CN107988425A - A kind of I type norovirus detection of nucleic acids standard substances of G and its preparation method and application - Google Patents
A kind of I type norovirus detection of nucleic acids standard substances of G and its preparation method and application Download PDFInfo
- Publication number
- CN107988425A CN107988425A CN201711080288.8A CN201711080288A CN107988425A CN 107988425 A CN107988425 A CN 107988425A CN 201711080288 A CN201711080288 A CN 201711080288A CN 107988425 A CN107988425 A CN 107988425A
- Authority
- CN
- China
- Prior art keywords
- nucleic acids
- detection
- type norovirus
- seq
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a kind of I type norovirus detection of nucleic acids standard substances of G and its preparation method and application, and I type norovirus detection of nucleic acids standard substance RNA sequences of G of the present invention are as shown in SEQ ID No.1.Preparation method the invention further particularly discloses the I type norovirus detection of nucleic acids standard substances of G and the application in I type norovirus detection of nucleic acids of G as standard substance.I type norovirus detection of nucleic acids standard substance inanimate object infectiousness of G of the present invention, easily prepares, and has good uniformity and enough stability, and the standard substance has characteristic value that is accurate, can tracing to the source；It can not only be used for the positive control of I type norovirus nucleic acid qualitative detections of G, the external standards that can be detected again as I type norovirus nucleic acid quantifications of G, it can also be used to evaluate new I type norovirus nucleic acid detection methods of G, material base is provided for I type norovirus detection of nucleic acids ability certification and accreditations of G, each laboratory can be widely used in.
Description
Technical field
The present invention relates to technical field of biological.More particularly, to a kind of I type norovirus detection of nucleic acids standards of G
Material and its preparation method and application.
Background technology
Food-borne virus is the virus for causing mankind's illness using food as carrier, includes the virus of excrement-mouth approach propagation,
And the virus using livestock products as carrier diffusion.Food-borne virus is difficult to timely and effectively be monitored always, not only to food
Health and people's health constitute a serious threat, and very big influence is also caused to food industry and national economy.According to U.S.'s disease
The data information of control centre (CDC) shows that virus has become the Important cause of disease of food origin disease.Common food-borne virus bag
Include：Rotavirus (Rotavirus, RV), norovirus (Norovirus, NoV), people's astrovirus (Human
Astrovirus, HAstV) etc..In past more than 10 year, having studied confirms that NoV is to cause acute to break out non-bacterial stomach and intestine
Scorching primary original of causing a disease, has important public health meaning, the borne Parasitic Encephalopathy of U.S. CDC study on monitoring estimation 30%~50%
Gastroenteritis is broken out related with Nov.
Mainly include ISO/TS 15216 on food-borne virus examination criteria in food both at home and abroad:2013、SN/T
4055-2014, SN/T 3841-2014, SN/T 1635-2005, SN/T2520-2010, SN/T2519-2010 and SN/T
2518-2010, the method that predominantly detects are common reverse transcription PCR method (Reverse transcription polymerase
Chain reaction, RT-PCR), one-step method real-time fluorescent quantifying PCR method (Realtime quantitative
Reverse transcription polymerase chain reaction, RT-qPCR) and reverse transcription-loop-mediated isothermal
Nucleic acid amplification method (Realtime reverse transcription lood-mediated isothermal
amplification,RT-LAMP).Although the sensitivity of PCR detection techniques and accuracy are continuously improved, practical operation
More influence factor is still had in journey, such as the remaining of PCR mortifiers after nucleic acid extraction and reverse transcriptase inhibitor, nucleic acid to be amplified
Concentration, the random error etc. of experimenter's operation can cause testing result deviation.Therefore, use based on round pcr
Method when carrying out food-borne virus detection, it is necessary to using uniform and stable, it is therefore desirable to there is accurate, the positive matter for the value that can trace to the source
Control product, carry out reverse transcription and PCR detection process the reliability that quality control just can guarantee that testing result, realize laboratory result
Comparativity.
One preferable food-borne virus examination criteria sample should possess following characteristics：For the RNA of specific virus gene
Fragment, can monitor two links of viral nucleic acid augmentation detection reverse transcription and PCR, and uniform and stable, value is accurate, and definite value is to absolutely
To copy number, value has clear and definite traceability, has the operational version of specification to ensure that the accurate of value is transmitted.At present, virus PCR
Accepted standard sample mainly has following three kinds of forms in detection：Recombinant plasmid, virion sample, vitro synthesized RNA fragment.
Although recombinant plasmid has that structure is simple, inanimate object infectiousness, the features such as being readily transported, but it is DNA, therefore can not be to viral RNA
Process of reverse-transcription be controlled；Virion sample has potential infectiousness, and lack of homogeneity, prepares transport difficult, and instead
Multiple freeze thawing restrovirus carrying capacity can be reduced substantially.Vitro synthesized RNA fragment can monitor viral nucleic acid detection without biological infectiousness
Reverse transcription and PCR processes, uniformity is good, as long as through necessarily handling it is ensured that it can be used with enough stability
Either physically or chemically it is quantified, obtains the typical magnitude that can clearly trace to the source.
ISO/TS 15216:Clearly proposed in 2013 using real-time fluorescence RT-PCR detection hepatitis A virus and norovirus
When, it is necessary to use exterior Quality Control RNA (external control RNA, EC RNA).EC RNA are often to contain target gene
The recombinant plasmid of fragment is template, is prepared by way of in-vitro transcription.Hazari etc., 2004；Kim etc., 2002；
Fronhoffs etc., 2002 (Hazari S, Acharya SK, Panda SK.Development and evaluation of a
quantitative competitive reverse transcription polymerase chain reaction(RT-
PCR)for hepatitis C virus RNA in serum using transcribed thio-RNA as internal
control[J].J Virol Methods,2004,116(1):45-54.；Kim K,Park J,Chung Y,et al.Use
of internal standard RNA molecules for the RT-PCR amplification of the
faeces-borne RNA viruses[J].J Virol Methods,2002,104(2):107-15.；Fronhoffs S,
Totzke G,Stier S,et al.A method for the rapid construction of cRNA standard
curves in quantitative real-time reverse transcription polymerase chain
reaction[J].Mol Cell Probes,2002,16(2):In correlative study 99-110.), vitro synthesized RNA is used as
The positive control of corresponding food-borne virus PCR detections, result of study show that vitro synthesized RNA can in virus PCR detection
Effectively play in laboratory and acted on laboratory monitoring quality control, had broad application prospects.
At present, the standard sample of existing norovirus detection, but there is no typical magnitude, it is impossible to it is mono- to be traceable to international IS
Position, not clear and definite clearly traceability；On the other hand, these standard samples do not carry out area to the gene type of norovirus
Point, therefore in practical applications, it is only used for the qualitative detection of norovirus, it is impossible to differentiate gene type, it is impossible to from a variety of
I type norovirus of G is identified in the mixing sample of norovirus.
Therefore it provides a kind of external synthesis I type norovirus RNA fragments of G have effectively played in laboratory and laboratory
Between quality control action, for tissue food-borne virus detectability verification lay the foundation, to be pushed further into food-borne virus inspection
The standardization and standardization of survey have great importance.
The content of the invention
First purpose of the present invention be to provide it is a kind of there is excellent homogeneity, sufficiently stable property and can accurately trace to the source
The I type norovirus detection of nucleic acids standard substances of G of the features such as characteristic value.
Second object of the present invention is to provide a kind of preparation of I type norovirus detection of nucleic acids standard substances of above-mentioned G
Method.
Third object of the present invention is to provide a kind of I type norovirus detection of nucleic acids standard substances of above-mentioned G in I types of G
Application in norovirus detection of nucleic acids as standard substance.
To reach above-mentioned purpose, the present invention uses following technical proposals：
The present invention provides a kind of I type norovirus detection of nucleic acids standard substances of G, the RNA sequence of the standard substance is such as
Shown in SEQ ID No.1.
Further, the characteristic value of the standard substance is (5.4 ± 1.2) × 107Copy/μ L.
Invention further provides the preparation method of above-mentioned I type norovirus detection of nucleic acids standard substances of G, including it is following
Step：
1) I type norovirus positives of G are screened, extract viral RNA, after reverse transcription, are amplified such as SEQ ID No.5 institutes
The DNA fragmentation shown；
2) DNA fragmentation described in step 1) is connected construction recombination plasmid with plasmid vector；
3) by the recombinant plasmid transformed that step 2) obtains to competent cell, propagation, extracts recombinant plasmid；
4) recombinant plasmid obtained using restriction enzyme to step 3) extraction carries out single endonuclease digestion, obtains linearisation restructuring
Plasmid；
5) to linearize recombinant plasmid as template, in-vitro transcription synthesis obtains I type norovirus detection of nucleic acids standard substances of G
Candidate, dilution, after uniformity, Detection of Stability, carries out definite value and uncertainty evaluation, you can
The I type norovirus detection of nucleic acids standard substance inanimate objects of G that the present invention is prepared by above method are infectious, avoid
The problem of bio-safety, show that there is good uniformity and enough stability through uniformity, Detection of Stability；Through fixed
Value research and uncertainty evaluation, its characteristic value are (5.4 ± 1.2) × 107Copy/μ L, can accurately trace to the source, and ensure to meet virus
Quality Control and quantitative demand during detection of nucleic acids.
Further, the primer such as SEQ ID used in the DNA fragmentation as shown in SEQ ID No.5 are amplified in step 1)
Shown in No.2 and SEQ ID No.3.
Further, the restriction enzyme is I restriction enzymes of HamH.
Further, the promoter of the in-vitro transcription is T7 promoters, its sequence is shown in SEQ ID No.6, transcription is
Since first G in last three G of sequence.
The plasmid vector and competent cell do not require particularly in the present invention, as long as can meet the need of the present invention
Will.In specific embodiment of the present invention, the plasmid vector is pcDNAII carriers；The competent cell is big
Enterobacteria TOP10 bacterial strains.
The present invention further additionally provides above-mentioned I type norovirus detection of nucleic acids standard substances of G in I type norovirus cores of G
Application in acid detection as standard substance.Such as can be the positive control of I type norovirus nucleic acid qualitative detections of G, I types of G
External perimysium reference material of norovirus nucleic acid quantification detection etc..
Present invention also offers a kind of kit for including above-mentioned I type norovirus detection of nucleic acids standard substances of G.
Further, the kit further includes the RT-ddPCR primer and probe groups for detecting I type norovirus nucleic acid of G
Close, the RT-ddPCR primer and probes combination is comprising the primer as shown in SEQ ID No.2 and SEQ ID No.3 and such as SEQ
Probe shown in ID No.4.
Wherein, the probe 5 ' holds flag F AM, 3 ' end mark BHQ.
Beneficial effects of the present invention are as follows：
I type norovirus detection of nucleic acids standard substances 1 of G of the present invention) inanimate object infectiousness, easily prepare, have well
Uniformity and enough stability, and the standard substance has characteristic value that is accurate, can tracing to the source；2) I type promises of G such as disease be can not only be used for
The positive control of malicious nucleic acid qualitative detection, and the external standards that can be detected as I type norovirus nucleic acid quantifications of G, may be used also
For evaluating new I type norovirus nucleic acid detection methods of G, thing is provided for I type norovirus detection of nucleic acids ability certification and accreditations of G
Matter basis, can be widely used in each laboratory.
Brief description of the drawings
The embodiment of the present invention is described in further detail below in conjunction with the accompanying drawings.
Fig. 1 shows that I type norovirus detection of nucleic acids standard substance candidates of G prepare scheme.
Fig. 2 shows the tem observation result of norovirus positive sample.
Fig. 3 shows the real-time fluorescence RT-PCR testing result of fecal sample norovirus RNA.
Fig. 4 shows pcDNAII Vector maps.
Fig. 5 shows recombinant plasmid structure diagram.
Fig. 6 shows recombinant plasmid regular-PCR qualification result.
Fig. 7 shows linearisation recombinant plasmid size and purity；M：DNA Marker；1,2：The linearisation restructuring of I norovirus of G
Plasmid.
Fig. 8 shows the fluorescent PCR qualification result of in-vitro transcription RNA.
Fig. 9 shows in-vitro transcription RNA sizes and purity；Wherein, M：RNA Marker；1,2：I norovirus in-vitro transcriptions of G
RNA。
Figure 10 shows the uniformity of I type norovirus detection of nucleic acids standard substances of G.
Figure 11 shows the long-time stability of I type norovirus detection of nucleic acids standard substances of G.
Embodiment
In order to illustrate more clearly of the present invention, the present invention is done further with reference to preferred embodiments and drawings
It is bright.Similar component is indicated with identical reference numeral in attached drawing.It will be appreciated by those skilled in the art that institute is specific below
The content of description is illustrative and be not restrictive, and should not be limited the scope of the invention with this.
Embodiment 1 is used for the specific primer probe for developing I type norovirus detection of nucleic acids standard substances of G
I type norovirus Genotyping region VP1 coded sequences of G are chosen, sequence analysis is carried out by NCBI online tools
And comparison, more than 10 are designed to primer and spy using Prime Express softwares V4.0 (ABI, Foster City, CA, USA)
Pin combines, and by screening, finally obtains high specificity, is used to prepare I type norovirus detection of nucleic acids standard substances of G and follow-up inverse
Transcribe droplet type digital polymerase chain reaction (Reverse Transcript-droplet digital Polymerase
Chain Reaction, RT-ddPCR) detection method primer and probe combination it is each 1 set, sequence is shown in Table 1.Its middle probe 5 ' is held
Flag F AM, 3 ' end marks
Remember BHQ.Primer and probe leads to Trade Co., Ltd.'s synthesis by Beijing six directions.
1 primer probe sequence of table
The preparation of 2 G of embodiment, I type norovirus detection of nucleic acids standard substance candidates
The extraction viral RNA from the biological sample (being mostly fecal specimens) for be accredited as the I type norovirus positives of G, utilizes
The primer amplified filtered out goes out the DNA fragmentation as shown in SEQ ID No.5；Then by the DNA fragmentation and plasmid vector
Construction recombination plasmid is connected, and by the recombinant plasmid transformed to competent escherichia coli cell, is built containing recombinant plasmid
Escherichia coli；By the propagation of Escherichia coli, it can be achieved that prepared by a large amount of of recombinant plasmid of above-mentioned DNA fragmentation；Extraction restructuring matter
Grain, then carries out single endonuclease digestion to recombinant plasmid using I restriction enzymes of HamH, forms in-vitro transcription template, started by T7
Sub- in-vitro transcription synthesis obtains I type norovirus detection of nucleic acids standard substance candidates of G.Wherein, the sequence of T7
(TAATACGACTCACTATA (GGG)) as shown in SEQ ID No.6, transcription be since first G in (GGG), because
This, obtained I type norovirus detection of nucleic acids standard substance candidate sequences of G are as shown in SEQ ID No.1.Specific solution
In terms of seeing Fig. 1, including preparation procedure and Quality Control program two, detailed step is as follows：
1. norovirus positive sample is identified
Norovirus positive excrement is obtained from BJ Children's Hospital, takes 10 μ L fecal specimens drop in the carbon-sprayed copper net of 200 mesh
On, inhaled after 1min with filter paper and abandon surplus liquid, 20s is dyed with 2% (w/v) acetic acid uranium, after putting air drying, in transmission electron microscope
(TEM) as it can be seen that there is the small round shape structural viral particle being dispersed on a small quantity in fecal specimens, diameter is about 30nm or so for observation under, symbol
Close the morphological feature (Fig. 2) of norovirus.
2. the extraction of norovirus RNA, reverse transcription and identification
The RNA being accredited as with TRIzol extractions in the sample of the norovirus positive, then using SuperscriptTM
First-strand synthesis system for RT-PCR kits the reverse transcription reaction for extracting RNA is generated
cDNA；The cDNA produced using qRT-PCR methods to reverse transcription is identified.It turns out that the RNA of positive fecal specimens extraction
There is specificity fluorescent amplified signal, it is 15.0 that it, which detects Ct values, illustrates in the RNA that extracts I types of G containing higher concentration respectively
Norovirus nucleic acid (Fig. 3).
The preparation of I type norovirus virus recombinant plasmids of 3.G
The RT-PCR amplifications of 3.1 purpose fragments
Using the primer shown in SEQ ID No.2 and SEQ ID No.3, from the positive fecal specimens of I type norovirus of G
The shown DNA fragment specific for 74bp such as SEQ ID No.5 length is amplified, which is I type norovirus of G
Specific purpose fragment.
Contain 10 × PCR buffer solutions, 5 μ L, 4 μ L of dNTP (2.5mmol/L), sense primer and downstream in 25 μ L reaction systems
Each 2 μ L of primer (10 μm of ol/L), 5 μ L of pyrobest enzymes (5U/ μ L) 0.5 μ L and cDNA template.Pressed in ABI 9700PCR instrument
The following conditions are reacted：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 45s, 53 DEG C of annealing 45s, 72 DEG C of extension 45s, 35 circulate,
72 DEG C, 8min, 4 DEG C preservations.
The recycling of 3.2 PCR products
PCR product is usedSV Gel and PCR Clean-Up System (promega) are recycled.Take PCR
2 μ L of product carry out 1.5% agarose gel electrophoresis, cut the Agarose plug (as small as possible) containing purpose fragment, be put into 1.5mL from
In heart pipe, film combination buffer solution is added by 10 μ L/10mg agarose gels, 50 DEG C~65 DEG C water-baths is put and is incubated 10min, is run per 2min
Mix once, until agarose blob of viscose melts completely.The glue of thawing is moved into adsorption column, places 1min at room temperature,
16000g centrifuges 1min, discards the liquid in collecting pipe, adsorption column is put back in same collecting pipe.700 μ L are added in adsorption column
Lavation buffer solution, 16000g centrifugation 1min, discards the liquid in collecting pipe, adsorption column is placed back in collecting pipe, 500 μ L are washed
Wash buffer solution repeated washing once, 16000g centrifugation 5min, discard the liquid in collecting pipe, adsorption column is put back in collecting pipe, is opened
1min is centrifuged under lid state, to remove remaining ethanol.Adsorption column is put into clean 1.5mL centrifuge tubes, 50 μ L DEPC water
Adsorbed film center is added to, stands 1min, room temperature 16000g centrifugation 1min, -20 DEG C of preservations are put by the liquid eluted (DNA)
It is spare.3.3 coupled reaction
Selection contains carrier of the pcDNAII carriers of T7 promoters as recombinant plasmid, and plasmid map is shown in Fig. 4.First will
PcDNAII carriers carry out single endonuclease digestion using EcoRV, form the linearized vector with two flat ends, then expand RT-PCR
Increase the purpose fragment to be inserted on pcDNAII carriers by flush end connection.Specific linked system includes 6 μ of PCR glue reclaims product
L, 1 μ L of buffer solution, 1 μ L of pcDNAII carriers, 1 μ L of ligase, Yi Shui are connected and supplies reaction system to 10 μ L.It is placed in 14 DEG C of connections
Overnight.
RT-PCR is expanded into obtained I type norovirus target gene DNA fragmentations of G and is inserted into carrier EcoRV restriction enzyme sites
Place, constructs the recombinant plasmid containing viral target gene, and the structure diagram of recombinant plasmid is shown in Fig. 5.
The conversion of 3.4 connection products
TOP10 competent cells are the competent cells that Escherichia coli TOP10 bacterial strains are handled through special process, can be used
Converted in the thermal shock of DNA, be a kind of bacterial strain for being usually used in plasmid cloning.- 80 DEG C of refrigerators take out the TOP10 competent cells of freezing
(50 μ L/ pipes) melts on ice, and flicking tube wall makes its mixing.Draw 5 μ L connections liquid add it is above-mentioned fill competent cell from
In heart pipe；Flicking pipe outer wall makes its mixing, ice bath 30min；42 DEG C of thermal shock 40s, add 250 μ L SOC nutrient solutions, 37 DEG C of incubations
1h.40 μ L X-gal (20mg/mL) and 4 μ L IPTG (200mg/ are added on the LB tablets containing 50 μ g/mL Ampicillin
ML), whole planar surface is spread evenly across with sterile glass spreader, after being dried up on superclean bench, takes 100 μ L bacteria suspensions
It is coated on LB tablets, 37 DEG C of culture 12h are stand-by up to growing single bacterium colony.
The extraction of 3.5 recombinant plasmids
Aseptic inoculation ring random picking white single bacterium colony on conversion tablet, is inoculated into and contains 50 μ g/mL equipped with 3mL
In the test tube of the LB nutrient solutions of Ampicillin, 220rpm, 37 DEG C of shaken cultivations increase bacterium overnight.Using Wizard Plus SV
Minipreps DNA Purification System (promega) are extracted, and concrete operations are carried out by kit specification.Most
Recombinant plasmid dna is dissolved in 50 μ L TE afterwards, recombinant plasmid pcDNAII-G I is obtained, is stored in -20 DEG C.
The identification of 3.6 recombinant plasmids
3.6.1 PCR is identified
The recombinant plasmid extracted using the primer pair shown in SEQ ID No.2 and SEQ ID No.3 carries out PCR amplification, electricity
Swimming identification amplified production.Electrophoresis result shows that recombinant plasmid pcDNAII-G I specificity occur at 74bp after PCR amplification and expand
Increase band (see Fig. 6), prompt to contain the target gene fragment of virus in recombinant plasmid, further verified by sequencing.
3.6.2 sequencing identification
The recombinant plasmid that the PCR that learns from else's experience is accredited as the positive send and carries out sequencing mirror in Shanghai Sheng Gong biotechnologys Services Co., Ltd
Fixed, the structure of the recombinant plasmid according to Fig. 5, purpose fragment is inserted at II carrier EcoRV restriction enzyme sites of pcDNA, EcoRV
Restriction enzyme site be " GAT！ATC ", therefore should include EcoRV restriction enzyme site partial sequences in purpose fragment upstream and downstream；Square frame
In for insertion purpose fragment, the gene order of norovirus in the purpose fragment sequencing result and GenBank is carried out
Homology analysis, the genetic homology with I type norovirus separation strains of G illustrate recombinant plasmid (tool up to 100%
Body sequence is CGAGCGGCCGCCAGTGTGATGGAT
ATCTGCAGAAT the purpose fragment of the I type norovirus of G in) containing sequence as shown in SEQ ID No.5.
4. the preparation of in-vitro transcription template
The linearisation of 4.1 recombinant plasmids
Usually carry out needing to linearize DNA profiling before in-vitro transcription, so that ensure will not be to viral target gene downstream
Sequence excessively transcribed.The BamHI restriction enzymes in position and viral target gene downstream are selected to carry out recombinant plasmid single
Digestion, produces 5 ' prominent viscous ends, can effectively avoid the transcription to non-target gene after the digestion.
The purifying of the recombinant plasmid of 4.2 linearisations and electroresis appraisal
Efficient in-vitro transcription depends on the transcription templates of high quality, it is desirable to linearizes DNA profiling and is free of RNase, does not mix
Other miscellaneous DNA structures and other components to responsive transcription there may be interference.Therefore we select promega companies of the U.S.
Wizard DNA Clean-Up System kits purify linearisation DNA, concentrate.The restructuring of linearisation after purification
Plasmid judges its size and purity into row agarose gel electrophoresis.
The purpose fragment size being inserted into II-G I of recombinant plasmid pcDNA is 74bp, and II carrier sizes of pcDNA are 2971bp,
Therefore the size of recombinant plasmid should be 3045bp.1% agarose gel electrophoresis shows the size of linear recombinant plasmid after purification
Meet expection with purity, linearisation is complete, can conduct there is no ring-type and super spirial plasmid structure, and without DNA degradation is found
In-vitro transcription template (Fig. 7).
5. the preparation of the RNA of the I type norovirus purpose fragment containing G
The in-vitro transcription of 5.1 RNA
With the Ribo MAXTM Large Scale RNA Production system-T7 kits of Promega companies
(article No.：P1300 in-vitro transcription (being carried out by kit operational manual)) is carried out.CRNA RNeasy made from in-vitro transcription
MiniElute Cleanup kit (being purchased from QIAGEN companies, article No. 74204) are purified, and concrete operations are said according to kit
Bright progress.
The identification of 5.2 in-vitro transcription RNA
5.2.1 fluorescent PCR is identified
In-vitro transcription RNA directly carries out fluorescent PCR amplification, whether identification has remaining DNA points without process of reverse-transcription
Son；Whether row fluorescent PCR detection again after RNA progress reverse transcriptions, identification transcription RNA are contained into the specific sequence of virus at the same time
Row.The cRNA of in-vitro transcription directly carries out fluorescent PCR augmentation detection without reverse transcription, does not as a result occur amplified signal, explanation
DNA is free of in transcription cRNA.It will further be detected after RNA reverse transcriptions through fluorescent PCR, specific amplification curve as a result occur,
Prove that the cRNA of transcription includes virulent specific sequence (Fig. 8).
5.2.2 ultraviolet spectrophotometry Purity
Light absorption values of the RNA of UV detector measure in-vitro transcription at 260nm and 280nm, calculates A260And A280
Ratio.Ultraviolet spectrophotometry surveys absorbance 260/A280=1.96, shows that in-vitro transcription product RNA purity is higher.
5.2.3 RNA sequence measures
The RNA of in-vitro transcription is sent to precious bioengineering (Dalian) Co., Ltd and carries out RNA sequencing identifications.Norovirus core
Sour standard substance candidate is prepared by the artificial synthesized RNA obtained by in-vitro transcription, it should contains I type norovirus purposes of G
Fragment.The structure of recombinant plasmid according to Fig. 5, since the sequence of T7 transcriptons is：TAATACGACTCACTATA (GGG),
Transcription is since first G in (GGG), therefore, except I type norovirus of G detects in in-vitro transcription RNA fragment sequences
Outside aim sequence, also contain in the T7 promoters partial sequence of aim sequence upstream and target gene downstream from EcoRV digestions position
Sequence of the point to BamHI restriction enzyme sites.The RNA sequencing results of in-vitro transcription generation are as shown in SEQ ID No.1:
(GGGCGAAUUGGGCCCUCUAGAUGCAUGCUCGAGCGGCCGCCAGUGUGAUGGAU
AUCUGCAGAAUUCCAGCACACUGGCGGCCGUUACUAGUG), it is the RNA fragments of one section of 166bp, is G I wherein in square frame
Type norovirus detection of nucleic acids purpose fragment, by the gene of I type norovirus of G in the purpose fragment sequencing result and GenBank
Sequence carries out homology analysis, and homology is up to 100%, the purpose fragment with the insertion of I sequencing results of recombinant plasmid pcDNAII-G
Unanimously, the purpose fragment of the I type norovirus of corresponding G in the RNA for illustrating to prepare containing sequence as shown in SEQ ID No.5.
5.2.4 the non denatured agarose gel electrophoresis identifications of 0.7%-2.0%
The purity of one side assistant analysis RNA, on the other hand identifies the integrality of transcription RNA according to the size of RNA fragments.
Electrophoresis result finds occur specific band at 100bp-200bp, is consistent with the RNA sequence size drawn is sequenced, and without it
There is (Fig. 9) by non-specific transcription product in him.
The I type norovirus detection of nucleic acids standard substance candidate inanimate objects of G prepared by above scheme are infectious, avoid
The problem of bio-safety, Quality Control and quantitative demand when ensureing to meet viral nucleic acid detection.
The foundation of 3 RT-ddPCR methods of embodiment
RT-ddPCR methods are mainly used for uniformity, stability in norovirus detection of nucleic acids standard substance preparation process
With definite value research.The optimum detection scope of RT-ddPCR is 20-2000 copies/μ L, using balance weight method, by RNA reference materials
Matter carries out gradient dilution, with reference to One-Step RT-ddPCR Kit forProbes kit methods, to the standard of above-mentioned preparation
Material carries out RT-ddPCR detections, and used primed probe is with being shown in Table 1, reference reagent cassette method, and concrete operation method is as follows：
1.PCR reaction systems
2 × one-step RT-ddPCR supermix, 10 μ L, 25mM manganese acetate solution
0.8 μ L, forward primer and reverse primer each 1.0-1.8 μ L, fluorescence probe (as shown in SEQ ID No.2 and SEQ ID No.3)
(as shown in SEQ ID No.4) 0.5 μ L, RNA template 2.0 μ L, DEPC water polishings to 20 μ L.Primer probe sequence is shown in Table 1.
2. droplet generates
The RT-ddPCR reaction systems of 20 μ L and 65 μ L droplets generation oil are added separately in 8 hole droplet generation cards, put
The generation droplet in droplet generation instrument (QX200, Bio-Rad, Pleasanton, CA).
3.PCR reacts
The droplet (40 μ L) of the Water-In-Oil of generation is slowly transferred in 96 orifice plates, aluminium foil heat-sealing film sealer is placed on commonly
Amplified reaction, response parameter are carried out in PCR instrument：60℃30min；95℃5min；94 DEG C of 30s, Tm 60s, 40 circulations；98℃
10min；4℃Hold.Warming and cooling rate≤2.5 DEG C/sec.
4. result judgement
PCR after reaction, after QX100/200droplet reader detections, obtains copying for RNA in 20 μ L reaction systems
Shellfish concentration value, the RNA copy concentrations in sample are：The copy of RNA in sample RNA concentration (copy/μ L)=20 μ L reaction systems
Concentration (copy/μ L) × 20 μ L ÷, 2 μ L (RNA template sample-addings amount) × extension rate.
The preparation of 4 G of embodiment, I type norovirus detection of nucleic acids standard substances
Dilution, uniformity initial survey and the packing of I type norovirus detection of nucleic acids standard substance candidates of 1.G
It is using the DEPC processing water without RNase that the I type norovirus detection of nucleic acids standard substance candidates of G of preparation is dilute
Release to 10-4, its ultraviolet spectrophotometry survey absorbance A260/A280=2.04, show I type norovirus nucleic acid of the G inspection prepared
It is higher to survey standard substance candidate RNA purity.In order to examine the dilution of I type norovirus detection of nucleic acids standard substance candidates of G molten
Whether the distribution of RNA molecule is uniform in liquid, by being inhaled to top layer, middle level, the different sample points of bottom three in the middle part of conical centrifuge tube
30 μ L RNA solutions are taken, are detected using fluorescence RT-PCR method, each sampled point repeats detection 5 times, using single factor test side
The detection Ct values of poor analysis method comparison difference sampled point.Uniformity initial survey shows that the I type norovirus nucleic acid of G after dilution is examined
Standard substance candidate RNA molecule is surveyed to be evenly distributed (table 2).I type norovirus detection of nucleic acids standard substance candidates of G after dilution
The 1.2mL that thing is distributed into sterile no enzyme has the screw socket cryopreservation tube (Corning) of sealing ring, and every 0.1mL, prepares 200 samples altogether
Article unit, obtains I type norovirus detection of nucleic acids standard substances of G.
2 G of table, I type norovirus detection of nucleic acids standard substance candidate uniformity initial survey results
I type norovirus detection of nucleic acids Certified Reference Material Homogeneities of 2.G are studied
2.1 extracting unit numbers and sampling mode
16 units are extracted out of 200 sample units, for uniformity testing.Sampling mode is stratified random smapling,
Specially：According to the initial of packing, mid-early stage, middle and later periods and finishing steps, 200 cell-averages are divided into 4 layers, 50 every layer
Unit, unit in every layer is encoded by 1-50 respectively, using the table of random numbers determine every layer extraction sample number, every layer with
Machine extracts 4 units.
2.2 uniform Journal of Sex Research detection methods
Uniformity testing is carried out using RT-ddPCR methods in embodiment 1, every sample repeats detection 3 times.
2.3 uniformity testings assess statistical model
It is first first into trend test between row ping after obtaining detection data, when trend is not notable between ping, point Ji it not calculate uniform between ping
Property with bottle in uniformity, using one-way analysis of variance method carry out statistical analysis, calculate uniformity introduce uncertainty
2.4 uniformity testing data results judge
I type norovirus detection of nucleic acids Certified Reference Material Homogeneity results of study of G are shown in Figure 10 and table 3, and table 3 lists I type promises of G such as
Viral nucleic acid examination criteria material homogeneity analysis data.
3 G of table, I type norovirus detection of nucleic acids Certified Reference Material Homogeneity check analysis data (× 107Copy/μ L)
Data can be calculated in table：
The sum of squares of deviations between group
Intra-class variance and
v1=m-1=15
v2=N-m=32
Standard deviation between group
Group internal standard deviation
Counting statistics amount F
According to the free degree (15,32) and given significance 0.05, F is checked in by F distributions tables of critical valuesα=
1.9922, compared with the F values being calculated F ＜ Fα, it is believed that between group group internal standard deviation between no significant difference, andIn explanation group measured deviation be less than group between measured deviation, droplet type numeral RT-PCR method it is repeated more satisfactory.
Standard deviation between each group of data
Each niAll same, in uniform Journal of Sex Research, slThe deviation s that as uniformity of standard substance introducesbb, then formula can letter
Turn to：
Therefore the uncertainty u that uniformity introducesbbFor
ubb=sbb=0.16 (× 107Copy/μ L)
I type norovirus detection of nucleic acids standard substance stability studies of 3.G
3.1 short-term stabilities and long-time stability research approach
Short-term stability research approach：Using 40 DEG C, room temperature (RT, 20~25 DEG C), 4 DEG C and -20 DEG C, investigate norovirus
The stability of transportational process under nucleic acid standard substance sample difference traffic condition；The research approach that long-time stability are stablized：By sample
Product are continuous at a temperature of being stored in -80 DEG C to investigate at least six moon, and concrete scheme is shown in Table 4.
4 G of table, I type norovirus detection of nucleic acids standard substance stability study schemes
The selection of 3.2 stability study detection methods
Stability investigation is carried out using RT-ddPCR methods, each investigation time point randomly selects 3 standard substance samples
Article unit, each sample unit repeat detection 3 times, calculate average value.
3.3 stability assessment data results judge
3.3.1 short-term stability result of study
Data are investigated to short-term stability using variance analysis method and carry out statistical check, analyze I type norovirus nucleic acid of G
Stability of the examination criteria material sample under different preservation conditions, determines most long transport time limit and traffic condition.The result shows that
The standard substance is degraded rapidly in 40 DEG C of environment, only stablizes preserve 3d at room temperature, and 4 DEG C can stablize preservation 14d, and -20 DEG C can be steady
Surely 28d (table 5) is preserved.
5 G of table, I type norovirus detection of nucleic acids standard substance short-term stabilities
*：Room temperature refers to temperature between (20~25) DEG C；#：Compared with the measured value of the 0th day, p ＜ 0.05
3.3.2 long-time stability result of study
Long-time stability result of study is shown in Figure 11, carries out Trend analysis using linear model, observes long-time stability number
According to whether having significant change trend, stability of the standard substance within the given holding time is determined, computational stability introduces not
Degree of certainty.I type norovirus detection of nucleic acids standard substance stability datas of G are given in table 6.
6 G of table, I type norovirus detection of nucleic acids standard substance long-time stability investigate result
The evaluation of long-time stability is by the characteristic value in different time bioassay standard material, in potential kinetics mechanism
In the case of unknown, generally use (classics) linear model, Y=b0+b1X depicts the relation of characteristic magnitude and time, formula
In：b0, b1For regression coefficient, X is the time, and Y is I type norovirus detection of nucleic acids standard substance characteristic values of G.
Slope by 6 Detection of Stability measure data fitting linear equation of table is：
In formula：
The intercept of linear equation is：
The standard deviation of point among straight line：
The standard deviation of slope is：
It is n-2=5 in the free degree, under confidence level p=0.95 (95% level of signifiance), examines slope to be compared with 0
No to have significant difference, the critical value of t-inspection is 2.571, because
|b1| ＜ t0.95,5×s(b1)=2.571 × 0.0096=0.025
So slope is not notable, therefore unstability is not observed.At this time, the term of validity of standard substance is 6 months, no
The partial uncertainty that stability introduces is us=s (b1) × X=0.0096 × 6=0.058 (× 107Copy/μ L).
I type norovirus detection of nucleic acids standard substances of 4.G combine definite value scheme
G I type norovirus detection of nucleic acids of the pattern to preparation of Duo Jia laboratory cooperation definite values is carried out using RT-ddPCR
Standard substance carries out definite value, with the copy concentrations containing I type norovirus purpose fragment RNA of G, i.e., contained by every μ L solution
RNA copy numbers are as standard value.
4.1 joint definite value scheme
Choose with authoritative 9 independent laboratories for possessing progress digital pcr detection of certain technology cooperate and determine
Value research, four kinds of RM, every kind of each 3 parts of parallel wrapping units are provided to every independent laboratory at random, while are provided specificity and drawn
Thing/probe (being shown in Table 1) and normalizing operation program (Standard Operating Procedure, SOP) and result report model
This.Each joint definite value laboratory is required received RM Sample storages in -80 DEG C or liquid nitrogen, draws before detection is started
Thing/probe is stored in -20 DEG C.
4.2 SOP are summarized
10 times of gradient dilutions are carried out to I type norovirus detection of nucleic acids standard substances of G using balance weight method, in 18 μ L
The RNA templates after 2.0 μ L dilutions are added in PCR reaction systems, then the 20 μ L PCR reaction systems containing RNA templates are transferred to micro-
In drop generation card, droplet generation is stuck in QX100/200 drop generators and generates nearly 20000 droplets, will be micro- with pipettor
Drop is gone in 96 orifice plates, and reverse transcription PCR reaction is carried out on regular-PCR instrument.PCR after reaction, is analyzed using QX100/200
Instrument droplet detects whether each droplet has fluorescence signal one by one, obtains the copy concentrations value of RNA in 20 μ L reaction systems, in sample
RNA copy concentrations be：The copy concentrations of RNA (are copied in standard substance sample RNA concentration (copy/μ L)=20 μ L reaction systems
Shellfish/μ L) × 20 μ L ÷, 2 μ L (RNA template sample-addings amount) × extension rate.Report testing result, and detection method used is carried out
Generality describes.
The collection of 4.3 joint definite value test in laboratory data and technical Analysis
Share 9 independent laboratories and participate in the joint definite value research of I type norovirus detection of nucleic acids standard substances of G.9 experiments
Press the order of 1#~9#, number consecutively in room.
After the result report for receiving 9 laboratories, the generality description first to measurement result and detection method used is pressed
The following aspects carries out technical Analysis：
(1) definite value laboratory is respectively combined before detection is started, if by received RM Sample storages in -80 DEG C or liquid nitrogen
In, primer/probe is stored in -20 DEG C；
(2) whether each RM samples are using balance weight method progress gradient dilution；
(3) add RT-ddPCR reaction systems in whether be 2 μ L dilution after RM samples；
(4) whether detection data are reported as the form of copy concentrations, i.e., per the RNA copy numbers of μ L solution；
(5) it whether there is data reduction mistake.
By technical Analysis, in 9 laboratories, the detected value of 7# experiments pair deviates considerably from the detected value in other laboratories,
Therefore this group of data are rejected, the testing result average value and standard deviation in each data qualifier laboratory are shown in Table 7.
Combine definite value result in 7 Duo Jia laboratories of table
4.3.1 data equally accurate judges
4.3.3.1 method：Using Cork discuss method examine between each laboratory average value whether equally accurate, i.e.,WhereinFor the maximum in m laboratory measurements standard deviation,For in m family laboratory
The standard deviation of the measured value in i family laboratory.
4.3.3.2 result：According to level of significance α=0.05, the laboratory group number m=8 of standard substance definite value is participated in, it is more
Number laboratory duplicate measurements frequency n=9, obtain critical value C (0.05,8,9)=0.2926.Obtained according to Cochran calculation formula：
C ＜ C (0.05,8,9), examining verification, 8 groups of data are equally accurates without suspicious data group.
4.3.2 whether there is outlier judgement
4.3.2.1 method：Average value with Rod Dixon principle to 8 groups of I type norovirus detection of nucleic acids standard substance definite values of G
Statistical check is carried out, determines whether outlier.
4.3.2.2 result：Each laboratory definite value average value is as follows by arranging from small to large：
f(0.01,8)=0.717, r1And rnRespectively less than f(0.01,8), examine and judge without outlier.
4.3.3 normal distribution-test
4.3.3.1 method
I type norovirus detection of nucleic acids standard substance definite value result datas of G are examined using the coefficient of skew and coefficient of kurtosis
Normality.
4.3.3.2 result
Each laboratory definite value average value is as follows by arranging from small to large：
The coefficient of skew；For detecting the asymmetry of data：
Coefficient of kurtosis, is examined for kurtosis：
B=m4/(m2)2=1.767
According to confidence level p=0.99 and detection number 8, table look-up to obtain critical value A1 (0.01,8)=1.42, B1-B′1It is critical
Section is (1.25,4.23), because in 1.36 1.42,1.31 ＜ of ＜, 1.767 ＜ 4.53, therefore I type norovirus detection of nucleic acids of G
The equal Normal Distribution of setting examination data of standard substance.
The standard value of 4.4 G, I type norovirus detection of nucleic acids standard substances determines
Complex art analysis judges that rejecting abnormalities value judges with outlier, normal distribution-test and equally accurate are examined, the mark
The quasi- equal Normal Distribution of material setting examination data, and the average value of each laboratory definite value result is equally accurate, therefore use
Standard value of the overall average of the average value of each laboratory definite value result as the standard substance, i.e.,WhereinFor the standard value of overall average, i.e. standard substance,For i-th
The average value of family's laboratory definite value result, m is the laboratory number for participating in standard substance definite value research, by each laboratory data mark
The quadratic sum divided by laboratory number of quasi- deviation, evolution obtain the standard deviation of overall average, are the uncertainty A of standard value
Class component uA, i.e.,：
5 G of embodiment, I type norovirus detection of nucleic acids standard substance uncertainty evaluations and its characteristic value determine
I type norovirus detection of nucleic acids standard substance uncertainty sources of G include three aspects：Inhomogeneities introduces not
Degree of certainty (ubb), unstability introduce uncertainty (us) and definite value introduce uncertainty (uchar).Standard substance is determined
Value result should have the implication of two aspects：(1) it is tested the standard value y of the best estimate, i.e. standard substance of characteristic magnitude；
(2) the uncertainty u of standard valueCRM.Therefore the definite value result of the standard substance is represented by y ± uCRM。
1. appraisal procedure
Expanded uncertainty uCRMIt is that, according to fiducial probability, selection is accordingly after partial uncertainty combined standard uncertainty
Spreading factor, using formula uCRM=k × uCRMCalculate.uCRMFor combined standard uncertainty,ucharIt is the not true of standard substance definite value process introducing
Fixed degree, by A class components uAWith B class components uBTwo parts form, ubbThe uncertainty introduced for the uniformity of standard substance, usFor
The uncertainty that the stability of standard substance introduces.Normal distribution formula, Coverage factor k can divide position according to confidence level from t
Checked in number.
2. uncertainty evaluation result
Each partial uncertainty is shown in Table 8.
The uncertainty that 2.1 uniformities introduce
See that 2.4. uniformity testing data results are sentenced in the preparation of I type norovirus detection of nucleic acids standard substances of embodiment 4G
It is disconnected.The uncertainty u that uniformity introducesbbFor：
ubb=sbb=0.16 (× 107Copy/μ L)
Relative uncertainty degree is：
The uncertainty that 2.2 stability introduce
See the 3.3.2 Journal of Sex Research knots steady in a long-term in the preparation of I type norovirus detection of nucleic acids standard substances of embodiment 4G
Fruit.Stability introduce partial uncertainty be：
us=s (b1) × X=0.0096 × 6=0.058 (× 107Copy/μ L)
Do not know relatively be：
The uncertainty that 2.3 definite values introduce
Uncertainty (the u of definite valuechar) mainly by the A class uncertainties (u of Duo Jia laboratories joint definite value resultA) and it is fixed
The B class uncertainties (u of value methodB) composition.Due to combining deterministic models using more independent laboratories, in measurement process
B classes component is embodied in definite value result at random, therefore no longer carries out B class uncertainty evaluations.Definite value introduce uncertainty be：
Relative uncertainty degree is：
2.4 expanded uncertainty
Each partial uncertainty is synthesized, obtains combined standard uncertainty, takes spreading factor k=2, is calculated each RM's
Expanded uncertainty.Expanded uncertainty generally gives up to two effective digitals, and the digit of standard value y will be with uncertainty
Digit is alignd after decimal point, position after the decimal point for the standard value reservation for thus making I type norovirus detection of nucleic acids standard substances of G
Number.
8 G of table, I type norovirus detection of nucleic acids standard substance uncertainties (× 107Copy/μ L)
The characteristic value of 2.5 G, I type norovirus detection of nucleic acids standard substances
According to standard value and its uncertainty, the characteristic value for determining I type norovirus detection of nucleic acids standard substances of G is：5.4
±1.2(×107Copy/μ L).
Obviously, the above embodiment of the present invention is only intended to clearly illustrate example of the present invention, and is not pair
The restriction of embodiments of the present invention, for those of ordinary skill in the field, may be used also on the basis of the above description
To make other variations or changes in different ways, all embodiments can not be exhaustive here, it is every to belong to this hair
Row of the obvious changes or variations that bright technical solution is extended out still in protection scope of the present invention.
Sequence table
<110>Inspection and Quarantine Technology Center, Beijing Entry-Exit Inspection and Q
<120>A kind of I type norovirus detection of nucleic acids standard substances of G and its preparation method and application
<130> JLC17I0606E
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 166
<212> RNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
gggcgaauug ggcccucuag augcaugcuc gagcggccgc cagugugaug gaugcccccc 60
aaggugaauu uacuauuucc ccaaauaaua cccccgguga uguuuuguuu gauuugaguu 120
uggguccauc ugcagaauuc cagcacacug gcggccguua cuagug 166
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gccccccaag gtgaatttac 20
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ggacccaaac tcaaatcaaa caa 23
<210> 4
<211> 27
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
tttccccaaa taataccccc ggtgatg 27
<210> 5
<211> 74
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
gccccccaag gtgaatttac tatttcccca aataataccc ccggtgatgt tttgtttgat 60
ttgagtttgg gtcc 74
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
taatacgact cactataggg 20
Claims (9)
- A kind of 1. I type norovirus detection of nucleic acids standard substances of G, it is characterised in that the RNA sequence of the standard substance such as SEQ Shown in ID No.1.
- 2. I type norovirus detection of nucleic acids standard substances of G according to claim 1, it is characterised in that the reference material The characteristic value of matter is (5.4 ± 1.2) × 107Copy/μ L.
- 3. a kind of preparation method of I type norovirus detection of nucleic acids standard substances of G as claimed in claim 1 or 2, its feature It is, comprises the following steps：1) I type norovirus positives of G are screened, extract viral RNA, after reverse transcription, are amplified as shown in SEQ ID No.5 DNA fragmentation；2) DNA fragmentation described in step 1) is connected construction recombination plasmid with plasmid vector；3) by the recombinant plasmid transformed that step 2) obtains to competent cell, propagation, extracts recombinant plasmid；4) recombinant plasmid obtained using restriction enzyme to step 3) extraction carries out single endonuclease digestion, obtains linearisation restructuring matter Grain；5) to linearize recombinant plasmid as template, in-vitro transcription synthesis obtains I type norovirus detection of nucleic acids standard substances of G and waits Thing is selected, is diluted, after uniformity, Detection of Stability, carries out definite value and uncertainty evaluation, you can.
- 4. preparation method according to claim 3, it is characterised in that amplified in step 1) as shown in SEQ ID No.5 DNA fragmentation used in primer as shown in SEQ ID No.2 and SEQ ID No.3.
- 5. preparation method according to claim 3, it is characterised in that the restriction enzyme is restricted interior for HamH I Enzyme cutting.
- 6. preparation method according to claim 3, it is characterised in that the promoter of the in-vitro transcription is T7 promoters, Its sequence is shown in SEQ ID No.6, transcription is since first G in last three G of sequence.
- 7. a kind of I type norovirus detection of nucleic acids standard substances of G as claimed in claim 1 or 2 are in I type norovirus cores of G Application in acid detection as standard substance.
- A kind of 8. kit of the I type norovirus detection of nucleic acids standard substances of G comprising described in claim 1 or 2.
- 9. kit according to claim 8, it is characterised in that the kit is further included for detecting I type promises of G such as The RT-ddPCR primer and probes combination of viral nucleic acid, the RT-ddPCR primer and probes combination include such as SEQ ID No.2 With the primer shown in SEQ ID No.3 and the probe as shown in SEQ ID No.4；Preferably, the probe 5 ' holds flag F AM, 3 ' end mark BHQ.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711080288.8A CN107988425A (en) | 2017-11-06 | 2017-11-06 | A kind of I type norovirus detection of nucleic acids standard substances of G and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711080288.8A CN107988425A (en) | 2017-11-06 | 2017-11-06 | A kind of I type norovirus detection of nucleic acids standard substances of G and its preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107988425A true CN107988425A (en) | 2018-05-04 |
Family
ID=62030170
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711080288.8A Pending CN107988425A (en) | 2017-11-06 | 2017-11-06 | A kind of I type norovirus detection of nucleic acids standard substances of G and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107988425A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109762944A (en) * | 2019-03-29 | 2019-05-17 | 山东时进检测服务有限公司 | A kind of method of I type norovirus of G in detection marine food |
| CN110616200A (en) * | 2018-06-19 | 2019-12-27 | 中国动物疫病预防控制中心（农业部屠宰技术中心） | Porcine reproductive and respiratory syndrome virus European strain nucleic acid standard substance and preparation method thereof |
| CN113025758A (en) * | 2021-04-07 | 2021-06-25 | 拱北海关技术中心 | Primer, probe and kit for detecting GI type norovirus of aquatic product |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7822782B2 (en) * | 2006-09-21 | 2010-10-26 | The University Of Houston System | Application package to automatically identify some single stranded RNA viruses from characteristic residues of capsid protein or nucleotide sequences |
| CN105505953A (en) * | 2016-01-14 | 2016-04-20 | 山东出入境检验检疫局检验检疫技术中心 | Preparing method for GI type norovirus virus-like particles and application thereof |
| CN106119417A (en) * | 2016-08-04 | 2016-11-16 | 北京出入境检验检疫局检验检疫技术中心 | The test kit of a kind of accurate quantification detection norovirus I type and detection method |
-
2017
- 2017-11-06 CN CN201711080288.8A patent/CN107988425A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7822782B2 (en) * | 2006-09-21 | 2010-10-26 | The University Of Houston System | Application package to automatically identify some single stranded RNA viruses from characteristic residues of capsid protein or nucleotide sequences |
| CN105505953A (en) * | 2016-01-14 | 2016-04-20 | 山东出入境检验检疫局检验检疫技术中心 | Preparing method for GI type norovirus virus-like particles and application thereof |
| CN106119417A (en) * | 2016-08-04 | 2016-11-16 | 北京出入境检验检疫局检验检疫技术中心 | The test kit of a kind of accurate quantification detection norovirus I type and detection method |
Non-Patent Citations (4)
| Title |
|---|
| BYOUNG-HWA KONG等: "Development of Enhanced Primer Sets for Detection of Norovirus", 《BIOMED RESEARCH INTERNATIONAL》 * |
| 全国标准物质管理委员会: "《标准物质的研制、管理与应用》", 30 November 2010, 中国计量出版社 * |
| 周云龙: "《转基因生物标志物质研制与应用》", 31 August 2014, 中国质检出版社 * |
| 曹芳芳等: "单管多重荧光定量RT-PCR方法鉴别A组轮状病毒及诺如病毒GⅠ型和GⅡ型", 《中国卫生检验杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110616200A (en) * | 2018-06-19 | 2019-12-27 | 中国动物疫病预防控制中心（农业部屠宰技术中心） | Porcine reproductive and respiratory syndrome virus European strain nucleic acid standard substance and preparation method thereof |
| CN109762944A (en) * | 2019-03-29 | 2019-05-17 | 山东时进检测服务有限公司 | A kind of method of I type norovirus of G in detection marine food |
| CN113025758A (en) * | 2021-04-07 | 2021-06-25 | 拱北海关技术中心 | Primer, probe and kit for detecting GI type norovirus of aquatic product |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105203759B (en) | A kind of method of use colloidal gold chromatographic technology for detection mycoplasma pneumoniae nucleic acid and test kit | |
| CN109735657A (en) | A kind of reagent, detection method and application for African swine fever virus detection | |
| CN107988425A (en) | A kind of I type norovirus detection of nucleic acids standard substances of G and its preparation method and application | |
| CN106167833B (en) | A kind of while 8 kinds of entomophila encephalitis viruses of detection RT-PCR primers and probe combinations and kit | |
| CN103509877B (en) | A kind of PCR kit for fluorescence quantitative for detecting PRV and application thereof | |
| CN111440793B (en) | Novel coronavirus nucleic acid detection kit | |
| CN107513584A (en) | A kind of five heavy fluorescence quantitative kits for detecting enterovirus | |
| CN107267628A (en) | Embryonic limb bud cell prochromosome abnormality detection kit | |
| CN106868227A (en) | Yak rotavirus detection kit and application based on constant temperature isolation type fluorescent PCR platform | |
| CN106434996A (en) | Kit and method for detecting Acinetobacter baumannii DNA | |
| CN110499393A (en) | The real-time fluorescence quantitative PCR detection of hepatitis infectiosa canis virus, hepatitis infectiosa canis virus I type and hepatitis infectiosa canis virus II type and diagnostic primers and probe | |
| CN106868224A (en) | The RT PCR methods of detection pig blue-ear disease poison classical strainses, highly pathogenic mutant strain and the strains of NADC 30 | |
| CN1955310B (en) | Nucleotide sequential, testing kit and method for detecting swine streptococcus II | |
| CN101550452B (en) | Human bocavirus real-time fluorescence PCR detection reagent kit | |
| CN100404689C (en) | Real-time fluorescent PCR testing primer, probe and immobilized kit for citrus ulcer bacteria and testing process thereof | |
| CN106636474B (en) | Six kinds of viral primer sets of Multiple immunizations fluoroscopic examination mouse, kit and method | |
| CN108330211A (en) | A group rotavirus/astrovirus/intestinal adenovirus nucleic acid multiple fluorescence PCR detection reagent box and application thereof | |
| CN109762932A (en) | Identify the detection primer and probe, kit and application of HP-PRRSV and NADC30-like strain | |
| CN104342487B (en) | Mycoplasma nucleic acid constant-temperature amplification method | |
| CN113444773A (en) | Method and kit for detecting tick pathogen nucleic acid based on liquid chip | |
| CN106701983B (en) | Gonococcus, microspironema pallidum, chlamydia trachomatis, the hybond membrane bar of ureaplasma urealyticum and detection kit | |
| CN105671207A (en) | Liquid chip detection method for four types of pathogens of porcine virus diarrhea | |
| CN108624713A (en) | A kind of porcine pseudorabies vaccine virus differentiates the method and kit of detection with wild poison | |
| CN107513562A (en) | Detect pseudomonas aeruginosa and ExoU primer, kit and method in water | |
| CN107326098A (en) | The multi-fluorescence immunoassay method and reagent of a kind of quick differentiation Rabbit pest virus, sendai virus and lapine rotavirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |