CN104988238B - A kind of molecule labelling method and its molecular labeling primer indicated and identify sheep superfecundation character - Google Patents
A kind of molecule labelling method and its molecular labeling primer indicated and identify sheep superfecundation character Download PDFInfo
- Publication number
- CN104988238B CN104988238B CN201510446375.5A CN201510446375A CN104988238B CN 104988238 B CN104988238 B CN 104988238B CN 201510446375 A CN201510446375 A CN 201510446375A CN 104988238 B CN104988238 B CN 104988238B
- Authority
- CN
- China
- Prior art keywords
- sheep
- superfecundation
- genotype
- character
- types
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of molecule labelling method and its molecular labeling primer indicated and identify sheep superfecundation character, it discloses a kind of molecule labelling method.The present invention is the C using 5 ＇ control regions c. 365 of sheep FSHR genes>T mutation (C 365T) mutational site design, molecular labeling primer is FSHRPF and FSHRPR.Method is：First, section is regulated and controled with 5 ＇ of primer amplification sheep FSHR genes；2nd, digestion detection is carried out to C 365T mutational sites in pcr amplified fragment using Sau3AI；3rd, genotype judgement is carried out；4th, construction linear model is associated analysis；BB genotype donors have the number of eggs ovulated of higher in super ovulation procedures, possess the superfecundation efficiency of higher.The present invention is easy to operate, and testing cost is low, and accuracy is high, is suitable for automatic detection.The present invention utilizes the genotype information of 5 ＇ of FSHR genes regulation and control sections and the relevance of sheep superfecundation character.
Description
Technical field
The invention belongs to animal gene engineering technology field, and in particular to one kind indicates and identify sheep using molecular labeling
The method of superfecundation character.
Background technology
Superfecundation (Multiple Ovulation, MO) technology is the biology that have developed rapidly in the world in the past 30 years
New and high technology, in animal husbandry developed country, the super ovulation techniques of sheep have just been phased out into from laboratory from last century end should
Use the stage.The application of technique makes people break away from the past to the reproductive study of jenny and the limitation of application, starts to dig
Pick and the genetic potential using excellent dam, can be obtained using this technology in the relatively short time from an ewe
More offsprings, it can accelerate several times, tens times of breeding good species sheep than traditional method, this will greatly improve good variety population
Reproductive efficiency, promote animal improvement, accelerate genetic progress；Also it is at the same time reproduction cell fusion, in vitro fertilization, embryo gender mirror
The research of the biotechnologys such as fixed, transgenic technology, somatic cell clone provides basis, is that last century domestic animal after artificial insemination is numerous
Grow the great revolution again in field.
Extensive development with super ovulation techniques in husbandry sector and in research work, some influence its and further send out
Exhibition and the technical problem improved also increasingly show.Superovulation is unstable to become the head for restricting the application of its further genralrlization
Factor is wanted, even if the kind of meat sheep used as donor, age, nutrition and physiological status, the source of hormone, dosage, the season of superfecundation,
In the case of all sames such as program, significantly difference still occurs in Superovulation, and Different Individual is on ovum number is obtained
Variation is very big, and the coefficient of variation causes the efficiency of superfecundation to be remarkably decreased 40% or so.
With the rapid development of modern molecular genetics technology, molecular marking technique provides new to solve this problem
Thinking.Can be to avoid the genotype inspection disturbed to realize molecular labeling of age and environment using Protocols in Molecular Biology method
Survey, can accurately select high-quality donor to participate in superfecundation processing using molecular marker gene type information, reduction obtains the change of ovum number
It is different, it so will greatly accelerate breeding process, improve Livestock Production efficiency.
Follicle-stimulating hormone (FSH) also known as follicular stimulating hormone (Follicle-Stimulating Hormone, FSH), in reproductive process
In play important role, while be also a kind of external source hormone supplemented mostly important in superfecundation processing procedure.But promote
Follicular hormone cannot be directed through cell membrane in itself, it is necessary to the follicle-stimulating hormone (FSH) on granular cell, endo cell with target tissue
Acceptor (FSH receptor, FSHR) combines, and could enter and play its biological action into the cell.Sheep FSHR genes are located at 3
Number chromosome, Yarney etc. (1993) has cloned its cDNA sequence first, this sequence includes the open reading frame of long 2085bp, compiles
Mature protein (the 74,580daltons of 678 amino acid of code；PI=6.78).With known people and the sequence homology of rat
Property is more than 90%.The mRNA of FSHR is located at the surface of follicular cell, in follicular development initial stage, theca interna and matrix membrane shape
Into former, primordial follicle only has and can just be found during 1~2 layer of granular cell.FSHR and its ligand binding, make granular cell or testis
Tubule trophocyte cAMP concentration raises, and activates protein kinase A (PKA), causes some protease and transcription factor activation.
Transcription factor cAMP response element binding proteins and cAMP reaction bonded effectors are activated by PKA phosphorylation, with CRE (cAMP
Response element) combine, cause the mRNA of moment to transcribe.
Therefore, Follicle Stimulating Hormone Receptors gene (FSHR) can be chosen to be candidate gene, by finding it with important
The molecular labeling of function, and donor seletion is carried out using Molecular Marker Information, there is weight for improving sheep superfecundation efficiency
Want meaning.
The content of the invention
It is an object of the invention to clone sheep Follicle Stimulating Hormone Receptors (FSHR) genetic fragment, identifies its specific mutation
Site, and a kind of molecule labelling method and its molecular labeling primer indicated and identify sheep superfecundation character is provided.
The present invention is according to 5 ＇ control regions c.-365C of sheep FSHR genes>T is mutated (C-365T), wrong using primer single base
With mode, ingehious design specific primer FSHRPF and FSHRPR, successfully mask original on genome in primer region
Restriction enzyme site is disturbed, only retains the restriction enzyme site for being used for C-365T abrupt climatic changes in amplification section.Using restriction enzyme
Sau3AI is detected parting to C-365T mutational sites, using the relevance of genotype information and sheep superfecundation character,
A kind of molecule labelling method indicated and identify sheep superfecundation character is provided.
The present invention provides a kind of molecular labeling primer indicated and identify sheep superfecundation character, the molecular labeling primer
For FSHRPF and FSHRPR, the sequence such as sequence table Seq ID No of FSHRPF：Shown in 1, the sequence such as sequence table Seq of FSHRPR
ID No：Shown in 2.
A kind of indication of the present invention and the molecule labelling method for identifying sheep superfecundation character, it is according to following steps
Carry out：
First, using the ovine genome DNA of extraction as template, using FSHRPF and FSHRPR primers, PCR amplification is carried out, is received
Collect PCR product；Take PCR product to carry out detected through gel electrophoresis, and enzyme is carried out to PCR product using Sau3AI restriction enzymes
Cut, obtain digestion products；
2nd, concentration be 3% Ago-Gel digestion products are separated, then according to electrophoretic separation result into
Row genotype judges；The standard of judgement is：1. single band is presented after electrophoresis, size 138bp, then 5 ＇ tune of sheep FSHR genes
Control section -365 site is unmutated, and base C, pcr amplification product can not be ordered by restriction enzyme Sau3AI digestions
Entitled AA genotype；2. two bands are presented after electrophoresis, size is respectively 138bp and 26bp, then 5 ＇ control regions of sheep FSHR genes
- 365 sites of section are undergone mutation, and base T, pcr amplification product can be ordered by restriction enzyme Sau3AI complete degestions
Entitled BB genotype；3. three bands are presented after electrophoresis, size is respectively 138bp, 112bp and 26bp, then 5 ＇ of sheep FSHR genes
Regulation and control section -365 site is in heterozygous state, and base is C and T, and pcr amplification product is merely able to by restriction enzyme Sau3AI
It is partially digested, it is named as AB genotype；
3rd, construction is with Linear Model with Side：Y=μ+G+L+H+e；Wherein：Y represents the record value of correlated traits；μ represents colony
Average value；G represents genotype fixed effect；L Representative Cultivars fixed effects；H represents field year season fixed effect；E represents random
Residual error effect；Then genotype fixed effect and superfecundation shape are associated analysis using 6.12 software kits of SAS, and estimated
Count character least squares means, association analysis the result shows that, be BB between each genotypic population for ovulation point quantity on ovary
＞ AB ＞ AA；The average that BB types colony sheep embryo rate of fertilization and excellent embryo lead is higher than AA types and AB types colony；It is pregnant transplanting
In terms of rate of being pregnent, with AB types colony average highest；
4th, sheep donor is divided into three types according to genotype, selects BB genotype sheep donor to participate in superfecundation
Processing, so as to fulfill the molecular marker assisted selection to sheep superfecundation number, that is, completes indication and identification sheep superfecundation
The molecule labelling method of character；The sequence of the FSHRPF such as sequence table Seq ID No：Shown in 1, the sequence such as sequence of FSHRPR
List Seq ID No：Shown in 2.
The present invention FSHRPF primer sequences be：AGCGAGAGAGACATCAGTGAC, FSHRPR primer sequence is：
GCAGTGTGAAACATCATTAAGA。
The invention has the advantages that：
The most important feature of the present invention is：1st, number is surpassed with sheep using the C-365T mutation of 5 ＇ control regions of sheep FSHR genes
The relevance for character of ovulating, is indicated and identifies sheep superfecundation character；It is 2nd, of the invention in molecular labeling primer is designed,
Using single base mismatch mode is introduced, original interference restriction enzyme site on genome in primer region is masked, only retains amplification
It is used for the restriction enzyme site of C-365T abrupt climatic changes in section, the molecule labelling method of the present invention is carried out PCR-RLFP points
Analysis, accuracy rate high advantage low with expense.
The method of the present invention is easy to operate, and testing cost is low, and accuracy is high, and is suitable for automatic detection.Use this hair
Bright molecule labelling method completes the selection of donor in sheep super ovulation procedures, obtains ovum number and improves 2.87 pieces, reduces character
Variation, improve the efficiency of sheep superfecundation.Molecular marker assisted selection is carried out using the method for the present invention, will be greatly
Accelerate breeding process, improve sheep production efficiency.And it is the biological skill such as reproduction cell fusion, transgenic technology, somatic cell clone
The research of art provides more high-quality ovums.
Brief description of the drawings
Fig. 1 is the pcr amplification product of 5 ＇ control regions of sheep FSHR genes through 3% agarose gel electrophoresis testing result.
Wherein, M swimming lanes are that standard molecular weight Marker, 1-10 swimming lane are 10 detected PCR products.
Fig. 2 regulates and controls section C-365T polymorphic site digestion genotyping results for 5 ＇ of sheep FSHR genes.Wherein, M swimming lanes are mark
Quasi-molecule amount Marker, 1,3,5,7,9,10 swimming lanes are AA types individual, and 2,4,6 swimming lanes are AB types individual, and 8 swimming lanes are BB types
Body.
Embodiment
Embodiment one：A kind of indication of present embodiment and the molecular labeling of identification sheep superfecundation character draw
Thing, the molecular labeling primer are FSHRPF and the sequence such as sequence table Seq ID No of FSHRPR, FSHRPF：Shown in 1, FSHRPR
Sequence such as sequence table Seq ID No：Shown in 2.
Embodiment two：The present embodiment is different from the first embodiment in that：The molecular labeling primer
In be that FSHRPF primers design in the following manner：Using primer single base mismatch mode, on FSHRPF primer sequences
CATC bases are designed, the Sau3AI interference restriction enzyme sites in primer region on genome is masked, is only preserved for C-365T and dashes forward
Become the restriction enzyme site of detection.It is other identical with embodiment one.
Embodiment three：The present embodiment molecule labelling method is to utilize 5 ＇ control regions c.- of sheep FSHR genes
365 C>T mutational sites carry out parting, so as to indicate and identify sheep superfecundation character.
Embodiment four：Present embodiment is unlike embodiment three：Indication and identification sheep surpass number
The molecule labelling method for character of ovulating, it is followed the steps below：
First, using the ovine genome DNA of extraction as template, using FSHRPF and FSHRPR primers, PCR amplification is carried out, is received
Collect PCR product；Take PCR product to carry out detected through gel electrophoresis, and enzyme is carried out to PCR product using Sau3AI restriction enzymes
Cut, obtain digestion products；
2nd, concentration be 3% Ago-Gel digestion products are separated, then according to electrophoretic separation result into
Row genotype judges；The standard of judgement is：1. single band is presented after electrophoresis, size 138bp, then 5 ＇ tune of sheep FSHR genes
Control section -365 site is unmutated, and base C, pcr amplification product can not be ordered by restriction enzyme Sau3AI digestions
Entitled AA genotype；2. two bands are presented after electrophoresis, size is respectively 138bp and 26bp, then 5 ＇ control regions of sheep FSHR genes
- 365 sites of section are undergone mutation, and base T, pcr amplification product can be ordered by restriction enzyme Sau3AI complete degestions
Entitled BB genotype；3. three bands are presented after electrophoresis, size is respectively 138bp, 112bp and 26bp, then 5 ＇ of sheep FSHR genes
Regulation and control section -365 site is in heterozygous state, and base is C and T, and pcr amplification product is merely able to by restriction enzyme Sau3AI
It is partially digested, it is named as AB genotype；
3rd, construction is with Linear Model with Side：Y=μ+G+L+H+e；Wherein：Y represents the record value of correlated traits；μ represents colony
Average value；G represents genotype fixed effect；L Representative Cultivars fixed effects；H represents field year season fixed effect；E represents random
Residual error effect；Then genotype fixed effect and superfecundation shape are associated analysis using 6.12 software kits of SAS, and estimated
Count character least squares means, association analysis the result shows that, be BB between each genotypic population for ovulation point quantity on ovary
＞ AB ＞ AA；The average that BB types colony sheep embryo rate of fertilization and excellent embryo lead is higher than AA types and AB types colony；It is pregnant transplanting
In terms of rate of being pregnent, with AB types colony average highest；
4th, sheep donor is divided into three types according to genotype, selects BB genotype sheep donor to participate in superfecundation
Processing, so as to fulfill the molecular marker assisted selection to sheep superfecundation number, that is, completes indication and identification sheep superfecundation
The molecule labelling method of character；The sequence of the FSHRPF such as sequence table Seq ID No：Shown in 1, the sequence such as sequence of FSHRPR
List Seq ID No：Shown in 2.It is other identical with embodiment three.
The donor is experimental population, and the experimental population is：1. 32 Australia merino kinds, 28 German meat
With merino kind, 19 Suffolk kinds, 16 Te Kesaier kinds, 14 Xia Luolai kinds, 36 northeast thin-wool sheeps；②
It is ewe；3. all results are to analyze to complete in 3 years.
The three types are AA genotype, BB genotype and AB genotype.
Embodiment five：Present embodiment is unlike embodiment three：Step 3 constructs linear model
The characteristics of being according to experimental population, the characteristics of experimental population be：1. 32 Australia merino kinds, 28 German Muttons
Merino kind, 19 Suffolk kinds, 16 Te Kesaier kinds, 14 Xia Luolai kinds, 36 northeast thin-wool sheeps；It is 2. equal
For ewe；3. all results are to analyze to complete in 3 years.It is other identical with embodiment three.
Embodiment six：Present embodiment is unlike embodiment three：Association analysis in step 3
The result shows that：It is BB ＞ AB ＞ AA between each genotypic population for ovulation point quantity on ovary；Different genotype on ovary to arranging
Ovum quantity there are significant impact, wherein, P<0.05；The average that BB types colony sheep embryo rate of fertilization and excellent embryo lead is higher than
AA types and AB types colony, but difference is not notable, wherein, P>0.05；In terms of transplant pregnancy rate, with AB types colony average highest,
But three kinds of genetic varieties are not notable, wherein, P>0.05.It is other identical with embodiment three.
Embodiment seven：Present embodiment is unlike embodiment three：PCR amplification system in step 1
It is as follows for 20 μ l, PCR reaction systems：
PCR amplification condition is：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 59 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 30
A circulation, then 72 DEG C of extension 7min, 4 DEG C of insulations.
It is other identical with embodiment three.
Embodiment eight：Present embodiment is unlike embodiment three：Sau3AI is used in step 1
The system that restriction enzyme carries out digestion is 10.0 μ l, and reaction system is as follows：
Endonuclease reaction condition is：37 DEG C of digestion 12h.
It is other identical with embodiment three.
Embodiment nine：Present embodiment is unlike embodiment three：Sau3AI is used in step 1
Restriction enzyme is carried out PCR product digestion and refers to be mutated the C-365T of PCR product using restriction enzyme Sau3AI
Site carries out digestion.It is other identical with embodiment three.
Present invention is not limited only to the content of the respective embodiments described above, the group of one of them or several embodiments
Contract sample can also realize the purpose of invention.
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples, is commercially available unless otherwise specified.
Embodiment：
1. extract ovine genome DNA
(1) clip about 6mg ear tissue samples are put into a new centrifuge tube, are shredded as far as possible with eye scissors, vacuum is drained machine and drained
10min adds 700 μ l tissue DNA extracting solutions, mixes to remove ethanol.
(2) Proteinase K is added to 200 μ g/ml of final concentration, and 55 DEG C of digestion are overnight.
(3) isometric Tris- saturated phenols are added, slowly reverse centrifuge tube 10min, 12000rpm centrifugation 10min.Use head end
Part, which cuts off the pipette tips of 0.5cm supernatant carefully is moved to another clean centrifuge tube, (if resulting solution is not limpid, repeats this
Step is once).
(4) isometric phenol is added：Chloroform (1:1), slowly reverse centrifuge tube 10min, 12000rpm centrifuge 10min, use
Supernatant is carefully moved to another clean centrifuge tube by the pipette tips that head portion cuts off 0.5cm.
(5) isometric chloroform is added, slowly reverse centrifuge tube 10min, 12000rpm centrifugation 10min, uses head portion
Supernatant is carefully moved to another clean centrifuge tube by the pipette tips for cutting off 0.5cm.
(6) absolute ethyl alcohol of two volumes precooling is added, centrifuge tube overturns uniformly mixed, 6000rpm centrifugations 5min.
(7) supernatant is outwelled, 70% ethanol of 1ml is added and washed once.
(8) 6000rpm centrifuges 5min, outwells ethanol in pipe, dries 10min in air.
(9) appropriate TE dissolving DNAs are added.
(10) 0.7% agarose gel electrophoresis Preliminary detection concentration and purity.- 20 DEG C of preservations are stand-by.
2nd, PCR reaction systems are established
PCR amplification system is as follows for 20 μ l, PCR reaction systems：
The nucleotides sequence of specific primer is classified as：FSHRPF-AGCGAGAGAGACATCAGTGAC, FSHRPR-
GCAGTGTGAAACATCATTAAGA。
1st, PCR response procedures are established
PCR amplification products therefrom is detected using 3% agarose gel electrophoresis, sees Fig. 1, wherein, M swimming lanes are standard
Molecular weight Marker, 1-10 swimming lane are 10 detected PCR products.The result shows that：Product and expected in the same size, band list
One, no miscellaneous band of non-specific amplification, amplification efficiency is very high, can be used for next step digestion parting.
4th, PCR-RFLP digestion systems are established and use the system of Sau3AI restriction enzymes progress digestion as 10.0 μ l, instead
Answer system as follows：
Endonuclease reaction condition is：37 DEG C of digestion 12h.
Pcr amplification product is examined through 37 DEG C of digestion 12h of Sau3AI restriction enzymes using 3% agarose gel electrophoresis
Survey, as a result produce 3 kinds of genotype, see Fig. 2.Wherein, M swimming lanes are standard molecular weight Marker, and 1,3,5,7,9,10 swimming lanes are AA
Type individual, 2,4,6 swimming lanes are AB types individual, and 8 swimming lanes are BB types individual.
5th, 5 ＇ control region C-365T mutational sites polymorphism distribution inspection of sheep FSHR genes
In 6 experimental populations, according to digestion parting testing result, 5 ＇ control regions C-365T of sheep FSHR genes is analyzed
The various genotype frequencies and gene frequency in mutational site, statistical result are shown in Table 1.It is as shown in the table, and 6 kinds only have Suffolk
Do not detect that BB types are individual in colony, three kinds of genotype are distributed in other kinds.Independence test (X2) total result table
It is bright, genotype frequency significant difference (P between kind<0.05).
1. genotype of table and gene frequency compare between different cultivars
6th, related between each index of superfecundation point of 5 ＇ control region C-365T mutational site polymorphisms of sheep FSHR genes
Analysis
By the genotype in 5 ＇ control region C-365T mutational sites of sheep FSHR genes, super several rows with sheep in corresponding colony
Each index of ovum is associated analysis, is shown in Table 2.The result shows that：For ovulation point quantity on ovary, there are BB ＞ between each genotypic population
AB ＞ AA, there are significant impact (P to ovulation point quantity on ovary for different genotype<0.05)；BB types colony's sheep embryo by
The average that smart rate and excellent embryo lead is higher than AA types and AB types colony, but the not notable (P of difference>0.05).In transplant pregnancy rate side
Face, with AB types colony average highest, but three kinds of genetic varieties not significantly (P>0.05).
Result above shows that FSHR genes can obtain one of main candidate of ovum number character as sheep superfecundation,
Handled by selecting BB genotype donor to participate in superfecundation, its number of eggs ovulated is higher than 2.87 pieces of AA types donor.BB genotype can be with
It is used for the number of eggs ovulated for predicting sheep superfecundation as molecular genetic marker, will significantly improves sheep superfecundation efficiency.
Association analysis between 2. various genotype of table and each index of superfecundation
。
Claims (8)
- Indicate and the molecule labelling method of identification sheep superfecundation character 1. a kind of, it is characterised in that the molecule labelling method is Utilize the C of 5 ＇ control regions c.-365 of sheep FSHR genes>T mutational sites carry out parting, so as to indicate and identify the super several rows of sheep Egg character；Indication and identification sheep superfecundation character follow the steps below：First, using the ovine genome DNA of extraction as template, using FSHRPF and FSHRPR primers, PCR amplification is carried out, collects PCR Product；Take PCR product to carry out detected through gel electrophoresis, and digestion is carried out to PCR product using Sau3AI restriction enzymes, obtain Digestion products；2nd, the Ago-Gel that concentration is 3% separates digestion products, then carries out base according to electrophoretic separation result Because type judges；The standard of judgement is：1. single band is presented after electrophoresis, size 138bp, then 5 ＇ control regions of sheep FSHR genes - 365 sites of section are unmutated, and base C, pcr amplification product can not be named as by restriction enzyme Sau3AI digestions AA genotype；2. two bands are presented after electrophoresis, size is respectively 138bp and 26bp, then 5 ＇ of sheep FSHR genes regulate and control section- 365 sites are undergone mutation, base T, and pcr amplification product can be named by restriction enzyme Sau3AI complete degestions For BB genotype；3. three bands are presented after electrophoresis, size is respectively 138bp, 112bp and 26bp, then 5 ＇ tune of sheep FSHR genes Control section -365 site is in heterozygous state, and base is C and T, and pcr amplification product is merely able to by restriction enzyme Sau3AI portions Divide digestion, be named as AB genotype；3rd, construction is with Linear Model with Side：Y=μ+G+L+H+e；Wherein：Y represents the record value of correlated traits；μ represents the flat of colony Average；G represents genotype fixed effect；L Representative Cultivars fixed effects；H represents field year season fixed effect；E represents random residual Effect；Then genotype fixed effect and superfecundation shape are associated analysis, and the property estimated using 6.12 software kits of SAS The least squares means of shape, association analysis the result shows that, be BB ＞ AB between each genotypic population for ovulation point quantity on ovary ＞ AA；The average that BB types colony sheep embryo rate of fertilization and excellent embryo lead is higher than AA types and AB types colony；In transplant pregnancy rate Aspect, with AB types colony average highest；4th, sheep donor is divided into three types according to genotype, selects BB genotype sheep donor to participate in superfecundation processing, So as to fulfill the molecular marker assisted selection to sheep superfecundation number, that is, complete indication and identify sheep superfecundation character Molecule labelling method；The sequence of the FSHRPF such as sequence table Seq ID No：Shown in 1, the sequence such as sequence table of FSHRPR Seq ID No：Shown in 2.
- 2. a kind of molecule labelling method indicated and identify sheep superfecundation character according to claim 1, its feature It is the characteristics of step 3 construction linear model is according to experimental population, the characteristics of experimental population is：1. 32 Australia Merino kind, 28 German Mutton merino kinds, 19 Suffolk kinds, 16 Te Kesaier kinds, 14 Xia Luolai Kind, 36 northeast thin-wool sheeps；2. it is ewe；3. all results are to analyze to complete in 3 years.
- 3. a kind of molecule labelling method indicated and identify sheep superfecundation character according to claim 1, its feature In the association analysis in step 3 the result shows that：It is BB ＞ AB ＞ between each genotypic population for ovulation point quantity on ovary AA；Different genotype on ovary ovulate quantity there are significant impact, wherein, P<0.05；The sheep embryo fertilization of BB types colony The average that rate and excellent embryo lead is higher than AA types and AB types colony, but difference is not notable, wherein, P>0.05；In transplant pregnancy rate Aspect, with AB types colony average highest, but three kinds of genetic varieties are not notable, wherein, P>0.05.
- 4. a kind of molecule labelling method indicated and identify sheep superfecundation character according to claim 1, its feature In step 1 PCR amplification system for 20 μ l, PCR reaction systems it is as follows：PCR amplification condition is：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 59 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 30 are followed Ring, then 72 DEG C of extension 7min, 4 DEG C of insulations.
- 5. a kind of molecule labelling method indicated and identify sheep superfecundation character according to claim 1, its feature Being used in step 1, the system that Sau3AI restriction enzymes carry out digestion is as follows for 10.0 μ l, reaction system：Endonuclease reaction condition is：37 DEG C of digestion 12h.
- 6. a kind of molecule labelling method indicated and identify sheep superfecundation character according to claim 1, its feature Refer to use restriction enzyme Sau3AI using Sau3AI restriction enzymes to carry out digestion to PCR product in step 1 Digestion is carried out to the C-365T mutational sites of PCR product.
- Indicate and the molecular labeling primer of identification sheep superfecundation character 7. a kind of, it is characterised in that the molecular labeling primer is The sequence of FSHRPF and FSHRPR, FSHRPF such as sequence table Seq ID No：Shown in 1, the sequence such as sequence table Seq ID of FSHRPR No：Shown in 2.
- 8. a kind of molecular labeling primer indicated and identify sheep superfecundation character according to claim 7, its feature In the molecular labeling primer it is being that FSHRPF primers design in the following manner：Using primer single base mismatch side Formula, designs CATC bases on FSHRPF primer sequences, masks the Sau3AI interference digestions position in primer region on genome Point, is only preserved for the restriction enzyme site of C-365T abrupt climatic changes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510446375.5A CN104988238B (en) | 2015-07-27 | 2015-07-27 | A kind of molecule labelling method and its molecular labeling primer indicated and identify sheep superfecundation character |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510446375.5A CN104988238B (en) | 2015-07-27 | 2015-07-27 | A kind of molecule labelling method and its molecular labeling primer indicated and identify sheep superfecundation character |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104988238A CN104988238A (en) | 2015-10-21 |
| CN104988238B true CN104988238B (en) | 2018-05-04 |
Family
ID=54300131
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510446375.5A Active CN104988238B (en) | 2015-07-27 | 2015-07-27 | A kind of molecule labelling method and its molecular labeling primer indicated and identify sheep superfecundation character |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104988238B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107385061A (en) * | 2017-08-15 | 2017-11-24 | 南京农业大学 | One gene mutation site associated with sheep reproductive trait and its application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103740697A (en) * | 2013-09-27 | 2014-04-23 | 新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心 | Method for obtaining FSHR full-length coding region sequence with multiple splice forms |
| CN104046626A (en) * | 2014-06-05 | 2014-09-17 | 兰州大学 | Molecular marker related to lambing number character of sheep and application thereof |
-
2015
- 2015-07-27 CN CN201510446375.5A patent/CN104988238B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103740697A (en) * | 2013-09-27 | 2014-04-23 | 新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心 | Method for obtaining FSHR full-length coding region sequence with multiple splice forms |
| CN104046626A (en) * | 2014-06-05 | 2014-09-17 | 兰州大学 | Molecular marker related to lambing number character of sheep and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| Polymorphism of 50 regulatory region of ovine FSHR gene and its association with litter size in Small Tail Han sheep;M. X. Chu，et al;《Mol Biol Rep》;20110703;3721-3725页 * |
| 小尾寒羊促卵泡素受体基因5′端序列的TaqI 酶切多态性分析;魏伍川等;《草食家畜(季刊)》;20030331(第1期);58-60页 * |
| 山羊FSHR基因5′端侧翼序列多态性对产羔性状的影响;姬云涛等;《西北农林科技大学学报(自然科学版)》;20070930;第35卷(第9期);1-4页 * |
| 波尔山羊FSHR 5’端序列的SNP多态性及超排效果分析;宋美玲等;《家畜生态学报》;20060731;第27卷(第4期);25-28页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104988238A (en) | 2015-10-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110029178B (en) | SNP molecular marker related to single-fetus and multiple-lamb characters of sheep, detection primer group, detection kit and application thereof | |
| CN112251518B (en) | Molecular marker associated with lambing number and growth traits in goat RSAD2 gene and application thereof | |
| CN112176076B (en) | NFAT5 gene molecular marker related to goat growth traits and application thereof | |
| CN110004236A (en) | SNP marker relevant to the more lamb characters of sheep and its detection ESR1 genotyping primer group, kit and application | |
| CN110923333B (en) | Haplotype marker related to lambing number in first intron of goat ZBP1 gene and application thereof | |
| CN115141889A (en) | SNP marker related to Chinese southern Holstein cow milk production traits and application thereof | |
| CN108913787A (en) | SNP marker relevant to the more lambs of sheep and its application | |
| CN113430285B (en) | Molecular marker related to Muscovy duck breeding traits and application | |
| CN117385045B (en) | Application of goat AMHR2 gene as lambing number-associated molecular marker | |
| Peippo et al. | Birth of correctly genotyped calves after multiplex marker detection from bovine embryo microblade biopsies | |
| CN117431324A (en) | High-density SNP chip in whole genome of dairy cow and application thereof | |
| CN104988238B (en) | A kind of molecule labelling method and its molecular labeling primer indicated and identify sheep superfecundation character | |
| CN106676176B (en) | Method for performing SSR (simple sequence repeat) analysis on tetraploid alfalfa by utilizing multiple PCR (polymerase chain reaction) | |
| CN109295240A (en) | One kind SNP marker relevant to the more lamb characters of sheep list tire and SMAD1 gene parting detecting reagent and application | |
| CN109536617A (en) | The 4th exon 1 SNP of pig INCENP identification and application | |
| CN105821037A (en) | Snp marker and application thereof | |
| CN113278711A (en) | Gene chip, molecular probe combination, kit and application for sheep germplasm resource identification and pedigree reconstruction | |
| CN105420402B (en) | A kind of and the relevant molecular labeling of milk cow somatic cell score and its application | |
| CN109536633A (en) | The SNP marker and application isolated with the anti-graywall main effect QTL-qRgls2 of corn | |
| CN111197089B (en) | SNP molecular marker for selecting laying rate of hens in later laying period and application thereof | |
| US20220290220A1 (en) | Methods for lowering the incidence of hemorrhagic heart disease in swine | |
| CN116855613B (en) | Molecular marker, primer, kit, method and application of pig carcass traits | |
| CN114250307B (en) | Molecular marker for evaluating age of pigs reaching 100kg body weight and application thereof | |
| CN110564862B (en) | Method for rapidly screening Holstein cattle HH5 genetic defect gene carrier | |
| CN103114093B (en) | Pig catenin alpha-like 1 (CTNNAL1) gene as genetic marker of pig litter size traits |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |