CN105296466A - Single cell whole genome amplification method - Google Patents

Abstract

The invention discloses a single cell whole genome amplification method, comprising following steps: (1), performing separating to obtain single cell samples; (2), subjecting the single cell samples to whole genome DNA amplification; (3), subjecting an amplification product to quantitative and qualitative analysis; (4), establishing a genome sequencing library, performing sequencing, and performing genome bioinformatic analysis. The single cell genome DNA amplification method is built and can be used to detect the single, tertiary, multiple and sex chromosome deficiency of a whole chromosome, the insertion and deficiency of few bases, DNA copy number variation, and the genetic variation information of single cell genomes such as single nucleotide polymorphisms.

Description

A kind of unicellular whole genome amplification method

Technical field

The present invention relates to a kind of based on non-exponential amplification and the single-cell genome analysis method of high-flux sequence, on individual cell level, genome is analyzed by the method.

Background technology

Along with the development of genomics research, increasing investigator starts the gene studies being no longer confined to many cells level, but sight is focused on the level of individual cells more specifically.Unicellular is the elementary cell of multicellular organism, and the growth of multicellular organism, from unicellular, is constantly divided in strict Time and place sequence, but such complex process just can only get a real idea of at individual cell level.In addition, in multicellular organisms, each cell is in unique microenvironment, and do not have in two duplicate cells, particularly tumor tissues, the existence of height heterogeneity makes to carry out research from single celled angle becomes necessary.On the other hand, some sample rareness cannot in laboratory culture, and sample size is not enough to carry out Whole genome analysis, such as the embryonic cell etc. of neoplasm circulating cells, micro-array tissue, early development.

In a very long time, the acquisition of unicellular sample and the finiteness of nucleic acid content make unicellular genome analysis become a difficult problem.And in recent years, the appearance of fluidic cell sorting and laser capture microdissection technology and updating of unicellular whole genome amplification technology, allow single celled in a large number to catch and detection becomes possibility.Unicellular sequencing technologies becomes the clinical tool of guidance from experiment research just gradually, also develops a lot of clinical applications gradually.

In conjunction with unicellular sorting technology, by whole genome amplification technology and High throughput, single celled Whole genome analysis becomes possibility, and the example of more existing application.Whole genome amplification technology can be carried out amplification to very micro-DNA and be obtained a large amount of DNA, therefore be considered to a kind of basic skills solving this difficult problem at present, be widely used in the area researches such as medical jurisprudence, the diagnosis of single gene inheritance disease and the analysis of disease gene, and achieve good effect.But this technology also having some limitations property simultaneously, because the initial action product of whole genome amplification is few, even only has a DNA molecular, just inhomogenous problem is there is unavoidably like this when amplified reaction, namely can may increase repeatedly in some site in genome, then cannot increase in other site, interpretation of result may be made like this to produce deviation.Therefore a lot of scientific research institution is also being devoted to updating of whole genome amplification technology, more existing amplification techniques are mainly based on multiplex PCR and isothermal strand displacement technology at present, as DOP-PCR, MDA etc., but still there is the problem that amplification deviation is large, amplified production amount is low.The present invention establishes a kind of novel unicellular amplification method based on ring-type cyclic amplification technology, and construct a set of unicellular order-checking flow process based on the method, this amplification technique is verified through high-flux sequence, the repeatability of its data, homogeneity and coverage are all better than conventional art, can reach 90% through its coverage of sequencing data compare of analysis.

Summary of the invention

For solving the problems of the technologies described above, the invention provides a kind of unicellular full genome amplification technique, and being analyzed its comparison rate, homogeneity, coverage etc. by high-flux sequence, compared with traditional amplification technique, its repeatability, uniformity all increase.Concrete summary of the invention is as follows:

1, the separation of unicellular sample

Carry out the separation of unicellular sample by technology such as micrurgy, flow cytometer, laser microprobe dating, can be used for the cellular segregation of the common clinical samples such as embryonic cell, blood circulation cell, tissue slice;

2, amplimer design

Design the random pre-amplimer that two terminal sequences are identical, make fragment two ends to be connected to ring, avoid the skewed popularity amplification in some region.Pre-amplification primer sequence is as follows:

multiprimer(F)：AGGTAGAGTGGTAGTAGGTGTAAGGAGNNNNNGGG

multiprimer(R)：AGGTAGAGTGGTAGTAGGTGTAAGGAGNNNNNTTT

Wherein NNNNN represents the stochastic sequence of 5 bases;

Amplimer sequence is: AGGTAGAGTGGTAGTAGGTGTAAGGAG;

3, unicellular genome amplification

(1) unicellular cracking:

Get isolated unicellular sample, add the QiagenDLB solution that 1.5 μ l contain 1MDTT, 65 DEG C of reaction 10min; Add the stopsolution of 1.5, now reaction system is 5 μ l;

(2) unicellular pre-amplification experiment:

A, in unicellular split product, access the MIX of the pre-amplification of 25 μ l, 94 DEG C of reaction 3min, reaction terminates, and is placed on immediately on ice; The reaction system of MIX is as following table 1:

Table 1

Component	Volume
		H2O	18μl
10×ThermoPol buffer	3μl
		10mM dNTP	1μl
50mM MgSO4	1μl
		multi primer(F)	1μl
multi primer(R)	1μl

B, add the Bstlargefragment of 1 μ l on ice, the PyroPhage3173DNAPolymeraseexo-of 1 μ l, reaction conditions is: 10 DEG C of for45sec; 20 DEG C of for45sec; 30 DEG C of for45sec; 40 DEG C of for45sec; 50 DEG C of for45sec; 65 DEG C of for2min; 94 DEG C of for20sec; Reaction terminates to be placed on termination reaction on ice immediately;

C, add the Bstlargefragment of 1 μ l on ice, the PyroPhage3173DNAPolymeraseexo-of 1 μ l, reaction conditions is: 10 DEG C of for45sec; 20 DEG C of for45sec; 30 DEG C of for45sec; 40 DEG C of for45sec; 50 DEG C of for45sec; 65 DEG C of for2min; 94 DEG C of for20sec; 58 DEG C of for20sec; Reaction terminates to be placed on termination reaction on ice immediately, this step cyclical operation 5 times;

(3) amplified reaction

Pre-amplified production is divided into two parts, and now pre-amplified production has 44 μ l, and pre-amplified production is divided into two parts, each 22 μ l, every part adds volume as table 2:

Table 2

Component	Volume
		10×ThermoPol buffer	5μl
10mM dNTP	1μl
		50mM MgSO4	3.35μl
Deep Vent Enzyme	4.2μl
		primer 3(10uM)	5μl
H2O	9.45μl

Reaction conditions is: 94 DEG C of for20sec; 59 DEG C of for20sec; 65 DEG C of for1min; 72 DEG C of for2min, totally 17 circulations;

4, high-flux sequence analysis

Carry out high-throughput library construction and order-checking with whole genome amplification sample, sequencing result with compare with reference to genome, the comparison rate of analytical sequence, repeatability, uniformity and coverage etc.

Pass through technique scheme, the present invention establishes a kind of novel unicellular amplification method based on ring-type cyclic amplification technology, and construct a set of unicellular order-checking flow process based on the method, this amplification technique is verified through high-flux sequence, the repeatability of its data, homogeneity and coverage are all better than conventional art, can reach 90% through its coverage of sequencing data compare of analysis.

Accompanying drawing explanation

In order to be illustrated more clearly in the technical scheme in the embodiment of the present invention, below the accompanying drawing used required in describing embodiment is briefly described.

Fig. 1 is unicellular amplified production agarose gel electrophoresis figure in the embodiment of the present invention;

Fig. 2 is 13 heterotrimeric cell detected result figure in the embodiment of the present invention;

Fig. 3 is the analysis chart of sample amplification homogeneity in the embodiment of the present invention.

Embodiment

Below in conjunction with the accompanying drawing in the embodiment of the present invention, the technical scheme in the embodiment of the present invention is clearly and completely described.

Embodiment 1:

The separation of unicellular sample

Adopt positive cell line and the normal cell system of the chromosome abnormalty of cultivating, select individual cells respectively to verify experiment flow, cell type is as shown in table 3, with micrurgy, individual cells is separated, draw individual cells with mouth suction pipe and wash 3 times in 1 × PBS solution, then be transferred in the PCR pipe of 0.2mL, volume is no more than 2 μ l.

Table 3

Cell is numbered	Cell type	Output after amplification	Amplification efficiency
				1	T13	1.01μg	1.68*10e5
2	T13	1.15μg	1.92*10e5
				3	T13	1.21μg	2.02*10e5
4	4.9M micro-deleted	1.09μg	1.82*10e5
				5	4.9M micro-deleted	1.34μg	2.23*10e5
6	4.9M micro-deleted	1.24μg	2.07*10e5
				7	Normally	0.89μg	1.48*10e5
8	Normally	1.15μg	1.92*10e5

Embodiment 2:

Unicellular amplification experiment

According to amplification flow process unicellular described in summary of the invention, whole genome amplification is carried out to isolated unicellular sample; With 1.5 × AmpureXP magnetic bead purifying is carried out to amplified production; Detect amplified production concentration with Qubit after purifying, result is as shown in the table 3 in embodiment 1, and amplified production concentration is homogeneous, reproducible; The analysing amplified fragment length of agarose gel electrophoresis with 2%, result as shown in Figure 1.

Embodiment 3:

Amplified production fragmentation

Carry out fragmentation with the fragmentation cleavage reagent box of NEB to the product after purifying, fragmentation length is 150-200bp, 37 DEG C of process 20min, and enzyme cuts system as following table 4:

Table 4

Component	Reaction volume (μ L)
		DNA sample after purifying	X(300ng)
Fragmentation buffer	2
		Water	16-X
Fragmentation enzyme	2
		Reaction system total amount	20

Digestion products with 1.8 × AmpureXP magnetic bead carry out purifying.

Embodiment 4:

The order-checking of library construction, upper machine and sequencing result analysis

DNA after purifying adopts the IonXpressPlusFragmentLibraryKit test kit of Life to carry out library construction, the library Qubit2.0 photofluorometer detectable level built, Aglient2100 analytic plate segment length, according to concentration and fragment length conversion molecule number, emulsion-based PCR is carried out after dilution, then go up machine order-checking, the raw data of 6M about surveyed by each sample; Wherein the unicellular sample order-checking degree of depth of normal karyotype be 20 ×, for homogeneity and the coverage of analysis list cell amplification;

Compared with reference to genome by order-checking the data obtained, Yangxin clone all detects corresponding caryogram, and wherein 3 of T13 sample unicellular pattern detection results and gene order-checking result are as shown in Figure 2;

The unicellular sample sequencing result of normal karyotype is analyzed, karyomit(e) coverage >=1 × region account for 90%, homogeneity is on chromosome as shown in Figure 3.

To the above-mentioned explanation of the disclosed embodiments, professional and technical personnel in the field are realized or uses the present invention.To be apparent for those skilled in the art to the multiple amendment of above-described embodiment, General Principle as defined herein can without departing from the spirit or scope of the present invention, realize in other embodiments.Therefore, the present invention can not be restricted to these embodiments shown in this article, but will meet the widest scope consistent with principle disclosed herein and features of novelty.

Claims (5)

1. a unicellular whole genome amplification method, is characterized in that, comprise the steps:

(1) separation of unicellular sample;

(2) amplimer design: design the identical random pre-amplimer of two terminal sequences and amplimer, make fragment two ends to be connected to ring, avoid the skewed popularity amplification in some region;

(3) unicellular genome amplification:

1. unicellular cracking: the unicellular sample obtained based on step (1) carries out cracking;

2. unicellular pre-amplification: the pre-amplimer adding design in step (2) in the product after unicellular sample cracking in 1. increases in advance;

3. amplified reaction: the amplimer then adding design in step (2) in amplified production pre-in 2. carries out amplified reaction;

(4) high-flux sequence analysis: carry out high-throughput library construction and order-checking based on the whole genome amplification sample after the amplification in step (3), and sequencing result is compared with reference to genome.

2. the unicellular whole genome amplification method of one according to claim 1, is characterized in that, the pre-amplification primer sequence in step (2) is as follows:

multiprimer(F)：AGGTAGAGTGGTAGTAGGTGTAAGGAGNNNNNGGG

multiprimer(R)：AGGTAGAGTGGTAGTAGGTGTAAGGAGNNNNNTTT

Wherein NNNNN represents the stochastic sequence of 5 bases.

3. the unicellular whole genome amplification method of one according to claim 1 and 2, is characterized in that, the amplimer sequence in step (2) is:

AGGTAGAGTGGTAGTAGGTGTAAGGAG。

4. the unicellular whole genome amplification method of one according to claim 3, is characterized in that, in step (3), during unicellular pre-amplification, in unicellular split product in 1., access quantitative pre-amplimer, reacting by heating, reaction terminates, freezing; Then carry out temperature increment staircase response, reaction terminates freezing termination reaction; Carry out temperature increment staircase response again, and repeat this temperature increment staircase response circulating reaction after freezing termination reaction repeatedly.

5. the unicellular whole genome amplification method of one according to claim 4, it is characterized in that, in step (3), during amplified reaction, to pre-amplified production 2. and be divided into two parts, every part is all carried out repeatedly circulating reaction under differing temps gradient, until obtain the destination number needed namely stop amplified reaction.