrete operations are carried out by kit specification.Finally Recombinant plasmid dna is dissolved in 50 μ L TE, recombinant plasmid is obtained, is stored in -20 DEG C.

The sequencing identification of 3.6 recombinant plasmids

Recombinant plasmid is sent and carries out sequencing identification in Shanghai Sheng Gong biotechnologys Services Co., Ltd, according to Fig. 5 institutes The structure of the recombinant plasmid shown, target fragment are inserted at II carrier EcoRV restriction enzyme sites of pcDNA, the digestion of EcoRV Site is " GAT！ATC ", therefore should include EcoRV restriction enzyme site partial sequences in target fragment upstream and downstream；In box For the target fragment of insertion, the gene order of rotavirus in the target fragment sequencing result and GenBank is carried out same Source property is analyzed, and with the genetic homologies of A rotavirus separation strains up to 100%, illustrates that (particular sequence is recombinant plasmid ) in A rotavirus containing sequence as shown in SEQ ID No.5 target fragment.

4. the preparation of in-vitro transcription template

The linearisation of 4.1 recombinant plasmids

It usually carries out needing to linearize DNA profiling before in-vitro transcription, so as to which ensure will not be to viral target gene downstream Sequence excessively transcribed.The BamHI restriction enzymes in position and viral target gene downstream is selected to carry out recombinant plasmid single Digestion generates 5 ' prominent viscous ends, can effectively avoid the transcription to non-target gene after the digestion.

The purifying of the recombinant plasmid of 4.2 linearisations and electroresis appraisal

Efficient in-vitro transcription depends on the transcription templates of high quality, it is desirable that linearisation DNA profiling is not mixed without RNase Other miscellaneous DNA structures and other to responsive transcription, there may be the ingredients of interference.Therefore we select promega companies of the U.S. Wizard DNA Clean-Up System kits purify linearisation DNA, concentrate.The restructuring of linearisation after purification Plasmid judges its size and purity into row agarose gel electrophoresis.

The target fragment size being inserted into II-RV of recombinant plasmid pcDNA is 120bp, and II carrier sizes of pcDNA are 2971bp, therefore the size of recombinant plasmid should be 3091bp.1% agarose gel electrophoresis shows linear recombinant plasmid after purification Size and purity meet expection, linearisation is complete, there is no annular and super spirial plasmid structure, and without finding DNA degradation, In-vitro transcription template (Fig. 6) can be used as.

5. the preparation of the RNA of the target fragment of rotavirus containing A

The in-vitro transcription of 5.1RNA

With the Ribo MAXTM Large Scale RNA Production system-T7 kits of Promega companies (article No.：P1300 in-vitro transcription (being carried out by kit operational manual)) is carried out.CRNA RNeasy made from in-vitro transcription MiniElute Cleanup kit are purified (purchased from QIAGEN companies, article No. 74204), and concrete operations are said according to kit Bright progress.

The identification of 5.2 in-vitro transcription RNA

5.2.1 fluorescent PCR is identified

In-vitro transcription RNA directly carries out fluorescent PCR amplification, whether identification has remaining DNA points without process of reverse-transcription Son；Simultaneously by row fluorescent PCR detection again after RNA progress reverse transcriptions, whether identification transcription RNA contains the specific sequence of virus Row.The cRNA of in-vitro transcription directly carries out fluorescent PCR augmentation detection without reverse transcription, does not as a result occur amplified signal, explanation It transcribes and DNA is free of in cRNA.It will further be detected after RNA reverse transcriptions through fluorescent PCR, specific amplification curve as a result occur, Prove that the cRNA of transcription includes virulent specific sequence (Fig. 7).

5.2.2 ultraviolet spectrophotometry Purity

UV detector measures light absorption values of the RNA of in-vitro transcription at 260nm and 280nm, calculates A₂₆₀And A₂₈₀ Ratio.Ultraviolet spectrophotometry surveys absorbance 260/A280=2.01, shows that in-vitro transcription product RNA purity is higher.

5.2.3 in-vitro transcription RNA sequence measures

The RNA of in-vitro transcription is sent to precious bioengineering (Dalian) Co., Ltd and carries out RNA sequencing identifications.A groups of colyliform diseases Malicious nucleic acid standard substance candidate is prepared by the artificial synthesized RNA obtained by in-vitro transcription, it should contain A rotavirus mesh Segment.The structure of recombinant plasmid according to Fig. 5, since the sequence of T7 transcriptons is：TAATACGACTCACTATA (GGG), transcription is since first G in (GGG), therefore, except A groups of colyliform diseases in in-vitro transcription RNA fragment sequences Outside malicious testing goal sequence, also contain in the T7 promoters partial sequence of aim sequence upstream and target gene downstream from EcoRV enzymes Enzyme site is to the sequence of BamHI restriction enzyme sites.RNA (the i.e. A rotavirus detection of nucleic acids standard substance candidates of in-vitro transcription generation Object) sequencing result, as shown in SEQ ID No.1：(GGGCGAAUUGGGCCCUCUAGAUGCAUGCUCGAGCGGCCGCCAGUGU AGCACACUGGCGGCCGUUACUAGUG), it is the RNA segments of one section of 212bp, is examined wherein in box for A rotavirus nucleic acid Target fragment is surveyed, the gene order of A rotavirus in the target fragment sequencing result and GenBank is subjected to homology point Analysis, homology is as a result consistent with the target fragment in recombinant plasmid pcDNAII-RV sequencing results up to 100%, illustrates to prepare RNA in corresponding A rotavirus containing sequence as shown in SEQ ID No.5 target fragment.

5.2.4 the non denatured agarose gel electrophoresis identifications of 0.7%-2.0%

On the other hand the purity of one side assistant analysis RNA identifies the integrality of transcription RNA according to the size of RNA segments. There is specific band near 200bp in electrophoresis result discovery, is consistent with the RNA sequence size drawn is sequenced, and non-without other There is (Fig. 8) in specific transcriptional product.

The A rotavirus nucleic acid standard substance candidates inanimate object prepared by above scheme is infectious, avoids life The problem of object is safe, Quality Control and quantitative demand when ensureing to meet viral nucleic acid detection.

The foundation of 3 RT-ddPCR methods of embodiment

RT-ddPCR methods are mainly used for uniformity, stability in rotavirus nucleic acid examination criteria substance preparation process With definite value research.The optimum detection scope of RT-ddPCR is 20-2000 copies/μ L, using balance weight method, by RNA reference substances Matter carries out gradient dilution, with reference to One-Step RT-ddPCR Kit for Probes kit methods, to the mark of above-mentioned preparation Quasi- substance carries out RT-ddPCR detections, and used primed probe is with being shown in Table 1, and reference reagent cassette method, concrete operation method is such as Under：

1.PCR reaction systems

2 × one-step RT-ddPCR supermix, 10 μ L, 25mM manganese acetate solution 0.8 μ L, forward primer and reverse primer each 1.0-1.8 μ L, fluorescence probe (as shown in SEQ ID No.2 and SEQ ID No.3) (as shown in SEQ ID No.4) 0.5 μ L, RNA template 2.0 μ L, DEPC water polishings to 20 μ L.Primer probe sequence is shown in Table 1.

2. droplet generates

The RT-ddPCR reaction systems of 20 μ L and 65 μ L droplets generation oil are added separately in 8 hole droplet generation cards, put The generation droplet in droplet generation instrument (QX200, Bio-Rad, Pleasanton, CA).

3.PCR reacts

The droplet (40 μ L) of the Water-In-Oil of generation is slowly transferred in 96 orifice plates, aluminium foil heat-sealing film sealer is placed on commonly Amplified reaction, response parameter are carried out in PCR instrument：60℃30min；95℃5min；94 DEG C of 30s, Tm 60s, 40 Xun Huans；98℃ 10min；4℃Hold.Warming and cooling rate≤2.5 DEG C/sec.

4. result judgement

PCR after reaction, after QX100/200droplet reader detections, obtains copying for RNA in 20 μ L reaction systems Shellfish concentration value, the RNA copy concentrations in sample are：The copy of RNA in sample RNA concentration (copy/μ L)=20 μ L reaction systems Concentration (copy/μ L) × 20 μ L ÷, 2 μ L (RNA template sample-addings amount) × extension rate.

The preparation of 4 A rotavirus detection of nucleic acids standard substances of embodiment

Dilution, uniformity initial survey and the packing of 1.A rotavirus detection of nucleic acids standard substance candidates

It is using the DEPC processing water without RNase that the A rotavirus detection of nucleic acids standard substance candidates of preparation is dilute It releases to 10^-4, ultraviolet spectrophotometry survey absorbance A₂₆₀/A₂₈₀=2.07, show the A rotavirus detection of nucleic acids prepared Standard substance candidate RNA purity is higher.In order to examine in A rotavirus detection of nucleic acids standard substance candidate dilute solutions Whether the distribution of RNA molecule is uniform, by drawing 30 μ to surface layer, middle level, the different sample points of bottom three in the middle part of conical centrifuge tube L RNA solutions are detected using qRT-PCR methods, and each sampled point repeats detection 5 times, using one-way analysis of variance side The detection Ct values of the more different sampled points of method.Uniformity initial survey shows, the A rotavirus detection of nucleic acids standard substances after dilution Candidate RNA molecule is evenly distributed (table 2).A rotavirus detection of nucleic acids standard substance candidates after dilution are distributed into nothing 1.2mL of the bacterium without enzyme has the screw socket cryopreservation tube (Corning) of sealing ring, and every 0.1mL prepares 200 sample units, obtains altogether A rotavirus detection of nucleic acids standard substances.

2 A rotavirus detection of nucleic acids standard substance candidate uniformity initial survey results of table

2.A rotavirus detection of nucleic acids Certified Reference Material Homogeneity is studied

2.1 extracting unit numbers and sampling mode

16 units are extracted out of 200 sample units, for uniformity testing.Sampling mode is stratified random smapling, Specially：According to the initial of packing, mid-early stage, middle and later periods and finishing steps, 200 cell-averages are divided into 4 layers, 50 every layer Unit is encoded unit in every layer by 1-50 respectively, using the table of random numbers determine every layer extraction sample number, every layer with Machine extracts 4 units.

2.2 uniform Journal of Sex Research detection methods

Uniformity testing is carried out using RT-ddPCR methods in embodiment 1, every sample repeats detection 3 times.

2.3 uniformity testings assess statistical model

It is first first into trend test between row bottle after obtaining detection data, when trend is not notable between bottle, point Ji it not calculate uniform between bottle Property with bottle in uniformity, using one-way analysis of variance method carry out statistical analysis, calculate uniformity introduce uncertainty

2.4 uniformity testing data results judge

A rotavirus detection of nucleic acids Certified Reference Material Homogeneity results of study are shown in Fig. 9 and table 3, and table 3 lists A groups of colyliform diseases Malicious detection of nucleic acids Certified Reference Material Homogeneity analyzes data.

3 A rotavirus detection of nucleic acids Certified Reference Material Homogeneity check analyses data (× 10 of table⁷Copy/μ L)

Data can be calculated in table：

The sum of squares of deviations between group

Intra-class variance and

v₁=m-1=15

v₂=N-m=32

Standard deviation between group

Group internal standard deviation

Counting statistics amount F

According to degree of freedom (15,32) and given significance 0.05, F is checked in by F distributions tables of critical values_α= 1.9922, compared with the F values being calculated F ＜ F_α, it is believed that between group group internal standard deviation between no significant difference, andIllustrate that measured deviation is less than measured deviation between group in group, the repeatability of droplet type number RT-PCR method is more satisfactory.

Standard deviation between each group of data

Each n_iAll same, in uniform Journal of Sex Research, s_lThe deviation s that as uniformity of standard substance introduces_bb, then formula can letter It turns to：

Therefore the uncertainty u that uniformity introduces_bbFor

u_bb=s_bb=0.21 (× 10⁷Copy/μ L)

3.A rotavirus detection of nucleic acids standard substance stability studies

3.1 short-term stabilities and long-time stability research approach

Short-term stability research approach：Using 40 DEG C, room temperature (RT, 20~25 DEG C), 4 DEG C and -20 DEG C, investigate rotavirus The stability of transportational process under nucleic acid standard substance sample difference traffic condition；The research approach that long-time stability are stablized：By sample Product continuously investigate at least six moon at a temperature of being stored in -80 DEG C, and concrete scheme is shown in Table 4.

4 A rotavirus detection of nucleic acids standard substance stability study schemes of table

The selection of 3.2 stability study detection methods

Stability investigation is carried out using RT-ddPCR methods, each investigation time point randomly selects 3 standard substance samples Article unit, each sample unit repeat detection 3 times, calculate average value.

3.3 stability assessment data results judge

3.3.1 short-term stability result of study

Data are investigated to short-term stability using variance analysis method and carry out statistical check, analyze A rotavirus nucleic acid Stability of the examination criteria material sample under different preservation conditions determines most long transport time limit and traffic condition.The result shows that The standard substance is degraded rapidly in 40 DEG C of environment, only stablizes preserve 3d at room temperature, and 4 DEG C can stablize preservation 14d, and -20 DEG C can be steady Surely 28d (table 5) is preserved.

5 A rotavirus detection of nucleic acids standard substance short-term stabilities of table

*：Room temperature refers to temperature between (20-25) DEG C；^#：Compared with the measured value of the 0th day, p ＜ 0.05

3.3.2 long-time stability result of study

Long-time stability result of study is shown in Figure 10, carries out Trend analysis using linear model, observes long-time stability number According to whether having significant change trend, stability of the standard substance within the given holding time is determined, computational stability introduces not Degree of certainty.A rotavirus detection of nucleic acids standard substance stability datas are given in table 6.

6 A rotavirus detection of nucleic acids standard substances long-time stability of table investigate result

The evaluation of long-time stability is by the characteristic value in different time bioassay standard substance, in potential kinetics mechanism In the case of unknown, generally use (classics) linear model, Y=b₀+b₁X depicts the relation of characteristic magnitude and time, formula In：b₀, b₁For regression coefficient, X is the time, and Y is the characteristic value of standard substance.

Slope by 6 Detection of Stability measure data fitting linear equation of table is：

In formula：

The intercept of linear equation is：

The standard deviation of point among straight line：

The standard deviation of slope is：

It is n-2=5 in degree of freedom, under confidence level p=0.95 (95% level of signifiance), slope is examined to be compared with 0 No to have significant difference, the critical value of t-inspection is 2.571, because

|b₁| ＜ t_0.95,5×s(b₁)=2.571 × 0.027=0.069

So slope is not notable, therefore unstability is not observed.At this point, the term of validity of standard substance is 6 months, no The partial uncertainty that stability introduces is u_s=s (b₁) × X=0.027 × 6=0.16 (× 10⁷Copy/μ L)

4.A rotavirus detection of nucleic acids standard substance combines definite value scheme

A rotavirus detection of nucleic acids mark of the pattern to preparation of Duo Jia laboratory cooperation definite values is carried out using RT-ddPCR Quasi- substance carries out definite value, and with the copy concentrations containing A rotavirus target fragments RNA, i.e., contained RNA is copied in every μ L solution Shellfish number is as standard value.

4.1 joint definite value schemes：

It chooses with authoritative 9 independent laboratories for possessing progress digital pcr detection of certain technology cooperate and determine Value research provides four kinds of RM, each each 3 parts of parallel wrapping unit to every independent laboratory, while provides specificity and draw at random Object/probe (being shown in Table 1) and normalizing operation program (Standard Operating Procedure, SOP) and result report model This.Before detection is started, the RM Sample storages for being required to receive draw in -80 DEG C or liquid nitrogen in each joint definite value laboratory Object/probe is stored in -20 DEG C.

4.2SOP general introduction

10 times of gradient dilutions are carried out to A rotavirus detection of nucleic acids standard substance using balance weight method, in 18 μ L The RNA templates after 2.0 μ L dilutions are added in PCR reaction systems, then the 20 μ L PCR reaction systems containing RNA templates are transferred to micro- In drop generation card, droplet generation is stuck in QX100/200 drop generators and generates nearly 20000 droplets, it will be micro- with pipettor Drop is gone in 96 orifice plates, and reverse transcription PCR reaction is carried out on regular-PCR instrument.PCR after reaction, is analyzed using QX100/200 Instrument droplet detects whether each droplet has fluorescence signal one by one, obtains the copy concentrations value of RNA in 20 μ L reaction systems, in sample RNA copy concentrations be：The copy concentrations of RNA (are copied in standard substance sample RNA concentration (copy/μ L)=20 μ L reaction systems Shellfish/μ L) × 20 μ L ÷, 2 μ L (RNA template sample-addings amount) × extension rate.It reports testing result, and detection method used is carried out Generality describes.

The collection of 4.3 joint definite value test in laboratory data is analyzed with technology

It shares 9 independent laboratories and participates in the joint definite value research of A rotavirus detection of nucleic acids standard substance.9 experiments Press the order of 1#~9#, number consecutively in room.

After the result report for receiving 9 laboratories, the generality description of measurement result and detection method used is pressed first The following aspects carries out technology analysis：

(1) definite value laboratory is respectively combined before detection is started, if by the RM Sample storages received in -80 DEG C or liquid nitrogen In, primer/probe is stored in -20 DEG C；

(2) whether each RM samples are using balance weight method progress gradient dilution；

(3) add in RT-ddPCR reaction systems in whether be 2 μ L dilution after RM samples；

(4) whether detection data are reported as the form of copy concentrations, i.e., per the RNA copy numbers of μ L solution；

(5) it whether there is data reduction mistake.

It is analyzed by technology, in 9 laboratories, detection Data Data and other laboratories of 1#, 5# laboratory to RV RM It compares, differs an order of magnitude, therefore reject this two groups of data；7# laboratories are also relatively low to the setting examination data of RV RM.Each number 7 are shown in Table according to the testing result average value and standard deviation in qualified laboratory.

Combine definite value result in 7 Duo Jia laboratories of table

4.3.1 whether there is outlier judgement

Outlier is whether there is with each group detection data of Dixon test and judges RM.

4.3.1.1 method

By each laboratory definite value average value by arranging from small to large：x₍₁₎≤x₍₂₎≤…≤x_(n-1)≤x_(n), calculate respectivelyWithValue.f_(α,n)It is related with level of significance α and pendulous frequency n for critical value.If r₁ >f_(α,n), x₍₁₎For exceptional value, if r_n>r₁, and r_n>f_(α,n), then x_(n)For exceptional value；If r₁And r_nRespectively less than f_(α,n), then institute is retained There are data.

4.3.1.2 result

The statistical testing results are shown：r₁=0.678, r_n=0.175, it is respectively less than f_(0.01,6)=0.740, examine judgement unbounded Outer value.

4.3.2 normal distribution-test

The normality of definite value result data is examined using the coefficient of skew and coefficient of kurtosis.

4.3.2.1 method

Definite value measurement data is denoted as x by arranging from small to large₁, x₂..., x_n(x₁≤x₂≤ ... ,≤x_n), It calculates The then coefficient of skewFor detecting the asymmetry of data, coefficient of kurtosis B=m₄/(m₂)³, examined for kurtosis It tests.

4.3.2.2 result

According to confidence level p=0.99 and detection number 6, table look-up to obtain critical value A_{1 (0.01,6)}＞ 1.42, confidence level p= 0.99 and detection number 7 when B₁-B′₁Critical section for (1.25,4.23), therefore 1.31 ＜ 1.42, and 1.25 ＜, 3.525 ＜ 4.23, therefore the equal Normal Distribution of setting examination data of A rotavirus detection of nucleic acids standard substances.

4.3.3 data equally accurate judges

Using Cork discuss method examine between each laboratory average value whether equally accurate

4.3.3.1 method

WhereinFor the maximum in m laboratory measurements standard deviation,It is real for m family Test the standard deviation of the measured value in i-th laboratory in room.

4.3.3.2 result

The C values of A rotavirus detection of nucleic acids standard substances are for 0.4558 according to level of significance α=0.01, laboratory Group number m=6, most laboratory duplicate measurements frequency n=9 obtain critical value C (0.01,6,9)=0.3682；It can be seen that the reference substance The C values of matter definite value result are less than critical value C, and the average value for illustrating the definite value result in each laboratory is unequal accuracy, it is necessary to adopt Value data is handled with unequal accuracy method of weighting.

The standard value of 4.4A rotavirus detection of nucleic acids standard substances determines

Due to the average value unequal accuracy of each laboratory definite value result, each data are at other in MSD maximum standard deviation group Within the scope of each group of data, therefore the data of MSD maximum standard deviation group are not rejected, handled using unequal accuracy method of weighting.

4.4.1 method

The uncertainty calculation of each laboratory value data of weight, weighting overall average is standard value, i.e.,WhereinFor the weighting overall average of Duo Jia laboratories definite value result,For i-th laboratory The average value of definite value result, W_iFor the weight of i-th laboratory definite value result average value,Wherein n_i For each laboratory value data number, u_iFor the uncertainty of each laboratory definite value result, the stardard uncertairty of overall average is weighted Degree is the A class components of standard uncertainty, i.e.,

4.4.2 result

A rotavirus detection of nucleic acids standard substances value data weighting processing procedure is shown in Table 8.

8 A rotavirus nucleic acid measurement standard substances value data of table weighting processing computational chart (unit：×10⁷Copy/ μL)

Each laboratory weight is respectively：w_2#∝14.42；w_3#∝2.63；w_4#∝3.28；w_6#∝204.08；w_8#∝ 36.00；w_9#∝73.47

The standard value of rotavirus nucleic acid standard substance, that is, weight overall average:

The standard uncertainty of weighting overall average is the A class components of standard uncertainty：

5 A rotavirus detection of nucleic acids standard substance uncertainty evaluation of embodiment and its characteristic value determine

A rotavirus detection of nucleic acids standard substance uncertainties source includes three aspects：Inhomogeneities introduces not Degree of certainty (u_bb), unstability introduce uncertainty (u_s) and definite value introduce uncertainty (u_char).Standard substance is determined Value result should there are two the meanings of aspect：(1) it is tested the standard value y of the best estimate, i.e. standard substance of characteristic magnitude； (2) the uncertainty U of standard value_CRM.Therefore the definite value result of the standard substance is represented by y ± U_CRM。

1. appraisal procedure：

Expanded uncertainty U_CRMIt is after partial uncertainty combined standard uncertainty, according to fiducial probability, selects Corresponding spreading factor is selected, using formula U_CRM=k × u_CRMIt calculates.u_CRMFor combined standard uncertainty,u_charIt is the not true of standard substance definite value process introducing Fixed degree, by A class components u_AWith B class components u_BTwo parts form, u_bbFor the uncertainty that the uniformity of standard substance introduces, u_sFor The uncertainty that the stability of standard substance introduces.Normal distribution formula, Coverage factor k can divide position according to confidence level from t It is checked in number.

2. uncertainty evaluation result

Each partial uncertainty is shown in Table 9.

The uncertainty that 2.1 uniformities introduce

See that 2.4 uniformity testing data results are sentenced in the preparation of embodiment 4A rotavirus detection of nucleic acids standard substances It is disconnected.The uncertainty u that uniformity introduces_bbFor：

u_bb=s_bb=0.21 (× 10⁷Copy/μ L)

Relative uncertainty degree is：

2.2 the uncertainty that stability introduces

See 3.3.2 long-time stability results of study in the preparation of embodiment 4A rotavirus detection of nucleic acids standard substances. Stability introduce partial uncertainty be：

u_s=s (b₁) × X=0.0125 × 6=0.16 (× 10⁷Copy/μ L)

Relative uncertainty degree is：

The uncertainty that 2.3 definite values introduce

Uncertainty (the u of definite value_char) mainly by the A class uncertainties (u of Duo Jia laboratories joint definite value result_A) and it is fixed The B class uncertainties (u of value method_B) composition.Due to combining deterministic models using more independent laboratories, in measurement process B classes component is embodied at random in definite value result, therefore no longer carries out B class uncertainty evaluations.Definite value introduce uncertainty be：

2.4 expanded uncertainty

Each partial uncertainty is synthesized, obtains combined standard uncertainty, takes spreading factor k=2, is calculated each RM's Expanded uncertainty.Expanded uncertainty generally gives up to two effective digitals, and the digit of standard value y will be with uncertainty Digit is alignd after decimal point, position after the decimal point for the standard value reservation for thus making A rotavirus detection of nucleic acids standard substances Number.

9 A rotavirus detection of nucleic acids standard substances uncertainty (× 10 of table⁷Copy/μ L)

The characteristic value of 2.5A rotavirus detection of nucleic acids standard substances

According to standard value and its uncertainty, the characteristic value for determining A rotavirus detection of nucleic acids standard substances is：5.8 ±1.5(×10⁷Copy/μ L).

Obviously, the above embodiment of the present invention is only intended to clearly illustrate example of the present invention, and is not pair The restriction of embodiments of the present invention for those of ordinary skill in the art, may be used also on the basis of the above description To make other variations or changes in different ways, all embodiments can not be exhaustive here, it is every to belong to this hair The obvious changes or variations that bright technical solution is extended out is still in the row of protection scope of the present invention.

Sequence table

<110>Inspection and Quarantine Technology Center, Beijing Entry-Exit Inspection and Q

<120>A kind of A rotavirus detection of nucleic acids standard substance and its preparation method and application

<130> JLC17I0605E

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 212

<212> RNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

gggcgaauug ggcccucuag augcaugcuc gagcggccgc cagugugaug gauucgcuag 60

uugcaugcga auuggcuaua auaaauacua uaguuuaccc agcauuugga augcaaagaa 120

ugcauuacag aaauggcgau ccucagacuc cauuucaaau agcagagcaa caaaucugca 180

gaauuccagc acacuggcgg ccguuacuag ug 212

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

tcgctagttg catgcgaatt 20

<210> 3

<211> 24

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

ttgttgctct gctatttgaa atgg 24

<210> 4

<211> 30

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

aatgcattac agaaatggcg atcctcagac 30

<210> 5

<211> 120

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

tcgctagttg catgcgaatt ggctataata aatactatag tttacccagc atttggaatg 60

caaagaatgc attacagaaa tggcgatcct cagactccat ttcaaatagc agagcaacaa 120

<210> 6

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

taatacgact cactataggg 20

Claims (9)

1. A kind of 1. A rotavirus detection of nucleic acids standard substance, which is characterized in that the RNA sequence of the standard substance such as SEQ Shown in ID No.1.
2. 2. A rotavirus detection of nucleic acids standard substance according to claim 1, which is characterized in that the standard substance Characteristic value be (5.8 ± 1.5) × 10⁷Copy/μ L.
3. 3. a kind of preparation method of A rotavirus detection of nucleic acids standard substance as claimed in claim 1 or 2, feature exist In comprising the following steps：

   1) A rotavirus positives are screened, extract viral RNA, after reverse transcription, are amplified as shown in SEQ ID No.5 DNA fragmentation；

   2) DNA fragmentation described in step 1) is connected construction recombination plasmid with plasmid vector；

   3) by the recombinant plasmid transformed that step 2) obtains to competent cell, multiplication extracts recombinant plasmid；

   4) recombinant plasmid obtained using restriction enzyme to step 3) extraction carries out single endonuclease digestion, obtains linearisation restructuring matter Grain；

   5) to linearize recombinant plasmid as template, in-vitro transcription synthesis obtains A rotavirus detection of nucleic acids standard substance candidates Object, dilution after uniformity, Detection of Stability, carry out definite value and uncertainty evaluation, you can.
4. 4. preparation method according to claim 3, which is characterized in that amplified in step 1) as shown in SEQ ID No.5 DNA fragmentation used in primer as shown in SEQ ID No.2 and SEQ ID No.3.
5. 5. preparation method according to claim 3, which is characterized in that the restriction enzyme is restricted interior for HamH I Enzyme cutting.
6. 6. preparation method according to claim 3, which is characterized in that the promoter of the in-vitro transcription is T7 promoters, Its sequence is shown in SEQ ID No.6, transcription is since first G in last three G of sequence.
7. 7. a kind of A rotavirus detection of nucleic acids standard substance as claimed in claim 1 or 2 is examined in A rotavirus nucleic acid Application in survey as standard substance.
8. 8. a kind of kit of the A rotavirus detection of nucleic acids standard substances comprising described in claim 1 or 2.
9. 9. kit according to claim 8, which is characterized in that the kit further includes to detect A groups of colyliform diseases The RT-ddPCR primer and probes combination of malicious nucleic acid, RT-ddPCR primer and probes combination include such as SEQ ID No.2 and Primer shown in SEQ ID No.3 and the probe as shown in SEQ ID No.4；Preferably, the end of probe 5 ' the flag F AM, 3 ' End mark BHQ.