CN108085291A - A kind of detection method of genophore genetic stability of encoding muramidase release albumen and application - Google Patents
A kind of detection method of genophore genetic stability of encoding muramidase release albumen and application Download PDFInfo
- Publication number
- CN108085291A CN108085291A CN201810009858.2A CN201810009858A CN108085291A CN 108085291 A CN108085291 A CN 108085291A CN 201810009858 A CN201810009858 A CN 201810009858A CN 108085291 A CN108085291 A CN 108085291A
- Authority
- CN
- China
- Prior art keywords
- genophore
- muramidase
- genetic stability
- encoding muramidase
- release albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Detection method and application the present invention provides a kind of genophore genetic stability of encoding muramidase release albumen, belong to bioengineering field.The host strain bacterium solution that the present invention passes through genophore plasmid of the culture containing encoding muramidase release albumen of recovering, and carry out the secondary culture of continuous multi-generation, certain algebraically is spaced to sample and detect, by the genetic stability of the host strain of the genophore plasmid that albumen is discharged containing encoding muramidase that detects artificial preservation, the genophore that albumen is discharged for research encoding muramidase provides reliable support and ensures；Above-mentioned detection method is applied in the genophore culture of encoding muramidase release albumen, or the research and culture of the genophore of encoding muramidase release albumen provide reference and uses for reference, and have important application value.
Description
Technical field
The present invention relates to bioengineering field, in particular to a kind of genophore of encoding muramidase release albumen
The detection method of genetic stability and application.
Background technology
Streptococcus suis is a kind of encapsulated gram-positive cocci of tool.Can according to its cell wall antigen ingredient by it substantially
It is classified as Lan Shi and divides group (Lancefieldgroup D) D group streptococcus.
Streptococcus suis is mainly shown as the septic of pig and the suppurative illness of focal lymph node.The nature of Streptococcus suis
Infection site is the upper respiratory tract (particularly tonsillotome and nasal cavity), genital tract and the alimentary canal of pig.Pig is susceptible in various animals
Property is higher.The pig at various ages can fall ill, but septicemia type and meningoencephalitis type are more common in piglet, purulent lymphadenitis type
It is more common in middle pig.Sick pig, I clinical rehabilitations pig and health pig can carry disease germs, after healthy swinery, which introduces, carries disease germs pig, due to mutually connecting
It touches, germ can be infected by mouth, nose, skin wound.The genophores for encoding muramidase release albumen few at present
The research of the stability of artificial preservation.
The content of the invention
The first object of the present invention is the detection for providing the genophore genetic stability of encoding muramidase release albumen
Method, by this detection method, the genetic stability for the genophore that can discharge albumen to encoding muramidase has more reliably
Understanding, the research of genophore that albumen is discharged for encoding muramidase provides reliable support.
The second object of the present invention is the genophore genetic stability for providing above-mentioned encoding muramidase release albumen
Application of the detection method in the genophore culture of encoding muramidase release albumen.
In order to realize the above-mentioned purpose of the present invention, using following technical scheme：
A kind of detection method of the genophore genetic stability of encoding muramidase release albumen, including：
The host strain bacterium solution of genophore plasmid of the culture containing encoding muramidase release albumen in fluid nutrient medium；
Continuous passage culture host strain bacterium solution；
The host strain bacterium solution of interval sampling secondary culture simultaneously carries out genetic stability detection.
The detection method of the genophore genetic stability of above-mentioned encoding muramidase release albumen is discharged in encoding muramidase
Application in the genophore culture of albumen.
Beneficial effects of the present invention are：The present invention passes through genophore of the culture containing encoding muramidase release albumen of recovering
The host strain bacterium solution of plasmid, and the secondary culture of continuous multi-generation is carried out, it is spaced certain algebraically and samples and detect, by detecting people
Genetic stability of the genophore plasmid containing encoding muramidase release albumen of work preservation in host strain, encodes for research
The genophore of muramidase-released protein provides reliable support and ensures；Above-mentioned detection method is applied to encoding muramidase to release
It puts in the genophore culture of albumen, or the research of the gene of encoding muramidase release albumen provides reference and uses for reference,
With important application value.
Description of the drawings
It in order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair
The restriction of scope, for those of ordinary skill in the art, without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Fig. 1 is the colonial morphology figure for the 5th generation Escherichia coli that experimental example 4 of the present invention provides；
Fig. 2 is the colonial morphology figure for the 15th generation Escherichia coli that experimental example 4 of the present invention provides；
Fig. 3 is the colonial morphology figure for the 25th generation Escherichia coli that experimental example 4 of the present invention provides；
Fig. 4 is the colonial morphology figure for the 40th generation Escherichia coli that experimental example 4 of the present invention provides；
Fig. 5 is the 5th generation colibacillus PCR electrophoresis result figure that experimental example 4 of the present invention provides；
Fig. 6 is the 15th generation colibacillus PCR electrophoresis result figure that experimental example 4 of the present invention provides；
Fig. 7 is the 25th generation colibacillus PCR electrophoresis result figure that experimental example 4 of the present invention provides；
Fig. 8 is the 40th generation colibacillus PCR electrophoresis result figure that experimental example 4 of the present invention provides；
Fig. 9 is the 5th generation Escherichia coli biochemical test result figure that experimental example 4 of the present invention provides；
Figure 10 is the 15th generation Escherichia coli biochemical test result figure that experimental example 4 of the present invention provides；
Figure 11 is the 25th generation Escherichia coli biochemical test result figure that experimental example 4 of the present invention provides；
Figure 12 is the 40th generation Escherichia coli biochemical test result figure that experimental example 4 of the present invention provides.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will
Understand, the following example is merely to illustrate the present invention, and is not construed as limiting the scope of the invention.It is not specified in embodiment specific
Condition person, the condition suggested according to normal condition or manufacturer carry out.Reagents or instruments used without specified manufacturer is
The conventional products that can be obtained by commercially available purchase.
After pig-pig infection streptococcus, its growth development is seriously affected；Tremendous influence is brought to pig-breeding, is seriously affected
The production and operation of raiser and income, it is therefore desirable to prevent pig-pig infection streptococcus, be studied.
The detection of the genophore genetic stability of albumen is discharged to a kind of encoding muramidase of the embodiment of the present invention below
Method and application are specifically described.
A kind of detection method of the genophore genetic stability of encoding muramidase release albumen, including：
The host strain bacterium solution of genophore plasmid of the culture containing encoding muramidase release albumen in fluid nutrient medium；
Continuous passage culture host strain bacterium solution；
The host strain bacterium solution of interval sampling secondary culture simultaneously carries out genetic stability detection.
By the gene cloning of encoding muramidase release albumen on carrier, and recombinant vector is transformed into host cell,
Cell is cultivated and is preserved, realizes that the genophore for indirectly preserving encoding muramidase release albumen and encoding muramidase are released
Put the expressing gene of the gene of albumen；The host strain of the vector plasmid of gene containing encoding muramidase release albumen is in preservation
In journey and in passage, it is possible to the vector plasmid of the gene of encoding muramidase release albumen be caused to be lost from host cell, made
Into the failure of preservation or the passage of the genophore plasmid of encoding muramidase release albumen, therefore to having carried out mostly generation passage
The host strain of genophore plasmid containing encoding muramidase release albumen is identified, it will be appreciated that is released containing encoding muramidase
Put the genetic stability of the host strain of the genophore plasmid of albumen.
The genophore plasmid of encoding muramidase release albumen is by the gene order of encoding muramidase release albumen：
TATTTACTGGGTATGATTATGTGGCAACTACAACTA
AAGCCGTTCAAGGTCCATATCCAAAGGGAACGGTATACCTTGC
TGGTACGGTTCAAAAGGATACAGTACAATATAAAGTTATTCGTG
AAATTGTGGAGAACGACCAAGCAGTTCTTAAATTCTATTATTTA
GATCCTACCTATAAGGGTGAAGTAGATTGGAGAGGAACTGATA
CGACTGGGTTTATTGAGTTGCTTACAACTTCCCCAACAACCTAT
AAAGTTGGTACTATATACGATTACAATATTAATTCAAAAATTACA
GCTCCATTTACTATTGATCCTACCAAGAATGTTATGGTTTTCAAG
GAAAGTGAACAGAACGAGCAAGGTAGCAAATATC is connected on pUC-57 carriers and obtains.
MRP sense primer gene orders：5’ACT GGG TAT GAT TAT GTG GC 3’
MRP anti-sense primer gene orders：5’TAC CTT GCT CGT TCT GTT CAC 3’；
Target fragment size is 364, by can preferably verify target fragment with detection primer.
Further, the inoculum concentration of host strain bacterium solution is the 1%-6% of the volume of fluid nutrient medium.
Host strain and fluid nutrient medium keep a rational inoculative proportion, it is ensured that bacterium solution can recover faster and into
Enter logarithmic phase, the time of saving experiment that can be larger, accelerate experiment process.
Further, host strain bacterium solution is glycerine bacterium solution.
Usual glycerol stock is low-temperature preservation, since glycerine has antifreeze effect, by adding glycerine, can be effectively protected
Bacterial strain is not destroyed in cryogenic conditions；And since glycerine has the effect of moisturizing, can preferably ensure the moisture of bacterium solution, it protects
Demonstrate,prove the activity of strain.
Further, the preparation of glycerine bacterium solution includes：
The virus particle of the genophore of the release albumen containing encoding muramidase is transformed into competent escherichia coli cell,
It is identified by primer detection, obtains positive recombination bacillus coli；
Recombination bacillus coli is cultivated, and adds glycerine and glycerine culture presevation is made.
Further, competent escherichia coli cell is one in TOP10 cells, DH5 α cells and BL21 (DE3) cell
Kind.
Since the growth of Escherichia coli is rapid, using Escherichia coli as host strain, pass through culture and the passage of simply recovering
Culture, can comparatively fast obtain substantial amounts of bacterium solution, you can to obtain the carrier matter of the gene of substantial amounts of encoding muramidase release albumen
Grain.
Further, the vector plasmid of gene of albumen and the body of competent escherichia coli cell are discharged containing encoding muramidase
Product is than being 1-4:100.
By controlling the ratio of virus particle and competent escherichia coli cell, the transformation efficiency of plasmid can be improved.
Further, the concentration of the virus particle of the genophore of the release albumen containing encoding muramidase is 1.7-4.8ng/ μ
L。
Further, method for transformation is：Mix the virus particle of the genophore of the release albumen containing encoding muramidase and big
Enterobacteria competent cell, places 25-37min on ice；Heat shock 35-55s, places 2-3min on ice.
Further, Testing and appraisal is reacted by PCR and realized, the annealing temperature of PCR reactions is 52-58 DEG C.
The detection method of the genophore genetic stability of above-mentioned encoding muramidase release albumen is released in encoding muramidase
Put the application in the genophore culture of albumen.
The feature and performance of the present invention are described in further detail with reference to embodiments.
Embodiment 1
The detection method of the genophore genetic stability of albumen is discharged the present embodiment provides a kind of encoding muramidase, including
The genophore plasmid of encoding muramidase release albumen is transformed into host strain cell, then will contain encoding muramidase and discharge
Glycerol stock is made in the host strain of the vector plasmid of the gene order pair of albumen, and by cultivating and passing on glycerol stock, identification passage is sweet
The genetic stability of oily bacterium.
The competent cell of DH5 α is selected to implement certainly in others as competent escherichia coli cell in the present embodiment
In mode other competent escherichia coli cells can also be selected to be tested, such as TOP10 cells or BL21 (DE3) cell.
The conversion of plasmid is as follows：
1.1 take the competent cell of 100 μ L bacillus coli DH 5 alphas to be added in EP pipes, and melt on ice；
The 1.2 genophore plasmids that the encoding muramidase that 1 μ L concentration is 4.8ng/ μ L is taken to discharge albumen are added in EP pipes
In the competent cell of the bacillus coli DH 5 alpha melted, 25min is placed on ice；
1.3 by EP pipes under 42 DEG C of temperature conditionss heat shock 35s, by EP pipes fast transfer to cooled on ice 2min；
1.4 add in the LB liquid medium without antibiotic of 200 μ L, 150rpm cultures 45min in EP pipes；
1.5 take the bacterium solution even spread of 50 μ L to LB solid mediums (Amp+) on, 37 culture 16h.
The identification of positive host strain
From the LB solid mediums (Amp of step 1.5+) on the single spot of picking 10 respectively, cultivated in LB fluid nutrient mediums,
Then bacterium solution PCR identifications are carried out；Using the reaction system of 21.5 μ L：10 × PCR Buffer2.5 μ L, dNTPs Mixture
(2.5mM) 2 μ L, each 0.25 μ L of upstream and downstream primer, 2 μ L, Taq archaeal dna polymerase of bacterium solution (template), 1 μ L, and add in ddH2O13.5
μ L are supplied.PCR response procedures are：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 52 DEG C of annealing 30s, 72 DEG C of extension 40s, 40
Xun Huan, 72 DEG C of extension 5min, 4 DEG C of preservations.
PCR reaction after the completion of, by reaction product with 1.5% agarose (containing 0.5 μ g/mL EB) gel electrophoresis, each
Amplified production and sample loading buffer mixture 6 μ L (wherein pcr amplification product and 6 × Loading buffer are added in electrophoresis hole
Volume be 5:1), other 6 μ L, 130V electrophoresis 40min of loading DNAMarker, then observe electrophoretic band.
Positive sample with band is enlarged culture.
It prepares glycerol stock and carries out culture presevation
2.1 prepare the spare of 30% glycerine；
2.2 thalline were collected by centrifugation by bacterium solution 400 the μ L, 2000rpm in growth period of taking the logarithm；
2.3 add in the fresh LB fluid nutrient mediums of 200 μ L, and thalline is dispelled to form bacteria suspension；
2.4 add in 30% isometric glycerine, mixing.
Embodiment 2
The present embodiment provides a kind of detection method of the genophore genetic stability of encoding muramidase release albumen, codings
The detection method of the genophore genetic stability of muramidase-released protein includes carrying the gene of encoding muramidase release albumen
The virus particle of body is transformed into host strain cell, then by the viroplasm of the genophore containing encoding muramidase release albumen
Glycerol stock is made in the host strain of grain, by cultivating and passing on glycerol stock, the genetic stability of identification passage glycerol stock.
The competent cell of TOP10 is selected in the present embodiment as competent escherichia coli cell, certainly other real
Applying in mode can also select other competent escherichia coli cells to be tested, such as DH5 α cells or BL21 (DE3) cell.
The conversion of plasmid is as follows：
1.1 take the competent cell of 100 μ L Escherichia coli TOP10 to be added in EP pipes, and melt on ice；
1.2 take the virus particle of the genophore for the encoding muramidase release albumen that 4 μ L concentration are 1.7ng/ μ L to be added to
In the competent cell of the Escherichia coli TOP10 melted in EP pipes, 37min is placed on ice；
1.3 by EP pipes under 42 DEG C of temperature conditionss heat shock 55s, by EP pipes fast transfer to cooled on ice 3min；
1.4 add in the LB liquid medium without antibiotic of 200 μ L, 150rpm cultures 45min in EP pipes；
1.5 take the bacterium solution even spread of 50 μ L to LB solid mediums (Amp+) on, 37 DEG C of culture 16h.
The identification of positive host strain
From the LB solid mediums (Amp of step 1.5+) on single spots of picking 10 respectively, cultivated in LB fluid nutrient mediums,
Then bacterium solution PCR identifications are carried out；Using the reaction system of 21.5 μ L：10 × PCR Buffer2.5 μ L, dNTPs Mixture
(2.5mM) 2 μ L, each 0.25 μ L of upstream and downstream primer, 2 μ L, Taq archaeal dna polymerase of bacterium solution (template), 1 μ L, and add in ddH2O13.5μ
L is supplied.PCR response procedures are：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 40s, 40 are followed
Ring, 72 DEG C of extension 5min, 4 DEG C of preservations.
PCR reaction after the completion of, by reaction product with 1.5% agarose (containing 0.5 μ g/mL EB) gel electrophoresis, each
Amplified production and sample loading buffer mixture 6 μ L (wherein pcr amplification product and 6 × Loading buffer are added in electrophoresis hole
Volume be 5:1), other 6 μ L, 130V electrophoresis 40min of loading DNAMarker, then observe electrophoretic band.
Positive sample with band is enlarged culture.
It prepares glycerol stock and carries out culture presevation
2.1 prepare the spare of 30% glycerine；
2.2 take the logarithm, and thalline were collected by centrifugation by bacterium solution 400 the μ L, 2000rpm in growth period；
2.3 add in the fresh LB fluid nutrient mediums of 200 μ L, and thalline is dispelled to form bacteria suspension；
2.4 add in 30% isometric glycerine, mixing.
Embodiment 3
The present embodiment provides a kind of detection method of the genophore genetic stability of encoding muramidase release albumen, codings
The detection method of the genophore genetic stability of muramidase-released protein includes carrying the gene of encoding muramidase release albumen
The virus particle of body is transformed into host strain cell, then by the viroplasm of the genophore containing encoding muramidase release albumen
Glycerol stock is made in the host strain of grain, by cultivating and passing on glycerol stock, the genetic stability of identification passage glycerol stock.
The competent cell of TOP10 is selected in the present embodiment as competent escherichia coli cell, certainly other real
Applying in mode can also select other competent escherichia coli cells to be tested, such as DH5 α cells or BL21 (DE3) cell.
The conversion of plasmid is as follows：
1.1 take the competent cell of 100 μ L Escherichia coli TOP10 to be added in EP pipes, and melt on ice；
1.2 take the virus particle of the genophore for the encoding muramidase release albumen that 2 μ L concentration are 2.6ng/ μ L to be added to
In the competent cell of the Escherichia coli TOP10 melted in EP pipes, 31min is placed on ice；
1.3 by EP pipes under 42 DEG C of temperature conditionss heat shock 45s, by EP pipes fast transfer to cooled on ice 3min；
1.4 add in the LB liquid medium without antibiotic of 200 μ L, 150rpm cultures 45min in EP pipes；
1.5 take the bacterium solution even spread of 50 μ L to LB solid mediums (Amp+) on, 37 DEG C of culture 16h.
The identification of positive host strain
From the LB solid mediums (Amp of step 1.5+) on the single spot of picking 10 respectively, cultivated in LB fluid nutrient mediums,
Then bacterium solution PCR identifications are carried out；Using the reaction system of 21.5 μ L：10 × PCR Buffer2.5 μ L, dNTPs Mixture
(2.5mM) 2 μ L, each 0.25 μ L of upstream and downstream primer, 2 μ L, Taq archaeal dna polymerase of bacterium solution (template), 1 μ L, and add in ddH2O13.5
μ L are supplied.PCR response procedures are：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 40s, 40
Xun Huan, 72 DEG C of extension 5min, 4 DEG C of preservations.
PCR reaction after the completion of, by reaction product with 1.5% agarose (containing 0.5 μ g/mL EB) gel electrophoresis, each
Amplified production and sample loading buffer mixture 6 μ L (wherein pcr amplification product and 6 × Loading buffer are added in electrophoresis hole
Volume be 5:1), other 6 μ L, 130V electrophoresis 40min of loading DNA Marker, then observe electrophoretic band.
Positive sample with band is enlarged culture.
It prepares glycerol stock and carries out culture presevation
2.1 prepare the spare of 30% glycerine；
2.2 take the logarithm, and thalline were collected by centrifugation by bacterium solution 400 the μ L, 2000rpm in growth period；
2.3 add in the fresh LB fluid nutrient mediums of 200 μ L, and thalline is dispelled to form bacteria suspension；
2.4 add in 30% isometric glycerine, mixing.
Embodiment 4
The present embodiment provides a kind of detection method of the genophore genetic stability of encoding muramidase release albumen, this realities
Apply the Escherichia coli that the genophore plasmid containing encoding muramidase release albumen being prepared in embodiment 3 is taken in example
Glycerol stock is tested as strain, is as follows：
1.1 add in the LB fluid nutrient mediums (ampicillin containing 100mg/L) of 3mL in test tube；
1.2 are inoculated into glycerol stock strain in test tube according to 1% inoculum concentration；
1.3 under conditions of 37 DEG C 120rpm shaken cultivations；
1.4 carry out continuous passage culture, and the sample in the 5th generation, the 15th generation, the 25th generation and the 40th generation is taken to be tested respectively.
The genetic stability of the Escherichia coli of the genophore plasmid containing encoding muramidase release albumen of continuous passage
Detection, including indole experiment, citrate experiment, VP experiments and MR (methyl red) experiment biochemistry detections.
The genetic stability of the Escherichia coli of the genophore plasmid containing encoding muramidase release albumen of continuous passage
Detection is compared including colonial morphology, Gram's staining and PCR are identified and biochemistry detection.
Colonial morphology compares
Appropriate eosin methylene blue culture medium is prepared, 121 DEG C of autoclave sterilization 15min prepare tablet in an aseptic environment,
5,15,25,40 generation bacterium solutions is taken to carry out line culture respectively, 37 DEG C of cultures for 24 hours, observe colonial morphology.
As a result as shown in Fig. 1 to Fig. 4, from colony morphological observation, the 5th generation, the 15th generation, the 25th generation and containing for the 40th generation compile
The colonial morphology of the E. coli SampLes of the genophore plasmid of code muramidase-released protein is consistent, without apparent difference, and
Single spot can be grown, illustrates that the Escherichia coli of the genophore plasmid containing encoding muramidase release albumen still possess work
Power.
PCR Molecular Identifications
The 5th generation, the 15th generation, the 25th generation and the 40th generation is taken to contain the big of the genophore plasmid of encoding muramidase release albumen
Enterobacteria sample carries out the PCR reaction systems and reaction of PCR reactions, PCR reaction systems and response procedures with reference to embodiment 3 respectively
Program.
PCR reaction results are as shown in Fig. 5 to Fig. 8, stripe size 364bp, meet the size of expected purpose segment, M in figure
Represent DNA Marker, 1 is detection sample, and 2 be negative control；The PCR product electrophoresis knot of the Escherichia coli in 5 generations is passed in Fig. 5
Fruit, Fig. 6 are the PCR product electrophoresis result of the Escherichia coli in 15 generations of passage；The PCR of Escherichia coli in Fig. 7 for 25 generations of passage is produced
Object electrophoresis result, Fig. 8 are the PCR product electrophoresis results of the Escherichia coli in 40 generations of passage；Pass on 5 generations, 15 generations, 25 generations and 40 generations
Escherichia coli can still detect pig encephalitis B virus plasmid, illustrate containing encoding muramidase release albumen genophore plasmid
Escherichia coli passed on for 5 generations, in 15 generations, 25 generations and 40 generations, can keep its genetic stability.
The biochemical reaction experiment of Escherichia coli
The Escherichia coli of genophore plasmid containing encoding muramidase release albumen are being passed on into 5 generations, 15 generations, 25 generations
It is sampled with after 40 generations, carries out indole experiment, MR (methyl red) experiments, VP experiments and citrate experiment and identified.
The 5th generation biochemical test result of the Escherichia coli of genophore plasmid containing encoding muramidase release albumen is such as
Shown in Fig. 9, it is the front and rear comparison diagram of indole experiment that wherein figure is opened on figure upper left side two, and it is right before and after VP is tested that figure is opened in upper right side two
Than figure；It is the front and rear comparison diagram of MR experiments that wherein figure is opened in figure lower left two, and it is right before and after citrate is tested that figure is opened in lower right two
Than figure；Its heredity can be kept in 5 generations of passage by showing the Escherichia coli of the genophore plasmid containing encoding muramidase release albumen
Stability.
The 15th generation biochemical test result of the Escherichia coli of genophore plasmid containing encoding muramidase release albumen
As shown in Figure 10, it is the front and rear comparison diagram of indole experiment that wherein figure is opened on figure upper left side two, and it is before VP is tested that figure is opened in upper right side two
Comparison diagram afterwards；It is the front and rear comparison diagram of MR experiments that wherein figure is opened in figure lower left two, and it is before citrate is tested that figure is opened in lower right two
Comparison diagram afterwards；It can be kept in 15 generations of passage by showing the Escherichia coli of the genophore plasmid containing encoding muramidase release albumen
Genetic stability.
The 25th generation biochemical test knot of the Escherichia coli of genophore plasmid containing encoding muramidase release albumen
Fruit is as shown in figure 11, and it is the front and rear comparison diagram of indole experiment that wherein figure is opened on figure upper left side two, and it is VP experiments that figure is opened in upper right side two
Front and rear comparison diagram；It is the front and rear comparison diagram of MR experiments that wherein figure is opened in figure lower left two, and it is citrate experiment that figure is opened in lower right two
Front and rear comparison diagram；Showing the Escherichia coli of the genophore plasmid containing encoding muramidase release albumen can keep in 25 generations of passage
Its genetic stability.
The 40th generation biochemical test result of the Escherichia coli of genophore plasmid containing encoding muramidase release albumen
As shown in figure 12, it is the front and rear comparison diagram of indole experiment that wherein figure is opened on figure upper left side two, and it is before VP is tested that figure is opened in upper right side two
Comparison diagram afterwards；It is the front and rear comparison diagram of MR experiments that wherein figure is opened in figure lower left two, and it is before citrate is tested that figure is opened in lower right two
Comparison diagram afterwards；It can be kept in 40 generations of passage by showing the Escherichia coli of the genophore plasmid containing encoding muramidase release albumen
Genetic stability.
Embodiment 5
The present embodiment provides a kind of detection method of the genophore genetic stability of encoding muramidase release albumen, this realities
Apply the Escherichia coli that the genophore plasmid containing encoding muramidase release albumen being prepared in embodiment 3 is taken in example
Glycerol stock is tested as strain, is as follows：
1.1 add in the LB fluid nutrient mediums (ampicillin containing 100mg/L) of 3mL in test tube；
1.2 are inoculated into glycerol stock strain in test tube according to 6% inoculum concentration；
1.3 under conditions of 37 DEG C 120rpm shaken cultivations；
1.4 carry out continuous passage culture, and the sample in the 5th generation, the 15th generation, the 25th generation and the 40th generation is taken to be tested respectively.
The genetic stability of the Escherichia coli of the genophore plasmid containing encoding muramidase release albumen of continuous passage
Detection, compare including colonial morphology, Gram's staining and PCR identification etc. biochemistry detections.
In conclusion the embodiment of the present invention is transformed into large intestine bar by the way that encoding muramidase to be discharged to the genophore of albumen
Then glycerol stock is made in bacterium, by cultivating glycerol stock and continuous passage, measure different generations discharges albumen containing encoding muramidase
Genophore plasmid Escherichia coli genetic stability, the research of genophore that albumen is discharged for encoding muramidase provides
It is reliable to ensure.
Embodiments described above is part of the embodiment of the present invention, instead of all the embodiments.The reality of the present invention
The detailed description for applying example is not intended to limit the scope of claimed invention, but is merely representative of the selected implementation of the present invention
Example.Based on the embodiments of the present invention, those of ordinary skill in the art are obtained without creative efforts
Every other embodiment, belongs to the scope of protection of the invention.
Claims (10)
1. a kind of detection method of the genophore genetic stability of encoding muramidase release albumen, which is characterized in that including：
The host strain bacterium solution of genophore plasmid of the culture containing encoding muramidase release albumen in fluid nutrient medium；
Host strain bacterium solution described in continuous passage culture；
Interval samples the host strain bacterium solution of the secondary culture and carries out genetic stability detection.
2. the detection method of the genophore genetic stability of encoding muramidase release albumen according to claim 1,
It is characterized in that, the inoculum concentration of the host strain bacterium solution is the 1%-6% of the volume of the fluid nutrient medium.
3. the detection method of the genophore genetic stability of encoding muramidase release albumen according to claim 1,
It is characterized in that, the host strain bacterium solution is glycerine bacterium solution.
4. the detection method of the genophore genetic stability of encoding muramidase release albumen according to claim 3,
It is characterized in that, the preparation of the glycerine bacterium solution includes：
The vector plasmid of the gene of the release albumen containing encoding muramidase is transformed into competent escherichia coli cell, passes through identification
Primer detection is identified, obtains positive recombination bacillus coli；
The recombination bacillus coli is cultivated, and adds glycerine and glycerine culture presevation is made.
5. the detection method of the genophore genetic stability of encoding muramidase release albumen according to claim 4,
It is characterized in that, the competent escherichia coli cell is one kind in TOP10 cells, DH5 α cells and BL21 (DE3) cell.
6. the detection method of the genophore genetic stability of encoding muramidase release albumen according to claim 4,
It is characterized in that, the body of the vector plasmid and the competent escherichia coli cell of the gene of the release albumen containing encoding muramidase
Product is than being 1-4:100.
7. the detection method of the genophore genetic stability of encoding muramidase release albumen according to claim 6,
It is characterized in that, the concentration of the vector plasmid of the gene of the release albumen containing encoding muramidase is 1.7-4.8ng/ μ L.
8. the detection method of the genophore genetic stability of encoding muramidase release albumen according to claim 4,
It is characterized in that, the method for the conversion is：The vector plasmid of the gene of the mixing release albumen containing encoding muramidase and described
Competent escherichia coli cell places 25-37min on ice；Heat shock 35-55s, places 2-3min on ice.
9. the detection method of the genophore genetic stability of encoding muramidase release albumen according to claim 4,
It is characterized in that, the Testing and appraisal is reacted by PCR to be realized, the annealing temperature of the PCR reactions is 52-58 DEG C.
10. the detection of the genophore genetic stability such as claim 1-9 any one of them encoding muramidase release albumen
Application of the method in the genophore culture of encoding muramidase release albumen.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810009858.2A CN108085291A (en) | 2018-01-04 | 2018-01-04 | A kind of detection method of genophore genetic stability of encoding muramidase release albumen and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810009858.2A CN108085291A (en) | 2018-01-04 | 2018-01-04 | A kind of detection method of genophore genetic stability of encoding muramidase release albumen and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108085291A true CN108085291A (en) | 2018-05-29 |
Family
ID=62181631
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810009858.2A Pending CN108085291A (en) | 2018-01-04 | 2018-01-04 | A kind of detection method of genophore genetic stability of encoding muramidase release albumen and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108085291A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102604983A (en) * | 2012-03-08 | 2012-07-25 | 刘紫琦 | Construction method of gene engineering strain without plasmid and antibiotic resistance screening marker |
| CN103451217A (en) * | 2012-06-01 | 2013-12-18 | 南京金斯瑞生物科技有限公司 | Recombinant pUC57 vector having kanamycin resistance, and constructing method thereof |
| CN104232675A (en) * | 2014-08-28 | 2014-12-24 | 武汉诺维健生物技术有限公司 | Single-resistance escherichia coli-bacillus subtilis shuttle expression vector and application thereof |
| CN104293832A (en) * | 2014-10-09 | 2015-01-21 | 河南农业大学 | Eukaryotic recombinant micro-ring expression vector for cell immortalization |
| WO2015126077A1 (en) * | 2014-02-19 | 2015-08-27 | 한국표준과학연구원 | Method for production, purification and analysis of stable isotope-labeled protein |
| CN107475170A (en) * | 2017-09-25 | 2017-12-15 | 华南理工大学 | A kind of colibacillus engineering and its application for being used to express Pseudomonas putidas Creatininase |
-
2018
- 2018-01-04 CN CN201810009858.2A patent/CN108085291A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102604983A (en) * | 2012-03-08 | 2012-07-25 | 刘紫琦 | Construction method of gene engineering strain without plasmid and antibiotic resistance screening marker |
| CN103451217A (en) * | 2012-06-01 | 2013-12-18 | 南京金斯瑞生物科技有限公司 | Recombinant pUC57 vector having kanamycin resistance, and constructing method thereof |
| WO2015126077A1 (en) * | 2014-02-19 | 2015-08-27 | 한국표준과학연구원 | Method for production, purification and analysis of stable isotope-labeled protein |
| CN104232675A (en) * | 2014-08-28 | 2014-12-24 | 武汉诺维健生物技术有限公司 | Single-resistance escherichia coli-bacillus subtilis shuttle expression vector and application thereof |
| CN104293832A (en) * | 2014-10-09 | 2015-01-21 | 河南农业大学 | Eukaryotic recombinant micro-ring expression vector for cell immortalization |
| CN107475170A (en) * | 2017-09-25 | 2017-12-15 | 华南理工大学 | A kind of colibacillus engineering and its application for being used to express Pseudomonas putidas Creatininase |
Non-Patent Citations (6)
| Title |
|---|
| BOJARSKA,A.等: "Streptococcus suis strain 07_584 truncated muramidase-released protein (mrp) gene, complete cds，GenBank: KJ746999.1", 《GENBANK》 * |
| MIKLÓSSY ILDIKÓ等: "In silico and in vivo stability analysis of a heterologous biosynthetic pathway for 1,4-butanediol production in metabolically engineered E. coli.", 《JOURNAL OF BIOMOLECULAR STRUCTURE AND DYNAMICS》 * |
| 倪艳秀等: "猪链球菌2 型SS2-1 和SS2-H 株的培养稳定性检测", 《中国兽医科技》 * |
| 徐公义等: "猪链球菌2 型人源株MRP 的表达及其单克隆抗体的制备与应用", 《中国兽医学报》 * |
| 杜悦凝等: "猪链球菌2型毒力因子研究进展", 《中兽医医药杂志》 * |
| 王淑娟等: "重组大肠杆菌pQE30-ChIL-6/JM109的遗传稳定性研究", 《现代畜牧兽医》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ocampo-Sosa et al. | Development of a new PCR assay to identify Brucella abortus biovars 5, 6 and 9 and the new subgroup 3b of biovar 3 | |
| Hadorn et al. | Genetic characterization of plasmid-encoded multiple antibiotic resistance in a strain of Listeria monocytogenes causing endocarditis | |
| Berglund et al. | Run-off replication of host-adaptability genes is associated with gene transfer agents in the genome of mouse-infecting Bartonella grahamii | |
| Reingold et al. | Identification of a new Escherichia coli She haemolysin homolog in avian E. coli | |
| Macaluso et al. | Identification of Rickettsia felis in the salivary glands of cat fleas | |
| Duhamel et al. | Colonic spirochetal infections in nonhuman primates that were associated with Brachyspira aalborgi, Serpulina pilosicoli, and unclassified flagellated bacteria | |
| CN116004429A (en) | Biocontrol strain for preventing and treating apple rot and application thereof | |
| Tomaszewski et al. | Detection and heterogeneity of herpesviruses causing Pacheco's disease in parrots | |
| Oakey et al. | Differentiation of Aeromonas genomospecies using random amplified polymorphic DNA polymerase chain reaction (RAPD‐PCR) | |
| Barbour et al. | Genotyping strains of Lyme disease agents directly from ticks, blood, or tissue | |
| CN105755143A (en) | LAMP kit for detection of bacillus erysipelatos-suis and detection method | |
| CN108085291A (en) | A kind of detection method of genophore genetic stability of encoding muramidase release albumen and application | |
| Zhang et al. | Rapid isolation of DNA for genetic screening of catfishes by polymerase chain reaction | |
| CN106868147B (en) | Molecular detection primer for sigatoka bacteria and rapid detection method thereof | |
| CN107937498A (en) | The Primer composition of auxiliary identification porcine contagious pleuropneumonia ApxI toxin and its application | |
| CN108179207A (en) | For identifying the PCR primer and method of different subgroup melon bacterial Acidovorax avenae subsps | |
| Ezquerra et al. | Molecular genotype analysis of Salmonella bovismorbificans | |
| CN108103172A (en) | A kind of detection method of plasmid genetic stability of Streptococcus suis extracellular factor gene and application | |
| CN106978512A (en) | RT PCR primers and its kit for detecting new bamboo rat source Ah card's pinta poison | |
| CN106319080A (en) | PCR detection kit for rapidly identifying mycoplasma hyopeumoniae, mycoplasma synoviae and mycoplasma hyorhinis, and applications of PCR detection kit | |
| CN108103243A (en) | The detection method of one boar encephalitis B virus genetic stability and application | |
| CN108085289A (en) | A kind of detection method of plasmid genetic stability containing pig hemolysin gene and application | |
| CN107012215B (en) | Specific primer for detecting putrefactive pathogenic bacteria and multiple PCR detection kit | |
| BHADURI et al. | A method for isolation of chromosomal and plasmid DNA from Yersinia enterocolitica for simultaneous amplification by polymerase chain reaction: a possible model for other bacteria | |
| Wright et al. | Laboratory investigation and comparison of Salmonella Brandenburg cases in New Zealand |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180529 |
|
| RJ01 | Rejection of invention patent application after publication |