CN115807058B

CN115807058B - Low-bias single sperm whole genome amplification method

Info

Publication number: CN115807058B
Application number: CN202211540393.6A
Authority: CN
Inventors: 汪洋; 韩笑; 李志�; 周莉; 桂建芳
Original assignee: Institute of Hydrobiology of CAS
Current assignee: Institute of Hydrobiology of CAS
Priority date: 2022-12-02
Filing date: 2022-12-02
Publication date: 2023-06-30
Anticipated expiration: 2042-12-02
Also published as: CN115807058A

Abstract

The invention belongs to the field of reproductive genetics, and relates to a low-bias single sperm whole genome amplification method. The application utilizes the characteristic of rapid synchronous DNA replication of cell cleavage at the early development stage of the heterohybrid gamete, simultaneously selects embryo at the end of division by monitoring the progress of a cell cycle, and finally completes complete and efficient low-bias single sperm genome amplification by combining with other conventional in-vitro whole genome amplification methods. Compared with the traditional method, the amplification product obtained by the method has high genome coverage (> 92%), extremely high consistency and reliability, and also enables single sperm analysis of complex species.

Description

Low-bias single sperm whole genome amplification method

Technical Field

The invention belongs to the field of reproductive genetics, and relates to a low-bias single sperm whole genome amplification method.

Background

Single sperm genome sequencing is a technology for sequencing the whole genome of sperm at a single cell level with high throughput, and is an important means for researching spermatogenesis, chromosome recombination rules, accurate molecular breeding and reproduction genetic related disease diagnosis. 1. The experimental operation technical requirements for single sperm separation are high: manual micromanipulation picking or flow cytometer sorting is easy to cause multicellular or cell damage and other problems. 2. Since only trace amounts of DNA are contained in each sperm (pg grade), pre-amplification of the whole genome is critical for single cell sequencing. However, the methods currently in common use include degenerate oligonucleotide primer PCR (DOP-PCR) based PCR amplification, multiple displacement amplification reaction (MDA) based isothermal amplification, primer enzyme whole genome expansion (pWGA), multiple annealing circular amplification technique (MALDBAC) combining isothermal and PCR amplification, and the like. Because these methods are all exponential amplifications, they tend to suffer from bias, non-uniformity, inaccuracy, low coverage, etc. Although the recent linear amplification method (LIANTI) based on transposase insertion is greatly superior to the previous exponential amplification method, there are still many limitations such as complex experimental operation, low reproducibility, inability to distinguish alleles, etc. More importantly, at present, the methods are fundamentally easy to cause exogenous DNA pollution, and extremely high experimental conditions and operation requirements are required.

Disclosure of Invention

The invention aims to provide a low-bias single sperm whole genome amplification method for realizing high-throughput sequencing analysis of a single sperm genome. The method is simple to operate, breaks through the thinking way of traditional amplification, and obtains good amplification sequencing effect.

In order to achieve the above object, the present invention adopts the following technical measures:

the DNA in the single sperm is trace, and meanwhile, the DNA is amplified in a large scale, so that the problems of bias, heterogeneity, error occurrence, exogenous pollution and the like are caused, the applicant considers that the DNA replication of a natural organism has the characteristics of extremely high fidelity and integrity, and finally obtains the whole genome of the single sperm by sequencing by means of the hybridization method and the way of replicating the genome of the sperm to be detected in vivo by means of embryo development early cleavage.

A low bias single sperm whole genome amplification method comprising: after DNA in a single sperm of a species to be detected is artificially marked, the sperm is hybridized with ova of different species, 512 cells or embryos before the cells are selected after hybridization, when the cells synchronously enter into the middle or end stage of mitosis, DNA sampling is carried out, sequencing is carried out, and the whole genome sequence of the single sperm is compared with the whole genome sequence of the species to be detected, so that the whole genome sequence of the single sperm can be obtained.

In the above method, preferably, the species to be detected is crucian, and the ovum providing species is zebra fish;

in the above method, preferably, the artificial labeling means is to artificially label the DNA by injecting h2a-gfp mRNA synthesized in vitro into a single sperm.

Compared with the prior art, the invention has the following advantages and effects:

1. according to the method, the embryo (1000 cells begin to be subjected to asynchronous replication) before 512 cells is selected, all cells synchronously enter the middle or end of mitosis (DNA replication is completed at the moment) at the same time, and subsequent in-vitro amplification is carried out.

2. Does not cause multicellular mixing and almost completely avoids exogenous genome pollution.

3. If sperm of the species to be detected is aneuploid or contains complex genome, the method can utilize genome of ovum to carry out quality inspection on the amplified product of whole genome.

Drawings

FIG. 1 shows the state of a staining monomer when the cells are in the middle or late stages of mitosis.

FIG. 2 is a quality inspection of genomic DNA amplification results of Carassius auratus and Carassius auratus;

wherein: drxCa represents the hybrid embryo of the color crucian carp and the zebra fish, and DrxCg represents the hybrid embryo of the silver crucian carp and the zebra fish.

FIG. 3 is a morphological comparison of different stages of development of hybrid embryos and selfed embryos.

FIG. 4 shows the measurement of cellular DNA content of embryos at different mitosis stages by flow cytometry.

Detailed Description

The following describes the technical scheme of the present invention in more detail with reference to examples: the technical scheme of the invention is a conventional scheme in the field unless specifically stated; the reagents or materials, unless otherwise specified, are commercially available. The invention is described by taking the hybridization of crucian and zebra fish as an example, other species can also carry out sperm-egg hybridization to obtain whole genome information of single sperm.

Example 1:

sequencing of a single sperm genome of a crucian, comprising the steps of:

the crucian carp used in the embodiment is tetraploid color crucian carp and hexaploid silver crucian carp

1. Synthetic DNA markers

By MAXIscript ^TM KIT (Thermo Fisher) human H2a-gfp mRNA was synthesized and quantified using.

2. Hybrid embryo DNA markers

Artificial extruded mature zebra fish eggs and color crucian carp/silver carp semen were inseminated in plastic petri dishes, which were immediately placed in 26 degree celsius incubator for cultivation under microscope with a glass microinjection needle with very fine tip (0.1 to 0.5 μm) injecting approximately 2nl h2a-GFP mRNA (100 ng/ul) into the animal pole of fertilized eggs.

3. Cell selection

Embryos were observed under a fluorescence microscope, when the hybrid embryos developed to 256 cell stages (about 2.5 hours) and all cells were in the metaphase or later stage of mitosis (fig. 1, two sister chromatids were aligned in cells or started to separate), immediately the egg shells and yolk were removed with syringe needles, the remaining animal pole cells were blown into 1 microliter phosphate-balanced saline (PBS) solution with a 10 microliter gun head, snap frozen in liquid nitrogen, and the samples were stored at-80 ℃.

MDA amplification

The whole genome multiple displacement amplification (multiple displacement amplification, MDA) was performed on the samples taken using a single cell whole genome amplification kit (REPLI-g Single Cell Kit, qiagen) to obtain amplification products.

5. Amplification quality detection

A single copy gene of zebra fish is randomly selected as a molecular marker, and specific primers (F: AACTGGGCTAAAGGTCATTACACGG and R TCAGACAGGTGGTGACGCCGCTCAT) are designed. A semi-quantitative PCR with a cycle number of 27 was performed by diluting the whole genome amplification product 50-fold as a DNA template (this method can compare the level of gene expression according to the intensity of the electrophoresis band). The PCR products were detected by agarose gel electrophoresis, as shown in FIG. 2, 5 hybridization samples of randomly selected color crucian carp each had very good amplification effect.

The single copy gene molecular marker of zebra fish is a conventional scheme in the field, and the other single copy gene molecular markers can also complete the DNA quality detection of the invention.

6. Sequencing

And randomly sending 20 color crucian sperms and 20 silver crucian sperms hybridization embryo amplification samples to carry out DNBSEQ T7 platform PE-150 sequencing, and simultaneously randomly sending 5 color crucian single sperms and 20 silver crucian single sperm samples amplified by the traditional MDA method to serve as sequencing control.

After the data are filtered, the reads obtained are compared with each reference genome (zebra fish+color crucian carp/silver crucian carp) by BWA-mem (V0.7.17), and the generated bam files are processed by SMAtools (V1.9), and finally, the coverage and depth of single sperm samples at the genome level are counted by Bamdeal (V0.25).

8. Results

Color crucian carp:

since color crucian carp is an ampholytic species, the genome of sperm is half of somatic cells, and is euploid. The average reads ratio of the samples using this method was 93.1% with an average coverage of 92.7%, whereas the average reads ratio of the conventional method was 73.8% with an average coverage of 50.2%. Moreover, the coverage of each sample of the method (Hy-MDA) provided by the invention is very close to that of the method, so that the method has extremely high consistency, and the samples of the traditional method have extremely large fluctuation (shown in the table below), and even two samples have bacterial contamination (ca 2 and ca 4).

Crucian carp:

the carassius auratus is a parthenogenesis species, the sperms of the carassius auratus should be aneuploidy, and the genome content and the composition of the sperms have great difference, so that the quality of amplification directly determines the correctness of the result because the quality of the amplification cannot be checked by pre-quality (PCR). As shown in the following table, compared with the traditional method, the novel method has stable and reliable result (coverage of 64.3% -94.6), can correctly reflect the chromosome composition therein, and enables the analysis of aneuploidy sperms.

Example 2:

selection of an analytical control for two key time points of hybrid cells

1. Results after 1000 cells were selected

The phenotypic characteristics of the embryo were followed and observed, and the hybrid embryo developed until the original intestine began to appear abnormal, and a significant number of deformities were produced by the somite stage (1 day) as shown in FIG. 3. Meanwhile, the same sequencing analysis is carried out on the hybridization embryos of 3 gastrulations (8 hours), and the results are shown in the following table. It can be seen that the genome coverage of the carassius auratus was reduced, so that to ensure the synchronicity and integrity of the cell cycle we selected 512 cells and their previous hybrid embryonic cells.

2. Rather than selecting the results of DNA extraction and sequencing by cells in the middle and late stages of chromosome replication

To ensure the synchronicity and integrity of DNA replication, we first examined the DNA content of embryonic cells at different cell division stages. As shown in FIG. 4, the DNA content distribution of the embryonic cells at the replication stage was not concentrated and the uniformity was poor, relative to the embryos at the mid/end stage. At the same time, the embryo in the replication stage was also subjected to sequencing analysis, and the results are shown in the following table. It can be seen that the coverage of the genomes of zebra fish and carassius auratus is reduced. It is therefore necessary to choose the middle or end stage.

Claims

1. A low bias single sperm whole genome amplification method comprising: after DNA in single sperm of crucian is artificially marked, the sperm is hybridized with ovum of zebra fish, 512 cells or embryo before the sperm are selected after hybridization, DNA sampling and sequencing are carried out when the cells synchronously enter into middle or end stage of mitosis, and the whole genome sequence of the single sperm can be obtained by comparing with the whole genome sequence of the species to be detected.

2. The method of claim 1, wherein the artificial labeling is performed by injecting h2a-gfp mRNA synthesized in vitro into a single sperm.