CN108913768A - Multiple liquid phase genetic chip primer, kit and its analysis method a kind of while that detect seven aminoglycosides drug resistant genes - Google Patents
Multiple liquid phase genetic chip primer, kit and its analysis method a kind of while that detect seven aminoglycosides drug resistant genes Download PDFInfo
- Publication number
- CN108913768A CN108913768A CN201810814819.XA CN201810814819A CN108913768A CN 108913768 A CN108913768 A CN 108913768A CN 201810814819 A CN201810814819 A CN 201810814819A CN 108913768 A CN108913768 A CN 108913768A
- Authority
- CN
- China
- Prior art keywords
- primer
- aph
- seq
- aminoglycosides
- drug resistant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of multiple liquid phase genetic chip primer, kit and its analysis methods for detecting seven aminoglycosides drug resistant genes simultaneously；It is intended to provide a kind of easy to operate, aminoglycoside resistant gene aac (6 ')-Ie-aph (2 ")-Ia can be detected simultaneously; aph (3 ')-IIIa; ant (4 ')-Ia; ant (9)-Ia; aadE; aph (3 ')-Ia and aph (3 ")-Ib, and there is high sensitivity, accuracy rate is high, it can be achieved that a variety of different molecules of interest in same sample carry out detection primer, kit and its analysis method simultaneously；Its technical solution includes primer nucleotide sequences such as SEQ ID NO：1-SEQ ID NO：Primer shown in 4；The invention belongs to the Pathogen test fields of experimental animal.
Description
Technical field
The invention belongs to the Pathogen test fields of experimental animal, and in particular to a kind of to detect aminoglycosides drug resistance base simultaneously
Because of aac (6 ')-Ie-aph (2 ")-Ia, aph (3 ')-IIIa, ant (4 ')-Ia, aadE, ant (9)-Ia, aph (3 ')-Ia and
The multiple liquid phase genetic chip analysis method and kit of aph (3 ")-Ib.
Background technique
Aminoglycoside antibiotics is a kind of wide spectrum, efficient antibacterials, is widely used in clinic, is clinical treatment
The important selection of severe infections caused by gram-Negative bacillus, often with other antibacterials combination therapy bacterium infections.Such is anti-
Raw element is specifically bound by the highly conserved area with bacterial ribosomal subunit, and Ribosome Structure is caused to change, and reduces albumen
Translation process fidelity inhibits bacterio protein synthesis, cell integrity is destroyed, so as to cause bacterial death.With amino sugar
Tobramycin antibiotic is clinically remaining widely to be used in year, and bacterium gradually produces different degrees of drug resistance to such drug.Needle
To aminoglycoside antibiotics, go out in the main resistance mechanism of Acinetobacter bauamnnii reply comprising generating Aminoglycosides modifying enzyme
Aminoglycoside antibiotics living and generation 16S rRNA methylase change aminoglycoside antibiotics target site etc..
Aminoglycosides modifying enzyme passes through specific amino and light base on modification aminoglycoside antibiotics side chain, so that by
The antibacterials of modification and the combination of bacterial ribosome are reduced, so that the similar aminoglycoside antibacterial of one or several kinds of structures
Drug-resistant.Aminoglycosides modifying enzyme huge number, it is presently found to have reached a variety of differences according to catalyst mechanism, by its point
For aminoglycoside phosphorylase (aminoglycoside phosphotransferase, APH), aminoglycoside acetylation
Sour (aminoglycoside acetytransferases, AAC) and aminoglycoside adenylase (aminoglycoside
Nucletidyltransferases, ANT) three big families.
Bacterial drug resistance detection both at home and abroad mainly has Phenotypic examination and the big method of genotype detection two at present.Traditional phenotype
Detection can intuitively react disease based on Bacteria Culture using susceptibility test methods and automation susceptibility detection method, this method
Opportunistic pathogen is to certain medicaments insensitive or drug resistance, but drug sensitivity tests report is slower, and experience dependence is strong, cumbersome, cannot fit completely
Answer the needs of clinical treatment.The method of Resistant genetype detection includes PCR, multiplex PCR and biochip technology.PCR and multiple
Round pcr amount detection is limited, and genetic chip has the characteristics that high-throughput, quick and precisely in contrast.At present about gene core
The existing part of piece screening drug resistant gene is attempted, but all concentrates on the solid phase chip field based on DNA microarray technology.Solid phase
Chip cost is high, sample preparation is also more complex, limits it to a certain degree and monitors and use clinically in cause of disease.For this purpose, needing
Establish the new high throughput of one kind, cost performance height, drug resistant gene screening platform easy to operate.
Existing aminoglycoside resistant genetic test is mainly by common substance PCR and multiplex PCR.It is reported to be directed to intestines
The multiplex PCR of coccus detects aac (6)-Ie-aph (2 ")-Ia, aph (2 ")-Ib, aph (2 ")-Ic, aph (2 ")-Id, aph
6 drug resistant genes of (3 ')-IIIaa and ant (4 ')-Ia, product clip size are differed from 71bp to 867bp, and the primer used is dense
Degree is not also inquired into the sensitivity of multiplex PCR, there are higher missed detection risks down to 5pmol.Moreover, either substance
Or multiple PCR technique, result judgement requires gel electrophoresis, time-consuming and laborious, and it is big to encounter sample size in practical applications
Situation is difficult to meet detection demand.
In addition, as more and more drug resistant genes are found, the current country yet there are no a kind of can detect seven kinds simultaneously
The detection method of aminoglycoside resistant gene also there are no resistance to using Multiple immunizations fluorescence analysis method detection aminoglycoside
The report of medicine gene.
Summary of the invention
Aminoglycosides drug resistant gene aac (6 ')-Ie-aph (2 ")-is detected simultaneously the purpose of the present invention is to provide a kind of
The multiple liquid phase base of Ia, aph (3 ')-IIIa, ant (4 ')-Ia, aadE, ant (9)-Ia, aph (3 ')-Ia and aph (3 ")-Ib
Because of chip analysis primer.
Another object of the present invention is to mention a kind of while detecting aminoglycosides drug resistant gene aac (6 ')-Ie-aph
(2 ")-Ia, the multiple liquid of aph (3 ')-IIIa, ant (4 ')-Ia, aadE, ant (9)-Ia, aph (3 ')-Ia and aph (3 ")-Ib
Phase gene microarray analysis kit.
Aminoglycosides drug resistant gene aac (6 ')-Ie-aph is detected simultaneously a further object of the present invention is to provide a kind of
(2 ")-Ia, the multiple liquid of aph (3 ')-IIIa, ant (4 ')-Ia, aadE, ant (9)-Ia, aph (3 ')-Ia and aph (3 ")-Ib
Phase gene microarray analysis method.
For this purpose, first technical solution provided by the invention is：
Multiple liquid phase genetic chip primer that is a kind of while detecting seven aminoglycosides drug resistant genes, the amino sugar
Amine drug resistant gene is：Aac (6 ')-Ie-aph (2 ")-Ia, aph (3 ')-IIIa, ant (4 ')-Ia, ant (9)-Ia, aadE,
Aph (3 ')-Ia and aph (3 ")-Ib；
Primer nucleotide sequences described in each aminoglycosides drug resistant gene are as follows：
Aac (6 ')-Ie-aph (2 ")-Ia detection primer：
Primer P1：AGAGCAATAAGGGCATACCAAA(SEQ ID NO：1),
Primer P2：CCACACTATCATAACCACTACCGA(SEQ ID NO：2)；
Aph (3 ')-IIIaa detection primer：
Primer P3：AGACGGAAAAGCCCGAAGA(SEQ ID NO：3),
Primer P4：GCAGAAGGCAATGTCATACCA(SEQ ID NO：4)；
Ant (4 ')-Ia detection primer：
Primer P5：AATCGGTAGAAGCCCAAAAGT(SEQ ID NO：5),
Primer P6：TGGTAGAAATGTTGTCGGTCC(SEQ ID NO：6)；
Ant (9)-Ia detection primer：
Primer P7：TGGTTCAGCAGTAAATGGTGGT(SEQ ID NO：7),
Primer P8：ATTGCCAAGGGACAACTTCACT(SEQ ID NO：8)；
AadE detection primer：
Primer P9：AGAAACTTTTGTCCACCTACCG(SEQ ID NO：9),
Primer P10：AATGAAGCCTTTCCGCCA(SEQ ID NO：10)；
Aph (3 ')-Ia detection primer：
Primer P11：AGCCGTTTCTGTAATGAAGGAG(SEQ ID NO：11),
Primer P12：GTGATTTTGATGACGAGCGTAA(SEQ ID NO：12)；
Aph (3 ")-Ib detection primer：
Primer P13：GGGTCCAATCGCAGATAGAA(SEQ ID NO：13),
Primer P14：GCTAACGCCGAAGAGAACTG(SEQ ID NO：14).
Preferably, the multiple liquid phase genetic chip primer of seven aminoglycosides drug resistant genes is detected while above-mentioned,
5 ' ends of the primer P1 and P2 wherein primer are biotinylated；
5 ' ends of the primer P3 and P4 wherein primer are biotinylated；
5 ' ends of the primer P5 and P6 wherein primer are biotinylated；
5 ' ends of the primer P7 and P8 wherein primer are biotinylated；
5 ' ends of the primer P9 and P10 wherein primer are biotinylated；
5 ' ends of the primer P11 and P12 wherein primer are biotinylated；
5 ' ends of the primer P13 and P14 wherein primer are biotinylated.
Preferably, the multiple liquid phase genetic chip primer of seven aminoglycosides drug resistant genes, institute are detected while above-mentioned
State primer P1 and P2, P3 and P4, P5 and P6, P7 and P8, P9 and P10, P11 and P12, what is be not biotinylated in P13 and P14 draws
5 ' ends of object are connected with tag sequence, and the tag sequence can mutually be recruited with the anti-tag sequence having in fluorescence-encoded micro-beads
It is right.
Preferably, seven aminoglycosides drug resistant genes of detection while above-mentioned, the primer P1 and P2, P3 and P4,
The tag sequence connected in this 7 groups of primer pairs of P5 and P6, P7 and P8, P9 and P10, P11 and P12, P13 and P14 is selected from SEQ ID
NO：Tag sequence shown in 15~21, and the tag sequence connected in 7 groups of primer pairs is different.
Second technical solution provided by the invention be：
Multiple liquid phase genetic chip kit that is a kind of while detecting seven aminoglycosides drug resistant genes, in the kit
Contain any primer of Claims 1 to 4.
Preferably, the multiple liquid phase genetic chip kit of seven aminoglycosides drug resistant genes is detected while above-mentioned,
The fluorescence-encoded micro-beads of different iridescent are also encoded in the kit containing streptavidin-phycoerythrin compound, 7 kinds.
Preferably, the multiple liquid phase genetic chip kit of seven aminoglycosides drug resistant genes is detected while above-mentioned,
Different iridescent also are encoded containing the anti-tag sequence with tag sequence complementary pairing in primer in the fluorescence-encoded micro-beads
Fluorescence-encoded micro-beads in the anti-tag sequence that contains it is different.
Third technical solution provided by the invention is：
Multiple liquid phase genetic chip analysis method that is a kind of while detecting seven aminoglycosides drug resistant genes, including such as
Lower step：
1) genome is extracted from bacterium；
2) using the bacterial genomes of extraction as template, PCR amplification is carried out with any primer of Claims 1 to 4；
3) by upper step amplified production, the fluorescence-encoded micro-beads of the different iridescent of 7 kinds of codings, streptavidin-phycoerythrin
Hybridized；
4) after hybridizing, hybrid product is tested and analyzed by Luminex system, determines the type of its virus；
The above method is used for the diagnosing and treating of non-disease.
Preferably, the multiple liquid phase genetic chip analysis side of seven aminoglycosides drug resistant genes is detected while above-mentioned
Method, it is characterised in that：The reaction system of PCR amplification is in step 2)：
The response procedures of PCR amplification are in step 2)：95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 60 DEG C of annealing 90s, 72
DEG C extend 30s；Circulation 35 times；68 DEG C extend 7min eventually.
Preferably, the multiple liquid phase genetic chip analysis side of seven aminoglycosides drug resistant genes is detected while above-mentioned
Method, it is characterised in that：The reaction system and program of hybridization described in step 3) be：
The beneficial effects of the invention are as follows：
1) present invention realizes while to aminoglycosides drug resistant gene aac (6 ')-Ie-aph (2 ")-Ia, aph (3 ')-
IIIa, ant (4 ')-Ia, aadE, ant (9)-Ia, aph (3 ')-Ia and aph (3 ")-Ib are detected, and the present invention passes through specific
PCR obtain target amplification segment, then by amplified production, fluorescence-encoded micro-beads and streptavidin-phycoerythrin (SA-PE) into
Row hybridization differentiates the rat parvovirus of different plant type when then reading MFI value by detector.
2) the method for the present invention can be simultaneously to 7 aminoglycosides drug resistant genes aac (6 ')-Ie-aph (2 ")-Ia, aph
(3 ')-IIIa, ant (4 ')-Ia, aadE, ant (9)-Ia, aph (3 ')-Ia and aph (3 ")-Ib are accurately detected, Er Qieling
Sensitivity is high, and accuracy is good.Compared with traditional detection method, the method for the present invention is realized to a variety of different purposes in same sample
Molecule is detected simultaneously, and sample dosage is few, easy to operate, quick, can substantially reduce testing cost.The present invention can guarantee identical
Renaturation temperature and hybridization efficiency, and effectively avoid different testing sample mark microballoon between crisscrossing.
Detailed description of the invention
Fig. 1 is the PCR electrophoretogram of 7 aminoglycoside resistant gene drug resistant genes；
Fig. 2 is the multiple liquid phase genetic chip analysis method detection sensitivity experimental result of 7 aminoglycoside resistant genes
Figure；
Fig. 3 is common aac (6 ')-Ie-aph (2 ")-Ia, aph (3 ')-IIIa, ant (4 ')-Ia of 22 clinical samples,
Ant (9)-Ia PCR testing result gel electrophoresis figure；
Fig. 4 is 22 clinical sample aadE, aph (3 ')-Ia and aph (3 ")-Ib regular-PCR testing result gel electrophoresis
Figure；
Specific embodiment
Explanation and specific embodiment are described in further detail claim of the invention with reference to the accompanying drawing.
1 design of primers of embodiment
After being screened to designed a large amount of primers, discovery primer pair P1 and P2, P3 and P4, P5 and P6, P7 and
Drug resistant gene effect is best in the detection 7 simultaneously of P8, P9 and P10, P11 and P12, P13 and the multiple liquid phase genetic chip of P14, alkali
Basic sequence is as follows.
Primer P1：AGAGCAATAAGGGCATACCAAA(SEQ ID NO：1),
Primer P2：CCACACTATCATAACCACTACCGA(SEQ ID NO：2)；
Primer P3：AGACGGAAAAGCCCGAAGA(SEQ ID NO：3),
Primer P4：GCAGAAGGCAATGTCATACCA(SEQ ID NO：4)；
Primer P5：AATCGGTAGAAGCCCAAAAGT(SEQ ID NO：5),
Primer P6：TGGTAGAAATGTTGTCGGTCC(SEQ ID NO：6)；
Primer P7：TGGTTCAGCAGTAAATGGTGGT(SEQ ID NO：7),
Primer P8：ATTGCCAAGGGACAACTTCACT(SEQ ID NO：8)；
Primer P9：AGAAACTTTTGTCCACCTACCG(SEQ ID NO：9),
Primer P10：AATGAAGCCTTTCCGCCA(SEQ ID NO：10)；
Primer P11：AGCCGTTTCTGTAATGAAGGAG(SEQ ID NO：11),
Primer P12：GTGATTTTGATGACGAGCGTAA(SEQ ID NO：12)；
Primer P13：GGGTCCAATCGCAGATAGAA(SEQ ID NO：13),
Primer P14：GCTAACGCCGAAGAGAACTG(SEQ ID NO：14)
The present invention adopts the method for multiple liquid phase genetic chip analysis to aminoglycosides drug resistant gene aac (6 ')-Ie-aph
(2 ")-Ia, aph (3 ')-IIIa, ant (4 ')-Ia, ant (9)-Ia, aadE, aph (3 ')-Ia and aph (3 ")-Ib are examined
It surveys, therefore above-mentioned primer is made into further modification, to meet corresponding operation requirement.Wherein primer P1, P3, P5, P7, P9, P11
It is connected with tag sequence with the 5 ' ends of P13, the tag sequence connected is respectively：
The tag sequence of primer P1 is：CTTAACATTTAACTTCTATAACAC(SEQ ID NO：15)；
The tag sequence of primer P3 is：CTTTCTCATACTTTCAACTAATTT(SEQ ID NO：16)；
The tag sequence of primer P5 is：CACTTAATTCATTCTAAATCTATC(SEQ ID NO：17)；
The tag sequence of primer P7 is：TTAAACAATCTACTATTCAATCAC(SEQ ID NO：18)；
The tag sequence of primer P9 is：ACACTTATCTTTCAATTCAATTAC(SEQ ID NO：19)；
The tag sequence of primer P11 is：TACTTCTTTACTACAATTTACAAC(SEQ ID NO：20)；
The tag sequence of primer P13 is：CAAACAAACATTCAAATATCAATC(SEQ ID NO：21).
In addition, 5 ' the ends of primer P2, P4, P6, P8, P10, P12 and P14 are also added with biotin labeling.
Embodiment 2：The multiple liquid phase genetic chip assay kit of 7 pairs of aminoglycosides drug resistant genes is detected simultaneously
Kit includes following components：
(1) primer designed by embodiment 1 for the analysis of multiple liquid phase genetic chip；
(2) 7 kinds of different iridescent of coding include anti-tag sequence fluorescence-encoded micro-beads, the anti-tag sequence
Column can correspondingly analyze the tag sequence complementary pairing in primer with multiple liquid phase genetic chip；7 kinds of microballoons are purchased from luminex
Company, wherein aac (6 ')-Ie-aph (2 ")-Ia, aph (3 ')-IIIa, ant (4 ')-Ia, ant (9)-Ia, aadE, aph
(3 ')-Ia fluorescence-encoded micro-beads number corresponding with aph (3 ")-Ib be MTAG-A030, MTAG-A020, MTAG-A028,
MTAG-A046, MTAG-A018, MTAG-A015 and MTAG-022.
(3) streptavidin-phycoerythrin compound.
Embodiment 3 detects the multiple liquid phase genetic chip analysis method detection side of 7 pairs of aminoglycoside resistant genes simultaneously
The foundation of method
(1) building of plasmid
Extract the genome of bacterium respectively with the bacterial genomes extraction agent box of Tiangeng, respectively with primer pair P1 and P2,
P3 and P4, P5 and P6, P7 and P8, P9 and P10, P11 and P12, P13 and P14 carry out PCR amplification, and amplified production is carried out respectively
Agarose gel electrophoresis detects and cuts glue purification.CDNA after purification is connected to pMD-19T carrier with the kit of Tiangeng again
In, connection product is converted to DH5a competent cell, monoclonal is selected, bacterium solution PCR identification is carried out, positive bacteria will be accredited as
Bacterium colony carries out plasmid extraction, send sequencing.
(2) plasmid PCR expands
Single amplification is carried out to the plasmid object containing target fragment respectively with primer described in embodiment 1.
The preparation of upstream primer mixed liquor：P1, P3, P5, P7, P9, P11 and P13 equal proportion are mixed；Downstream primer is mixed
Close the preparation of liquid：P2, P4, P6, P8, P10, P12 and P14 equal proportion are mixed.It is utilized respectively the corresponding plasmid of 7 genes
Template amplification.
Pcr amplification reaction system is as follows：
Wherein the final concentration of upstream and downstream primer is between 0.15-0.3 μM.
The response procedures of amplification are：95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 60 DEG C of annealing 90s, 72 DEG C of extension 30s；
Circulation 35 times；72 DEG C extend 6min eventually.
PCR product carries out agarose gel electrophoresis analysis, and electrophoretogram is as shown in Figure 1.1：aac(6')-Ie-aph(2")-
Ia, 2：Aph (3 ')-IIIa, 3：Ant (4 ')-Ia, 4：Ant (9)-Ia, 5：AadE, 6：Aph (3 ')-Ia, 7：Aph (3 ")-Ib,
8：PCRblank (PCR blank control), M：DL2000DNAmarker.
(3) resulting PCR product and fluorescence-encoded micro-beads working solution, Streptavidin phycoerythrin (SA-PE) are worked
Liquid hybridization, includes the following steps：
Be coated with 7 kinds of microballoons of special anti-tag sequence respectively, wherein anti-tag sequence can correspondingly with aac
(6 ')-Ie-aph (2 ")-Ia, aph (3 ')-IIIa, ant (4 ')-Ia, ant (9)-Ia, aadE, aph (3 ')-Ia and aph
Tag sequence complementary pairing on (3 ")-Ib primer.7 kinds of microballoons are purchased from luminex company, specific aac (6 ')-Ie-aph
(2 ")-Ia, aph (3 ')-IIIa, ant (4 ')-Ia, ant (9)-Ia, aadE, aph (3 ')-Ia and aph (3 ")-Ib are respectively corresponded
Fluorescence-encoded micro-beads number be MTAG-A030, MTAG-A020, MTAG-A028, MTAG-A046, MTAG-A018, MTAG-A015
And MTAG-022.
The preparation of fluorescence-encoded micro-beads working solution：By 2500/μ l fluorescence-encoded micro-beads with 1.1 × Tm
Hybrdization Buffer is diluted to 1 μ l and about contains 125/kind fluorescence-encoded micro-beads.
The preparation of SA-PE working solution：1mg/ml SA-PE is diluted to 10 μ g/ μ with 1 × Tm Hybrdization Buffer
l。
Fluorescence-encoded micro-beads working solution is sufficiently resuspended, 20 μ l of microballoon working solution, sample is added in each sample well and background hole
5 μ l PCR products are added in hole, 5 μ l PCRblank products are added in background hole, add the SA-PE working solution of 75 μ l, sufficiently
It mixes, 42 DEG C of incubation 25min in metal heater.
The 50 above-mentioned reaction solutions of μ l after hybridization are detected according to the explanation of 200 instrument of detector Luminex, as a result
As shown in Figure 2.When 200 instrument of detector Luminex reads MFI value, different types of cause of disease can be obviously offered an explanation.
As a result judgment criteria (note：The judgment criteria is only for reference, can also be adjusted to result judgment criteria) it is as follows：
The determination of lowest detection threshold value (cutoff value)：Choosing the monoclonals of 10 reference cultures, (each sample weighs in parallel
It is 3 times multiple), MFI value is read respectively and calculates its average and standard deviation.With the MIF value of average value plus 3 times of standard deviations set its as
Cutoff value.Obtained aac (6 ')-Ie-aph (2 ")-Ia, aph (3 ')-IIIa, ant (4 ')-Ia, ant (the 9)-Ia of the present invention,
AadE, aph (3 ')-Ia and aph (3 ")-Ib cutoff value is respectively 431.5,534.9,305.6,423.9,258.6,
605.6,531.1, therefore by aac (6 ')-Ie-aph (2 ")-Ia, aph (3 ')-IIIa, ant (4 ')-Ia, ant (9)-of the present invention
The cutoff value of Ia, aadE, aph (3 ')-Ia and aph (3 ")-Ib is set to 450,550,350,450,300,650,550 respectively.
When only the MFI value of test sample is higher than the cutoff value of setting, which just can be carried out effective analysis.
The analytical judgment of sample to be tested：1) when the MFI value > cutoff value of sample to be tested, it is judged as positive sample；2)
When MFI value≤cutoff value of sample to be tested, it is judged as negative, carry out repeating experiment or takes other detection methods into one
Step card.
Embodiment 4：The multiple liquid phase genetic chip analysis detection sensitivity experiments of aminoglycoside resistant gene
The plasmid of preparation is quantified, is diluted using 10 times of dilution methods, is diluted to 101Copies/ μ l, use are above-mentioned
The multiple liquid phase genetic chip analysis method established is detected.The multiple liquid phase genetic chip analysis detection sensitivity experiments knot
Fruit as shown in figure 4, the experimental results showed that, the sensitivity detection limit of ant (4 ')-Ia and aadE are 101Copies/ul, ant
(9) the sensitivity detection of-Ia is limited to 103Copies/ul, the sensitivity of remaining gene are all 102copies/ul。
Embodiment 5：The detection of sample
20 clinical bacteria samples that hospital provides, it is a small amount of to cultivate, it is extracted with Tiangeng bacterial genomes extraction agent box
DNA is expanded using QIAGEN Multiplex PCR Plus Kit, using DNA as template, using above-mentioned aminoglycoside
The multiple liquid phase genetic chip analyzing detecting method of class drug resistant gene is detected, amplified production and fluorescence-encoded micro-beads and SA-
PE hybridization, reads on 200 detector of Luminex.For specific steps referring to embodiment 3, experimental result is as shown in table 1.Meanwhile
By reference to the detection method of the regular-PCR in document, detection, experimental result such as Fig. 3, Fig. 4 are compared to this 20 samples
It is shown the experimental results showed that, the testing result of liquid phase genetic chip method and regular-PCR that the present invention establishes is almost the same.No. 13
Ac (6 ')-Ie-aph (2 ")-I weakly positive, the weakly positive of No. 16 ant (4 ')-Ia and ant (9)-Ia in regular-PCR all
There are missing inspections.In addition, No. 17 sample aadE have doubtful band near 838-bp, but subsequent sequencing shows that the segment is not mesh
Band, it is negative that the method that the present invention establishes also shows No. 17 sample aadE.Comparing result shows, the detection side that the present invention establishes
Method has higher sensitivity and accuracy rate.
Table 1 is multiple liquid phase genetic chip analysis method clinical detection result
A1-A7 is followed successively by aac (6 ')-Ie-aph (2 ")-Ia, aph (3 ')-IIIa, ant (4 ')-Ia, ant (9)-Ia,
AadE, aph (3 ')-Ia and aph (3 ")-Ib；
+++：Strong positive (MFI>5*cutoff)；++：The positive (3*cutoff<MFI<5*cutoff)；
+：Weakly positive (cutoff<MFI<3*cutoff)；-：Feminine gender (MFI<cutoff).
+/-：Liquid-phase chip testing result is weakly positive, and PCR testing result is feminine gender；
-/+：Liquid-phase chip testing result is feminine gender, and PCR testing result is the positive.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
Sequence table
<110>Experimental Animals Supervising Station, Guangdong Prov.
<120>It is a kind of at the same detect the multiple liquid phase genetic chip primers of seven aminoglycosides drug resistant genes, kit and its
Analysis method
<160> 21
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>Bacteria (bacterium)
<400> 1
agagcaataa gggcatacca aa 22
<210> 2
<211> 24
<212> DNA
<213>Bacteria (bacterium)
<400> 2
ccacactatc ataaccacta ccga 24
<210> 3
<211> 19
<212> DNA
<213>Bacteria (bacterium)
<400> 3
agacggaaaa gcccgaaga 19
<210> 4
<211> 21
<212> DNA
<213>Bacteria (bacterium)
<400> 4
gcagaaggca atgtcatacc a 21
<210> 5
<211> 21
<212> DNA
<213>Bacteria (bacterium)
<400> 5
aatcggtaga agcccaaaag t 21
<210> 6
<211> 21
<212> DNA
<213>Bacteria (bacterium)
<400> 6
tggtagaaat gttgtcggtc c 21
<210> 7
<211> 22
<212> DNA
<213>Bacteria (bacterium)
<400> 7
tggttcagca gtaaatggtg gt 22
<210> 8
<211> 22
<212> DNA
<213>Bacteria (bacterium)
<400> 8
attgccaagg gacaacttca ct 22
<210> 9
<211> 22
<212> DNA
<213>Bacteria (bacterium)
<400> 9
agaaactttt gtccacctac cg 22
<210> 10
<211> 18
<212> DNA
<213>Bacteria (bacterium)
<400> 10
aatgaagcct ttccgcca 18
<210> 11
<211> 22
<212> DNA
<213>Bacteria (bacterium)
<400> 11
agccgtttct gtaatgaagg ag 22
<210> 12
<211> 22
<212> DNA
<213>Bacteria (bacterium)
<400> 12
gtgattttga tgacgagcgt aa 22
<210> 13
<211> 20
<212> DNA
<213>Bacteria (bacterium)
<400> 13
gggtccaatc gcagatagaa 20
<210> 14
<211> 20
<212> DNA
<213>Bacteria (bacterium)
<400> 14
gctaacgccg aagagaactg 20
<210> 15
<211> 24
<212> DNA
<213>Bacteria (bacterium)
<400> 15
cttaacattt aacttctata acac 24
<210> 16
<211> 24
<212> DNA
<213>Bacteria (bacterium)
<400> 16
ctttctcata ctttcaacta attt 24
<210> 17
<211> 24
<212> DNA
<213>Bacteria (bacterium)
<400> 17
cacttaattc attctaaatc tatc 24
<210> 18
<211> 24
<212> DNA
<213>Bacteria (bacterium)
<400> 18
ttaaacaatc tactattcaa tcac 24
<210> 19
<211> 24
<212> DNA
<213>Bacteria (bacterium)
<400> 19
acacttatct ttcaattcaa ttac 24
<210> 20
<211> 24
<212> DNA
<213>Bacteria (bacterium)
<400> 20
tacttcttta ctacaattta caac 24
<210> 21
<211> 24
<212> DNA
<213>Bacteria (bacterium)
<400> 21
caaacaaaca ttcaaatatc aatc 24
Claims (10)
1. a kind of multiple liquid phase genetic chip primer for detecting seven aminoglycosides drug resistant genes simultaneously, which is characterized in that institute
The aminoglycosides drug resistant gene stated is：Aac (6 ')-Ie-aph (2 ")-Ia, aph (3 ')-IIIa, ant (4 ')-Ia, ant
(9)-Ia, aadE, aph (3 ')-Ia and aph (3 ")-Ib；
Primer nucleotide sequences described in each aminoglycosides drug resistant gene are as follows：
Aac (6 ')-Ie-aph (2 ")-Ia detection primer：
Primer P1：AGAGCAATAAGGGCATACCAAA(SEQ ID NO：1),
Primer P2：CCACACTATCATAACCACTACCGA(SEQ ID NO：2)；
Aph (3 ')-IIIaa detection primer：
Primer P3：AGACGGAAAAGCCCGAAGA(SEQ ID NO：3),
Primer P4：GCAGAAGGCAATGTCATACCA(SEQ ID NO：4)；
Ant (4 ')-Ia detection primer：
Primer P5：AATCGGTAGAAGCCCAAAAGT(SEQ ID NO：5),
Primer P6：TGGTAGAAATGTTGTCGGTCC(SEQ ID NO：6)；
Ant (9)-Ia detection primer：
Primer P7：TGGTTCAGCAGTAAATGGTGGT(SEQ ID NO：7),
Primer P8：ATTGCCAAGGGACAACTTCACT(SEQ ID NO：8)；
AadE detection primer：
Primer P9：AGAAACTTTTGTCCACCTACCG(SEQ ID NO：9),
Primer P10：AATGAAGCCTTTCCGCCA(SEQ ID NO：10)；
Aph (3 ')-Ia detection primer：
Primer P11：AGCCGTTTCTGTAATGAAGGAG(SEQ ID NO：11),
Primer P12：GTGATTTTGATGACGAGCGTAA(SEQ ID NO：12)；
Aph (3 ")-Ib detection primer：
Primer P13：GGGTCCAATCGCAGATAGAA(SEQ ID NO：13),
Primer P14：GCTAACGCCGAAGAGAACTG(SEQ ID NO：14).
2. multiple liquid phase genetic chip that is according to claim 1 while detecting seven aminoglycosides drug resistant genes is drawn
Object, which is characterized in that
5 ' ends of the primer P1 and P2 wherein primer are biotinylated；
5 ' ends of the primer P3 and P4 wherein primer are biotinylated；
5 ' ends of the primer P5 and P6 wherein primer are biotinylated；
5 ' ends of the primer P7 and P8 wherein primer are biotinylated；
5 ' ends of the primer P9 and P10 wherein primer are biotinylated；
5 ' ends of the primer P11 and P12 wherein primer are biotinylated；
5 ' ends of the primer P13 and P14 wherein primer are biotinylated.
3. according to benefit require 1 it is described while detect seven aminoglycosides drug resistant genes multiple liquid phase genetic chip primer,
It is characterized in that, in the primer P1 and P2, P3 and P4, P5 and P6, P7 and P8, P9 and P10, P11 and P12, P13 and P14 not
5 ' ends of the primer being biotinylated are connected with tag sequence, and the tag sequence can be with the anti-that has in fluorescence-encoded micro-beads
Tag sequence complementary pairing.
4. multiple liquid phase genetic chip that is according to claim 3 while detecting seven aminoglycosides drug resistant genes is drawn
Object, which is characterized in that the primer P1 and P2, P3 and P4, P5 and P6, P7 and P8, P9 and P10, P11 and P12, P13 and P14 this
The tag sequence connected in 7 groups of primer pairs is selected from SEQ ID NO：Tag sequence shown in 15~21, and connected in 7 groups of primer pairs
Tag sequence it is different.
5. a kind of multiple liquid phase genetic chip kit for detecting seven aminoglycosides drug resistant genes simultaneously, which is characterized in that
Contain any primer of Claims 1 to 4 in the kit.
6. multiple liquid phase genetic chip reagent that is according to claim 5 while detecting seven aminoglycosides drug resistant genes
Box, which is characterized in that also encode the glimmering of different iridescent containing streptavidin-phycoerythrin compound, 7 kinds in the kit
Pumped FIR laser microballoon.
7. multiple liquid phase genetic chip reagent that is according to claim 5 while detecting seven aminoglycosides drug resistant genes
Box, which is characterized in that also contain the anti-tag sequence with tag sequence complementary pairing in primer in the fluorescence-encoded micro-beads,
It is different to encode the anti-tag sequence contained in the fluorescence-encoded micro-beads of different iridescent.
8. a kind of multiple liquid phase genetic chip analysis method for detecting seven aminoglycosides drug resistant genes simultaneously, feature exist
In including the following steps：
1) genome is extracted from bacterium；
2) using the bacterial genomes of extraction as template, PCR amplification is carried out with any primer of Claims 1 to 4；
3) upper step amplified production, the fluorescence-encoded micro-beads of the different iridescent of 7 kinds of codings, streptavidin-phycoerythrin are carried out
Hybridization；
4) after hybridizing, hybrid product is tested and analyzed by Luminex system, determines the type of its virus；
The above method is used for the diagnosing and treating of non-disease.
9. multiple liquid phase genetic chip point that is according to claim 8 while detecting seven aminoglycosides drug resistant genes
Analysis method, it is characterised in that：The reaction system of PCR amplification is in step 2)：
The response procedures of PCR amplification are in step 2)：95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 60 DEG C of annealing 90s, 72 DEG C are prolonged
Stretch 30s；Circulation 35 times；68 DEG C extend 7min eventually.
10. multiple liquid phase genetic chip that is according to claim 8 while detecting seven aminoglycosides drug resistant genes
Analysis method, it is characterised in that：The reaction system and program of hybridization described in step 3) be：
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810814819.XA CN108913768B (en) | 2018-07-23 | 2018-07-23 | Multiplex liquid phase gene chip primer, kit and analysis method for simultaneously detecting seven glucosamine drug resistance genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810814819.XA CN108913768B (en) | 2018-07-23 | 2018-07-23 | Multiplex liquid phase gene chip primer, kit and analysis method for simultaneously detecting seven glucosamine drug resistance genes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108913768A true CN108913768A (en) | 2018-11-30 |
| CN108913768B CN108913768B (en) | 2021-10-22 |
Family
ID=64416965
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810814819.XA Active CN108913768B (en) | 2018-07-23 | 2018-07-23 | Multiplex liquid phase gene chip primer, kit and analysis method for simultaneously detecting seven glucosamine drug resistance genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108913768B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109762917A (en) * | 2019-03-28 | 2019-05-17 | 广东省实验动物监测所 | Multiple liquid phase genetic chip primer, kit and its analysis method a kind of while that detect 5 Sulfonamides-resistant genes |
| CN112322790A (en) * | 2020-11-26 | 2021-02-05 | 广州医科大学 | Primer combination, plasmid and detection kit for simultaneously detecting 9 respiratory viruses |
| CN113151517A (en) * | 2021-04-07 | 2021-07-23 | 安徽师范大学 | Aminoglycoside antibiotic resistance gene detection primer and kit |
| CN117987578A (en) * | 2024-04-03 | 2024-05-07 | 北京市动物疫病预防控制中心 | Microfluidic chip for simultaneously detecting pathogenic escherichia coli, salmonella and drug resistance genes and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1669077A1 (en) * | 2003-09-18 | 2006-06-14 | Third Military Medical University Chinese People's Liberation Army P.R. of China | Antibacterial compositions of n-acetyl-d-aminoglycosamine and antibiotics |
| CN106191311A (en) * | 2016-07-19 | 2016-12-07 | 广东省实验动物监测所 | A kind of quick detection Cavia porcellus LCMV, SV, PVM, Reo 3 virus multiple liquid phase method for gene chip and reagent |
| CN107312873A (en) * | 2017-06-28 | 2017-11-03 | 广东省实验动物监测所 | A kind of multiple liquid phase genetic chip detection primer, kit and method of 5 kinds of Respiratory Tract of Mice cause of diseases of quick differentiation |
-
2018
- 2018-07-23 CN CN201810814819.XA patent/CN108913768B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1669077A1 (en) * | 2003-09-18 | 2006-06-14 | Third Military Medical University Chinese People's Liberation Army P.R. of China | Antibacterial compositions of n-acetyl-d-aminoglycosamine and antibiotics |
| CN106191311A (en) * | 2016-07-19 | 2016-12-07 | 广东省实验动物监测所 | A kind of quick detection Cavia porcellus LCMV, SV, PVM, Reo 3 virus multiple liquid phase method for gene chip and reagent |
| CN107312873A (en) * | 2017-06-28 | 2017-11-03 | 广东省实验动物监测所 | A kind of multiple liquid phase genetic chip detection primer, kit and method of 5 kinds of Respiratory Tract of Mice cause of diseases of quick differentiation |
Non-Patent Citations (2)
| Title |
|---|
| RAMIREZ,M. ET AL: "Aminoglycoside modifying enzymes", 《DRUG RESISTANCE UPDATES》 * |
| VAKULENKO,S.B. ET AL: "Multiplex PCR for Detection of Aminoglycoside Resistance Genes in Enterococci", 《ANTIMICROBIAL AGENTS AND CHEMOTHERAPY》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109762917A (en) * | 2019-03-28 | 2019-05-17 | 广东省实验动物监测所 | Multiple liquid phase genetic chip primer, kit and its analysis method a kind of while that detect 5 Sulfonamides-resistant genes |
| CN112322790A (en) * | 2020-11-26 | 2021-02-05 | 广州医科大学 | Primer combination, plasmid and detection kit for simultaneously detecting 9 respiratory viruses |
| CN113151517A (en) * | 2021-04-07 | 2021-07-23 | 安徽师范大学 | Aminoglycoside antibiotic resistance gene detection primer and kit |
| CN113151517B (en) * | 2021-04-07 | 2022-07-26 | 安徽师范大学 | Aminoglycoside antibiotic resistance gene detection primer and kit |
| CN117987578A (en) * | 2024-04-03 | 2024-05-07 | 北京市动物疫病预防控制中心 | Microfluidic chip for simultaneously detecting pathogenic escherichia coli, salmonella and drug resistance genes and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108913768B (en) | 2021-10-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5317430B2 (en) | Probe set, probe carrier, and fungal discrimination identification method | |
| Boughner et al. | Microbial ecology: where are we now? | |
| CN1978669A (en) | Probe set, probe immobilized carrier and gene examination method | |
| CN108753954B (en) | Capture probe set of dementia-related gene, kit, library construction method and application | |
| CN108913768A (en) | Multiple liquid phase genetic chip primer, kit and its analysis method a kind of while that detect seven aminoglycosides drug resistant genes | |
| CN106191311B (en) | A kind of multiple liquid phase genetic chip method and reagent of quick detection cavy LCMV, SV, PVM, Reo-3 virus | |
| CN110004225B (en) | Tumor chemotherapeutic drug individualized gene detection kit, primers and method | |
| CN113817850A (en) | Mycobacterium tuberculosis drug-resistant gene detection primer composition and application thereof | |
| CN108138228A (en) | High-molecular-weight DNA sample for next generation's sequencing tracks label | |
| CN108138244A (en) | Virus group capture microarray dataset, design and construction method and application method | |
| CN108823325B (en) | Application of riemerella anatipestifer Imp gene, PCR detection kit and method thereof | |
| CN104988144A (en) | Gene liquid chip for detecting 10 kinds of common pathogenic microorganisms in soil and detection method of gene liquid chip | |
| CN101570784A (en) | Signal combination coding-based DNA ligation sequencing method | |
| CN107326098B (en) | Multiplex fluorescence immunoassay method and reagent for rapidly distinguishing rabbit plague virus, sendai virus and rabbit rotavirus | |
| CN109762917A (en) | Multiple liquid phase genetic chip primer, kit and its analysis method a kind of while that detect 5 Sulfonamides-resistant genes | |
| CN105296466A (en) | Single cell whole genome amplification method | |
| CN112501322A (en) | Saliva microbial marker and application thereof in drug detection | |
| CN108384782B (en) | Kit and kit for detecting pathogens causing bloodstream infections | |
| CN110423835A (en) | Primer composition for lower respiratory tract the pathogenic microorganism examination | |
| CN116144811A (en) | Multiplex primer set, method and kit for detecting cerebrospinal fluid pathogen | |
| Lamb et al. | Skim-Nanopore sequencing for routine genomic evaluation and bacterial pathogen detection in cattle | |
| Ricke et al. | Application of molecular methods for traceability of foodborne pathogens in food safety systems | |
| CN109266723A (en) | Rare mutation detection method, its kit and application | |
| CN112458202B (en) | PCR detection primer and kit for riemerella anatipestifer virulent phage | |
| KR101247972B1 (en) | PNA microarray for differential diagnosis of aerobic gram-negative food poisoning bacteria and the method for differential diagnosis using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |