CN104293832A - Eukaryotic recombinant micro-ring expression vector for cell immortalization - Google Patents

Abstract

The invention belongs to the technical field of gene engineering, and in particular relates to a eukaryotic recombinant micro-ring expression vector Minicircle-MRPS18 used in a cell immortalization process and a preparation method thereof. The vector is recombined and constructed by micro-ring plasmids and MRPS18 genes of a pig, and has a base sequence as shown in a sequence table. The vector can be used for preparing immortalized cells by performing transfection on Hela cells by virtue of a Tubofect reagent transfection process. The eukaryotic recombinant micro-ring expression vector disclosed by the invention specifically combines the advantages of a Minicircle plasmid vector and the MRPS18 genes, and the prepared eukaryotic recombinant micro-ring expression vector has the advantages of long continuous expression time of transgenes, a function of not causing a stress non-viral induction system of eukaryotic cells, low immunogenicity, safety and stability; moreover, a plasmid expression vector can be used for expressing GFP (Green Fluorescent Protein) so as to facilitate tracking reaction; and meanwhile, the eukaryotic recombinant micro-ring expression vector has the advantages of high transfection efficiency, simplicity, easiness in use and the like, and can obtain a relatively good immortalized cell preparation effect.

Description

A kind of eucaryon for cellular immortalization is recombinated micro-ring expression vector

Technical field

The invention belongs to gene engineering technology field, the eucaryon being specifically related to use in a kind of cellular immortalization process is recombinated micro-ring expression vector Minicircle-MRP S18 and preparation method thereof.

Background technology

Immortalized cells is phalangeal cell under field conditions (factors) or under human-induced condition, escapes and have the cell of endless multiplication capacity from the risk of aging.Because immortalized cells as the standard cell lines of the disciplinary study such as cytobiology and histology, and can have metastable multiplication characteristic and function, thus have broad application prospects.

MRP S18 (mitochondrial ribosome protein S18) albumen is a kind of mitochondrial ribosomal protein, it can translate mitochondrial protein, now there are some researches show, there is close molecular genetics and contact in MRP S18 gene and multiple mitochondrial disease, and also has close relationship with the adjusting and controlling growth of cell.Studies have found that, the process LAN of MRP S18 gene can cause mouse embryo fibroblasts immortalization (Kashuba E, Yenamandra S P, Darekar S D, et al.; MRPS18 – 2 protein immortalizes primary rat embryonic fibroblasts and endows them with stem cell-like properties; Proceedings of the National Academy of Sciences, 2009,106 (47): 19866 ~ 19871); Elena etc. find that MRP S18 can specifically in conjunction with phosphorylation and the dephosphorylation form of retinal proteins (retinoblastoma, Rb), but it not with other pocket protein binding, as p107 and p130, thus participate in the regulation and control of Rb path.In the small lymphocyte of Epstein-Barr virus transfection, MRPS18 can be transferred to nucleus by EBNA-6 albumen, replaces E ₂f ₁in conjunction with Rb, cause the E dissociated ₂f ₁increase, promote the cell cycle progression that Rb relies on, and the cell of MRPS18 transfection there occurs immortalization (Kashuba E, Yurchenko M, Yenamandra S P, et al.; EBV-encoded EBNA-6 binds and targets MRS18-2 to the nucleus, resulting in the disruption of pRb-E2F1 complexes; Proceedings of the National Academy of Sciences, 2008,105 (14): 5489 ~ 5494).

The probability that spontaneous immortalization occurs due to cultured cell in vitro is very low, therefore, generally adopts transgenic technology at present by exogenous origin gene integrator on the karyomit(e) of cell, to increase the Probability of immortalization.Because lipofection is simple and easy to use compared with the application of additive method, and transfection efficiency is higher, other chemical processes of transfection can be not easy the clone of transfection, thus use comparatively general.

Carrier is launch vehicle foreign gene being imported host cell, and expression vector system comprises virus and non-viral two kinds.Should having of virus vector often has certain potential safety hazard to exist, and major cause is that virus is easily integrated into genome, has immunogenicity.Although traditional plasmid vector is than virus vector safety, transfection efficiency is but very low, and very large for the consumption of transfection, and reach milligram level, thus cost is higher; Secondly traditional plasmid vector contains the hidden expression signal of germy replication origin, resistant gene, unmethylated CpG sequence and some possibility, although these sequences are required when the copying of plasmid, very serious biosafety issues may be brought out in the expression, treatment of goal gene.　

Minicircle dna (Minicircle DNA, MC DNA) be a kind of DNA structure of ring-type, the original plasmid MP of Minicircle is the novel carrier for expression of eukaryon of one of SBI company of U.S. exploitation, by the specific position of MP self, it can be made under the induction of pectinose to change micro-ring carrier Minicircle into, it had not both had germy replication origin, and again not containing resistant gene, to compare length less with other carrier.Research shows, Minicircle function vector is very strong, can long-term expression transgenosis in vivo or in external biological cells and tissues, compares with other carriers, the time that persistent transgene is expressed be the 10-1000 of other carriers doubly.Can't cause simultaneously eukaryotic stress non-viral formula inducible system, and expressing green fluorescent protein (green fluorescent protein, GFP), be convenient to observe and follow the tracks of, possess that transfection efficiency is high, the advantage such as long-term expression in body, and be simple and easy to use.

In prior art, carrier for expression of eukaryon research about the MRP S18 gene of pig used the carriers such as pcDNA3.1 (+), pEGFP-N1, but all contain bacterium replication origin and resistant gene in these carriers, these elements may make foreign gene reticent, thus be not suitable for preparing immortalized cells, and in prior art, there is not yet the relevant report of good carrier and restructuring micro-ring expression vector of MRP S18 gene.

Summary of the invention

The eucaryon that the object of the invention is to provide a kind of Minicircle plasmid (also claiming micro-ring plasmid) gene constructed with the MRP S18 of pig is recombinated micro-ring expression vector Minicircle-MRPS18, this expression vector can transfection relevant cell for the preparation of immortalized cells.

The technical scheme that the present invention takes is as follows:

Eucaryon for cellular immortalization is recombinated a micro-ring expression vector Minicircle-MRP S18, and built by the MRP S18 gene recombination of micro-ring plasmid and pig, its base sequence is as shown in sequence table.

The described eucaryon for cellular immortalization is recombinated micro-ring expression vector Minicircle-MRP S18, its preparation process is: first PCR clone pig MRP S18 gene, then the MRP S18 gene of clone is connected with plasmid pMD19-T, build pMD19-T-MRPS18 recombinant plasmid, the pMD19-T-MRPS18 recombinant plasmid built and micro-ring plasmid are carried out double digestion, connect, transform, picking positive bacteria drops into row bacterium liquid PCR and order-checking qualification, is collected by carrier correct for qualification and is the micro-ring expression vector Minicircle-MRP S18 of restructuring;

Detailed preparation process comprises the steps:

(1) the MRP S18 gene of PCR clone pig;

(2) the MRP S18 gene of clone in step (1) is connected with pMD19-T plasmid, builds pMD19-T-MRPS18 recombinant plasmid;

(3) recombinant plasmid pMD19-T-MRPS18 and Minicircle plasmid are carried out double digestion respectively, double digestion product connects, qualification, obtains eucaryon and to recombinate micro-ring expression vector Minicircle-MRP S18.

The described eucaryon stated for cellular immortalization is recombinated micro-ring expression vector Minicircle-MRP S18, is transformed enter transfectional cell for the preparation of immortalized cells by Tubofect reagent infection protocol.

Described transfectional cell is Hela cell.

The external source immutalizing gene that the present invention adopts is porcine mtdna ribosomal protein MRP S18 gene, and this gene is organized at each of pig all has distribution, and other foreign gene easily obtains relatively, because of but a safety, express stable foreign gene.Eucaryon for cellular immortalization provided by the present invention is recombinated micro-ring expression vector Minicircle-MRPS18, combine Minicircle plasmid vector and MRP S18 gene advantage separately specifically, prepared eucaryon is recombinated micro-ring expression vector, has persistent transgene expression time long; Can not cause eukaryotic stress non-viral formula inducible system, low immunogenicity, the advantage of safety and stability; And this plasmid expression vector expresses GFP, be convenient to follow the tracks of reaction; Possess simultaneously transfection efficiency high, be simple and easy to the advantages such as use, be thus suitable for transfection relevant cell, good immortalized cells can be obtained and prepare effect.

Accompanying drawing explanation

Fig. 1 is that eucaryon is recombinated the structure schematic flow sheet of micro-ring expression vector Minicircle-MRP S18;

Fig. 2 is MRP S18 gene PCR amplification, and wherein 1 is DNA molecular quality standard DL2000, and 2-4 is MRP S18 gene PCR amplification;

Fig. 3 is the bacterium liquid PCR result of pMD19-T-MRP S18 plasmid, and wherein 1 is DNA molecular quality standard DL2000, and 2-4 is the bacterium liquid PCR result of pMD19-T-MRP S18 plasmid;

Fig. 4 is the double digestion result of PMT19-MRP S18 cloning vector, and wherein 1 is DNA molecular quality standard DL2000, and 2 is the double digestion result of PMT19-MRP S18 cloning vector; 3 is PMT19-MRP S18; 4 is DNA molecular quality standard Wide Range DL15000;

Fig. 5 is the double digestion result of Minicircle carrier, and wherein 1 is DNA molecular quality standard Wide Range DL15000; 2 is the double digestion result of Minicircle carrier; 3 is Minicircle;

Fig. 6 is that eucaryon is recombinated the bacterium liquid PCR result of micro-ring expression vector Minicircle-MRP S18, and wherein 1 is DNA molecular quality standard DL2000, and 2-5 to recombinate the bacterium liquid PCR result of micro-ring expression vector Minicircle-MRP S18 for eucaryon;

Fig. 7 is that eucaryon is recombinated the induction result of micro-ring expression vector Minicircle-MRP S18, wherein 1 is DNA molecular quality standard Wide Range DL15000,2 is the single endonuclease digestion qualification result of Minicircle-MRP S18, and 3-4 is the induction result of Minicircle-MRP S18;

Fig. 8 is the mrna expression level result of MRPS18 gene in Hela cell;

Fig. 9 is the mrna expression level result of GFP gene in Hela cell;

Figure 10 is that Minicircle-MRP S18 expressed in the time length of HeLa cell; Wherein A is test group 48h (10X), B is test group 8d (10X), C be test group 15d (10X), D is test group 22d (10X), E is negative control group 48h(10X), F is negative control group 22d (10X);

Figure 11 is that mtt assay draws cell growth curve result;

Figure 12 is betagalactosidase activity detected result, and wherein A is test group (10X), B be blank group (10X), C be positive controls (10X), D is negative control group (10X);

Figure 13 is the expression result that immunochemical assays detects TERT in cell; Wherein A is test group 48h (10X), B be blank group 48h (10X), C is negative control group 48h (10X);

Figure 14 is Telomerase TRAP result; Wherein 1 is test group, and 2 is blank group, and 3 is positive controls.

Embodiment

Below in conjunction with embodiment the present invention will be further explained illustrate, with make those skilled in the art be convenient to understand and implement the present invention.

Before introducing specific embodiment, briefly introduce as follows to specimen in use source, main agents, equipment in embodiment, do not address content and be as the criterion with this area common equipment or reagent.

the MRP S18 gene of pig: the liver organization getting pig, tissue is stored in-80 DEG C after adopting liquid nitrogen flash freezer.

bacterial strain and plasmid: pMD19-T carrier (Code No. 3271), E.coli DH5 α bacterial strain (i.e. DH5 α competent cell, Code No. 9057) are purchased from the precious biotechnology company limited (TAKARA) in Dalian; MP plasmid, ZYCY10P3S2T E.coli bacterial strain purchased from American SBI company.

key instrument:

Thermograde pcr analysis instrument, Biometra, Germany;

JY600C electrophoresis apparatus and JY-SCZ-2 electrophoresis chamber, Jun Yi east, Beijing electrophoresis equipment company limited;

Labworks image acquisition and analysis software, UVP, Germany;

Trace ultraviolet spectrophotometer, Thermo NANODROP 1000;

Style clean bench on VD-850 type table, Suzhou purifies;

HH-S2 digital display electric-heated thermostatic water bath, Jin Yi;

Desk-type small whizzer 5424R, Eppendorf, Germany;

Shen energy lottery industry high precision numerical control shaking table, ChemStar plant and instrument company limited;

Automatic high pressure Autoclave, SANYO, Japan;

Constant-temperature incubation device, Eppendorf, Germany;

Micropipet, Eppendorf, Germany.

main agents and preparation:

Plasmid Mini Kit (AxyPrep Plasmid Miniprep Kit) is purchased from AXYGEN company;

Goat anti-rabbit antibodies is Japanese Zhong Shan Golden Bridge Products;

SanPrep pillar DNA glue reclaims test kit from Shanghai Sheng Gong biotechnology company limited;

20% L-arabinose purchased from American SBI company;

Nhe I(Code No:1622), Bam HI(Code No:1605), T4 DNA ligase, rTaq enzyme (Code No:RR902A), DL5000, DL2000, Wide Range DNA Marker15000, Trizol, Reverse Transcription, 5 × M-MLV Buffer(lot::A801A), 10mM dNTP mix(lot:BH2701A), Ribonuclease Inhibitor (lot:K6801CA, 40U/ μ L), M-MLV Reverse Transcriptase (lot:CK3401A, 200U/ μ L), oligo (dT) (lot:T401AA, 14nmol), Solution I(Code No. 6023), 10 × Green Buffer(Code No:1605), T4 DNA ligase (Code No:2040A), 10 × T4 DNA Ligase Buffer(Code No:2040A), SYBR Green mix (lot:AK3803) is purchased from TAKARA company,

Transfection reagent TurboFect is purchased from Thermo company;

In plasmid, extraction reagent kit is purchased from QIAGEN company;

DMEM substratum, 10% foetal calf serum, 0.25% pancreatin are Gibco Products;

Beta-galactosidase enzymes reporter gene detection kit is green skies biotechnology research institute product;

Zorubicin is purchased from Nanjing KaiJi Biology Science Development Co., Ltd;

The anti-human hTERT antibody of rabbit is purchased from Wuhan Boster Biological Technology Co., Ltd.;

DEPC water (lot:3A600180), Beijing ancient cooking vessel state;

Cut gel purification kit (numbering: SK8132), Shanghai Sheng Gong biotechnology company limited.

LB liquid nutrient medium: Tryptone(Tryptones) 10g, Yeast Extract(yeast extract) 5g, NaCl 5g.Compound method, weighs respectively according to formula, adds 800ml deionized water, and mixing makes it fully dissolve, and adds deionized water subsequently and is settled to 1000mL, with NaOH(5mol/L) solution adjust pH to 7.0, high pressure steam sterilization 30min.

Penbritin (Ampicillin) stock solution: take 1g penbritin in 15mL centrifuge tube, add appropriate aqua sterilisa, after fully dissolving, being settled to 10ml(final concentration is 100mg/mL), filtration sterilization is carried out, packing ,-20 DEG C of preservations with 0.22mm filtering membrane.During use, every 1mL LB liquid nutrient medium adds 1 μ L Amp stock solution, uses final concentration to be 100 μ g/mL.

Kantlex (Kanamycin) stock solution: take 0.5g Kanamycin and be placed in 15mL centrifuge tube, add appropriate aqua sterilisa, after abundant dissolving, being settled to 10mL(final concentration is 50mg/mL), filtration sterilization is carried out with 0.22mm filtering membrane, packing (1mL/ pipe) ,-20 DEG C of preservations.During use, every 1mL LB liquid nutrient medium adds this Kana stock solution of 1 μ L, uses final concentration to be 50 μ g/mL.

IPTG(isopropylthio-β-D galactoside) stock solution: take 1.2g IPTG and be placed in 50mL centrifuge tube, add appropriate aqua sterilisa, after fully dissolving, be settled to 50mL, final concentration is 24mg/mL, carries out filtration sterilization with 0.22mm filtering membrane, packing ,-20 DEG C of preservations.

The bromo-4-hydrogen of X-gal(5--3-indoles-β-D-galactoside) stock solution: take 1g X-gal in 50mL centrifuge tube, add 40ml DMF(dimethyl formamide), after abundant dissolving, be settled to 50mL, final concentration is (20mg/mL), carry out filtration sterilization with 0.22mm filtering membrane, packing, be placed in-20 DEG C of preservations.

Amp ⁺/ LB solid medium: first prepare 1L LB liquid nutrient medium according to formula, then add 15g agar powder (Agar powder), high pressure steam sterilization 30min.When substratum is cooled to 60 DEG C, add Ampicilin stock solution, be 100 μ g/mL to final concentration, fully mix, paved slat chain conveyor ware, 35mL/90mm culture dish.

Kana ⁺/ LB solid medium: first prepare 1L LB liquid nutrient medium according to formula, then add 15g agar powder (Agar powder), high pressure steam sterilization 30min.When substratum is cooled to 60 DEG C, add Kanamycin stock solution, be 50 μ g/mL to final concentration, fully mix, paved slat chain conveyor ware, 35mL/90mm culture dish.

50 × TAE electrophoretic buffer (pH8.0): take 242g Tris and 37.2g EDTA is placed in 1L beaker, add distilled water 800mL, fully dissolve, add 57.1mL Glacial acetic acid, after abundant mixing, adjust pH is 8.0, then adds distilled water and is settled to 1L.

The MTT solution of 5mg/ml: take 50mgMTT and be dissolved in 10ml phosphate buffered saline buffer, be made into 5mg/ml concentration, suction filtration is degerming, packing lucifuge-20 degree is preserved.

10% foetal calf serum substratum: the foetal calf serum 100ml adding deactivation in 900mlDMEM, after mixing, adjusts pH value to be that 7.0,0.45um filtering with microporous membrane is degerming, 4 DEG C of preservations.

Escherichia coli DH5a and ZYCY10P3S2T E.coli competent cell adopt CaCl ₂method amplification cultivation, is specially:

(1) the former bacterial classification of picking, at LB agar lining out, 37 DEG C of overnight incubation (12 ~ 16h);

(2) from picking single bacterium colony the bacterium flat board of activation, be inoculated in 2mL LB liquid nutrient medium, in 37 DEG C of shaking table overnight incubation; This bacterium liquid is inoculated in 50mL LB liquid nutrient medium with 1% volume ratio by next day, 37 DEG C of shaking table 2 ~ 3h, enlarged culturing; After muddiness, every 30min surveys an OD ₆₀₀, to OD ₆₀₀be about 0.3, stop cultivating;

(3) ice bath 10min, proceeds in 50mL centrifuge tube, 4 DEG C, the centrifugal 10min of 4000r/min;

(4) abandoning supernatant, with the 0.1mol/L CaCl of 10mL ice bath ₂after solution (autoclaving) re-suspended cell, ice bath 30min; Then in 4 DEG C, the centrifugal 10min of 4000r/min;

(5) abandoning supernatant, adds 0.1 mol/L CaCl of 2mL precooling ₂(containing 15 ﹪ glycerine, autoclavings), careful suspension cell;

(6) be placed in ice bath, be sub-packed in tubule with 100 μ L/ pipes, be placed in-80 DEG C of preservations.

Note: be operated in Bechtop above and operate, to avoid polluting.

embodiment 1

Eucaryon for cellular immortalization provided by the present invention is recombinated micro-ring expression vector Minicircle-MRPS18, and built by the MRP S18 gene recombination of micro-ring plasmid and pig, its base sequence is as shown in sequence table.

Eucaryon is recombinated micro-ring expression vector Minicircle-MRPS18, its preparation process as shown in Figure 1, be specially: first PCR clone pig MRP S18 gene, then the MRP S18 gene of clone is connected with plasmid pMD19-T, build pMD19-T-MRPS18 recombinant plasmid, the pMD19-T-MRPS18 recombinant plasmid built and micro-ring plasmid are carried out double digestion, connect, transform, picking positive bacteria drops into row bacterium liquid PCR and order-checking qualification, is collected by carrier correct for qualification and is the micro-ring expression vector Minicircle-MRPS18 of restructuring.

Detailed preparation process is described below:

(1) the MRP S18 gene of PCR clone pig;

1. the design of primer and synthesis

According to the nucleotide sequence of MRP S18 gene and the requirement of expression vector cloning site, design primer, primer is by Shanghai Sheng Gong biotechnology company limited design and synthesis, and concrete sequence is as follows:

F:5’-CTAGCTAGCGCCACCATGGCTGCCTCCATATTGAACGTG-3’，

R:5’-CGGGATCCCTACAGAGCACTTTGCGG-3’。

2. the extraction of total serum IgE in pig liver tissue

Total RNAs extraction adopts TRIZOL method, and step briefly introduces as follows:

From liquid nitrogen, take out the tissue of preservation, get about 100mg on masking foil, put into 2ml centrifuge tube, add 1 mL Trizol, with broken 45s abundant under tissue refiner's ice bath, room temperature leaves standstill 5min; Add 200 μ L chloroforms, concuss 3min, room temperature leaves standstill 2min; 4 DEG C of 12000 centrifugal 15min of rpm, can be observed sample and is divided into three layers, and careful upper strata aqueous phase (about 400 μ L) of drawing is transferred in a new 1.5mL centrifuge tube, and add isopyknic Virahol, after slowly putting upside down mixing up and down, room temperature leaves standstill 20 min, precipitated rna; 4 DEG C of 12000 centrifugal 10 min of rpm, supernatant discarded, precipitation 1mL 75% ethanol (preparation of DEPC water) washing, precipitation of upspringing; 4 DEG C of 12000 centrifugal 10 min of rpm, supernatant discarded, precipitation 1mL dehydrated alcohol suspends; 4 DEG C of centrifugal 5min of 12000rpm, supernatant discarded, back-off, on thieving paper, dries naturally; DEPC water 20 ~ 100 μ L appropriate according to how many use of precipitation dissolves ,-80 DEG C of preservations.

the total serum IgE reverse transcription of 3. extracting becomes cDNA

Reverse transcription: masterplate RNA1 μ g, oligo (dT) 1 μ L, adds DEPC water to 6 μ L, mixing wink from, ice bath 5min immediately after 70 DEG C of 10min, adds following reverse transcription system:

5 × M-MLV Buffer，2μL；

10mM dNTP mix，0.5μL；

Ribonuclease Inhibitor，0.25μL；

M-MLV Reverse Transcriptase，1μL；

DEPC water, 0.25 μ L.

The product prepared above is put into PCR instrument, is undertaken by following response procedures: 30 DEG C of 10 min, 42 DEG C of 1h, 72 DEG C of 10min, 14 DEG C of pause.

After reaction terminates, add the DEPC water of 50 μ L, gained cDNA is diluted 6 times, the cDNA of gained is placed in-20 DEG C and saves backup.

4. pcr amplification object fragment

PCR system:

ddH ₂O，8.5μL；

RTaq enzyme, 12.5 μ L;

Step is middle Primer F(10 pmol/ μ L 1.), 1 μ L;

Step is middle Primer R(10 pmol/ μ L 1.), 1 μ L;

Step is middle cDNA, 2 μ L 3.;

Reaction conditions: 95 DEG C of 5min, 95 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 70s, react 39 circulations, 72 DEG C of 10min.

PCR primer runs the agarose gel electrophoresis of 1%, the results are shown in Figure 2, reclaiming with cutting gel purification kit.

(2) the MRP S18 gene of clone in step (1) is connected with pMD19-T plasmid, builds pMD19-T-MRPS18 recombinant plasmid

Illustrate according to the precious biotechnology company limited pMD-19T carrier of TaKaRa, MRP S18 gene is connected with pMD-19T carrier.

Reaction system is as follows:

MRP S18 gene after pcr amplification in step (1), 1.5 μ L;

pMD-19T（50 ng /uL），1μL；

Solution I（TAKARA，Code No. 6023），5μL；

Distilled water, 2.5 μ L;

Connect temperature 16 DEG C, time 12h, places 5min on ice.

Get and get 10 μ L liquid rotatings after connection completes and dissolve in DH5 α competent cell, be evenly coated in (37 DEG C, 12 ~ 16h) on the LB culture plate containing penbritin (100 μ g/mL).The single bacterium colony of picking cultivates (37 DEG C, 5h) in containing (100 μ g/mL) LB nutrient solution of penbritin, carries out bacterium liquid PCR and identifies.

PCR identification system is as follows:

ddH ₂O，8.5μL；

RTaq enzyme, 12.5 μ L;

Primer F(10 pmol/ μ L in step (1)), 1 μ L;

Primer R(10 pmol/ μ L in step (1)), 1 μ L;

Bacterium liquid, 2 μ L.

Reaction conditions: 95 DEG C of 5min, 95 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 70s, react 39 circulations, 72 DEG C of 10min.

PCR primer runs the agarose gel electrophoresis of 1%, the results are shown in Figure 3.

(3) the micro-ring expression vector Minicircle-MRPS18 of restructuring is built

Respectively recombinant plasmid pMD19-T-MRPS18 and Minicircle plasmid are carried out double digestion, double digestion product connects, qualification, builds the micro-ring expression vector Minicircle-MRPS18 of restructuring.Specific as follows:

1. Minicircle plasmid and pMD19-T-MRP S18 recombinant plasmid carry out double digestion respectively

Enzyme cuts system:

NheI，1μl；

Bam HI，1μl；

10×Green Buffe，2μl；

Minicircle plasmid or the middle pMD19T-MRP S18 (100ng/ μ L, 9 μ L) of step (2);

High pressure distilled water, up to 20 μ L;

Enzyme Qie Wendu 37 DEG C, time 30min.

Digestion products runs the agarose gel electrophoresis of 1%, the results are shown in Figure 4 and Fig. 5.Recovery digestion products is carried out with cutting gel purification kit.

2. digestion products connects

Linked system:

T4 DNA ligase, 1 μ L;

10×T4 DNA Ligase Buffer，2.5μL；

Step is middle double digestion MRP S18 fragment (20ng/ μ L) 1., 1 μ L;

Step is middle double digestion Minicircle plasmid fragments (32.1ng/ μ L) 1., 3.5 μ L;

Aqua sterilisa, 12 μ L;

Connect temperature 16 DEG C, time 12h, places 5min on ice.

Get 10 μ L linked systems to be transformed in DH5 α competent cell, be evenly coated on the LB culture plate containing kantlex (50 μ g/mL).The single bacterium colony of picking is cultivated in containing the LB nutrient solution of kantlex (50 μ g/mL), carries out bacterium liquid PCR and identifies.

PCR identification system is as follows:

ddH ₂O，8.5μL；

RTaq enzyme, 12.5 μ L;

Primer F(10 pmol/ μ L in step (1)), 1 μ L;

Primer R(10 pmol/ μ L in step (1)), 1 μ L;

Bacterium liquid, 2 μ L.

Reaction conditions: 95 DEG C of 5min, 95 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 70s, react 39 circulations, 72 DEG C of 10min.PCR primer runs the agarose gel electrophoresis of 1%, the results are shown in Figure 6.

3. micro-ring plasmid Minicircle plasmid abduction delivering effect identification

Micro-ring expression vector of being recombinated by the step Minicircle-MRP S18 that 2. middle structure obtains is transformed into ZYCY10P3S2T competent cell, after 20% L-arabinose induction, cuts the effect identifying that micro-ring is induced with NheI enzyme.

Enzyme cuts system:

NheI，1μL；

10×Green Buffer，2μL；

pMD19T- MRP S18(100ng/μL) ，9μL；

High pressure distilled water, up to 20 μ l;

Enzyme Qie Wendu 37 DEG C, time 30min.

Digestion products runs the agarose gel electrophoresis of 1%, the results are shown in Figure 7.Result shows micro-ring plasmid Minicircle plasmid correction, and constructed Minicircle-MRP S18 micro-ring expression vector of recombinating can be used for transfectional cell.

embodiment 2

Eucaryon constructed by inspection embodiment 1 is recombinated the concrete technique effect of micro-ring expression vector Minicircle-MRP S18 in cellular immortalization, contriver is by after Minicircle-MRP S18 transfected with human uterine cancer cells Hela cell, have detected the expression of this gene on a cellular level further and carried out detecting that (cellular immortalization index has: real-time quantitative PCR detects the expression of GFP in the expression of gene and Minicircle to relevant cellular immortalization index, fluorescence duration time is observed, mtt assay cell growth curve is drawn, cell aging mark betagalactosidase activity detects, immunochemical assays detects the expression of TERT in cell, the detection of telomerase activation), be specifically described as follows.

1. to recombinate micro-ring expression vector Minicircle-MRP S18 transfection Hela cell

With the DMEM nutrient solution containing 10% inactivated fetal bovine serum, at 5% CO ₂, cultivator uterine cancer cells Hela cell under 37 DEG C of conditions, adopt the transfection of Tubofect reagent infection protocol; Be provided with the Hela cell of Minicircle transfection in contrast simultaneously.

2. real-time fluorescence quantitative PCR detects MRP S18 gene, the expression of GFP in Hela cell

For inspection MRP S18 gene, the expression of GFP in Hela cell, contriver is extracted total serum IgE respectively and carries out RT-PCR and synthesizes cDNA from the normal Hela cell of the Hela cell of the Hela cell of transfection Minicircle-MRP S18, transfection Minicircle, untransfected, is carried out the detection of mrna expression by Real time Q-PCR.MRNA relative expression quantity result GraphPad Prism 5 statistical software analyzing and processing.

As shown in Figure 8, show for MRP S18 gene expression results, the Hela cell of transfection Minicircle-MRP S18 is compared with the Hela cell of transfection Minicircle, and MRP S18 gene expression dose significantly raises.

As shown in Figure 9, the expression of results for GFP shows, the Hela cell of transfection Minicircle-MRP S18 is compared with the Hela cell of transfection Minicircle, and the expression level of GFP is without significant difference.

Concrete steps are as follows:

Recombinated by transfection eucaryon respectively after micro-Hela cell of ring expression vector Minicircle-MRP S18, the Hela cell of Minicircle and normal Hela cell cultures 48h and carry total serum IgE, reverse transcription becomes cDNA, by the cDNA stoste DEPC-H of each sample ₂o carries out 50 times of dilutions, using the cDNA after dilution as reaction template, each gene of single sample is all done 3 holes and is repeated to reduce testing error, respectively with the GFP Q-PCR in MRP S18, Minicircle plasmid fragments for primer, with people β-actin for internal reference, carry out Real Time PCR.Primer is synthesized by the precious biotechnology company limited in Dalian.

MRP S18 Q-PCR primer sequence:

Upstream is GGGACCTTGACTTCAGTACCACTC,

Downstream is GCTCTCTCTCTGGTGGCTGTTT;

GFP Q-PCR primer sequence:

Upstream is CGCATGACCAACAAGATGAAG,

Downstream is GGTAGGTGCCGAAGTGGGATA;

β-actin Q-PCR primer sequence:

Upstream is GGGTCAGA AGGATTCCTATG,

Downstream is GGTCTCAAACATGATCTGGG.

Fluorescence quantitative PCR detection genes involved: to dilute the cDNA of rear each sample as reaction template, the individual gene of each sample does 3 holes and repeats for reducing the error in testing, and each sample all has house-keeping gene β-actin in contrast.Reaction system is as follows:

　　 SYBR Green mix ，5μL；

Upstream primer (20 pmol/ μ L), 0.1 μ L;

Downstream primer (20 pmol/ μ L), 0.1 μ L;

　　　　 cDNA，1.25uL；

DEPC water, 3.55 μ L.

Optimum response program is: 95 DEG C of 2min, 95 DEG C of 15s, 60 DEG C of 20s, 40 circulations, 72 DEG C of 20s.

In the extension stage that the capture setting of fluorescent signal reacts at PCR, threshold value and baseline are generated automatically by software.After amplification program is arranged, then insert the response procedures of melting curve, specific procedure is: 95 DEG C of 15s, 60 DEG C of 15s, 95 DEG C of 15s.

3. Minicircle-MRP S18 eucaryon is recombinated the observation of fluorescence duration time after micro-ring expression vector transfection Hela cell

Before transfection, 8h will be in the Hela cell of logarithmic phase with l × 10 ⁵the density in/hole is inoculated in 12 orifice plates, when Growth of Cells reaches 40%-60% degrees of fusion, carry out transfection by Tubofect transfection reagent box specification sheets, the Hela cell of not Pignus pignoris grain is set as negative control group, observe respective fluorescing matter after 24 h, continuous observation is until fluorescence disappears.

Take pictures result as shown in Figure 10 with fluorescent microscope.

As we can see from the figure, proceed to the recombinate cell of micro-ring expression vector of Minicircle-MRP S18 and occurred green fluorescence (figure A), show that micro-ring expression vector Successful transfection enters in cell, when continuous observation is to 22d, fluorescence disappears (figure D), shows that expression effect is comparatively lasting.

4. the drafting of mtt assay cell growth curve

Experiment is divided into 3 groups: the blank group of transfection Minicircle, transfection Minicircle-MRP S18 genome, the normal Hela cell of untransfected plasmid.Transfection added MTT liquid (5mg/mL) 10uL in every hole after 6 hours, and cultivate 4h in incubator after, abandon supernatant, every hole adds 150uL DMSO (saikebio, CAS:67685).Concussion makes crystallization fully dissolve, and multi-functional microplate reader measures optical density A _492nm.Continuous detecting, after 5 days, analyzes optical density A _492nmvalue take time as X-coordinate, with OD value for ordinate zou makes growth curve chart, as shown in figure 11.Result shows that the growth of pig MRPS18 gene pairs Hela cell has suppression, but growth tendency is normal.

5. beta-galactosidase enzymes reporter gene detects

Beta-galactosidase enzymes is a kind of reporter gene of conventional old and feeble mark, can carry out native staining, just can observe the expression of the beta-galactosidase enzymes in cell or tissue under an optical microscope.

With beta-galactosidase enzymes native staining test kit (green skies biotechnology research institute, numbering: C0602) expression of right beta-galactosidase enzymes reporter gene has carried out Testing and appraisal.Experiment is divided into 4 groups: the blank group of transfection Minicircle, transfection Minicircle-MRP S18 test group, the positive controls after the negative control group do not stimulated of normal Hela and the aging of normal Hela irritation cell.

Beta-galactosidase enzymes native staining test kit take X-Gal as substrate, beta-galactosidase enzymes can catalysis its generate mazarine product, under simple microscope, just can observe the cell of the aging becoming blueness like this.Can observe according to cell dyeing situation, cell dyeing au bleu illustrates cell aging, and dyeing illustrates that aging is more obvious more deeply.As shown in figure 12, the aging of result display MRP S18 to cell has restraining effect to result.

6. immunochemical assays detects the expression of TERT in cell

1 μ g Minicircle-MRP S18 Transfected Recombinant Plasmid is entered in Hela cell as test group, arrange the negative control group of untransfected and normal Hela cell, the blank group of transfected plasmids Minicircle does the expression that immunochemical assays observes TERT simultaneously.

Do immunohistochemical methods after 48h, the expression of the TERT in observation of cell, the TERT expression amount that dyeing represents in cell is more deeply higher.Result shows, and MRPS18 can promote the expression of TERT in cell.As Figure 13.

Concrete steps are as follows:

Fixing: sucking-off substratum, PBS (doctor's moral, 0.1M) washes 2 times, and cold acetone (Yantai City is Chemical Co., Ltd. in pairs, lot number 265141) fixes 10min.

Sucking-off acetone, adds PBS and cleans 5min.Slide takes out and dries.

Drip 1:300(PBS) the rabbit against human T ERT antibody (Wuhan Boster Biological Technology Co., Ltd.) that dilutes, put in wet box, 37 DEG C, 1h.

Take out slide, PBS shake washes 3 times, and each 5min, dries up.

Drip 1:100(PBS) goat anti-rabbit antibodies (company of Japanese Zhong Shan Golden Bridge) of diluting, be placed in wet box, 37 DEG C, 1h.

Take out slide, PBS shake washes 3 times, and each 5min, dries up.

Develop the color DAB (Zhong Shan Golden Bridge, ZLI-9017/9018/9019) 10min, room temperature.

Tap water (stopping DAB dyeing).

Resinene (Chinese Shanghai sample model factory) mounting, to take pictures.

7. the detection of telomerase activation

1 μ g Minicircle-MRP S18 Transfected Recombinant Plasmid is entered in Hela cell as test group, untransfected and normal Hela cell positive control group are set simultaneously, the blank group of transfected plasmids Minicircle, carry out the detection of Cell Telomerase Activity after cultivating 48h, result is as Figure 14.Telomerase test kit (the triumphant base in Nanjing is biological, CAT NO.KGA413) shows the positive findings of the stepped separation of interval 6bp in gel electrophoresis, and the large I of telomerase activation obtains the depth by band and how much illustrates.Result shows that MRP S18 can strengthen the activity of Telomerase.Concrete operations are as follows.

Rotaring redyeing system:

Plasmid, 1 μ g;

DMEM (serum-free) (Gibco company, lot NO.1233130), 100 μ L;

Transfection reagent, 2 μ L;

Leave standstill 5min by after plasmid and DMEM mixing, add transfection reagent mixing, leave standstill 15min, be added drop-wise in 12 orifice plates, limit edged slowly shakes, and 12h changes liquid.

SEQUENCE LISTING

<110> Agricultural University Of He'nan

<120> eucaryon for cellular immortalization is recombinated micro-ring expression vector

<130> none

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 7040

<212> DNA

<213> eucaryon is recombinated micro-ring expression vector Minicircle-MRP S18

<400> 1

acattaccct gttatcccta gatgacatta ccctgttatc ccagatgaca ttaccctgtt 60

atccctagat gacattaccc tgttatccct agatgacatt taccctgtta tccctagatg 120

acattaccct gttatcccag atgacattac cctgttatcc ctagatacat taccctgtta 180

tcccagatga cataccctgt tatccctaga tgacattacc ctgttatccc agatgacatt 240

accctgttat ccctagatac attaccctgt tatcccagat gacataccct gttatcccta 300

gatgacatta ccctgttatc ccagatgaca ttaccctgtt atccctagat acattaccct 360

gttatcccag atgacatacc ctgttatccc tagatgacat taccctgtta tcccagatga 420

cattaccctg ttatccctag atacattacc ctgttatccc agatgacata ccctgttatc 480

cctagatgac attaccctgt tatcccagat gacattaccc tgttatccct agatacatta 540

ccctgttatc ccagatgaca taccctgtta tccctagatg acattaccct gttatcccag 600

atgacattac cctgttatcc ctagatacat taccctgtta tcccagatga cataccctgt 660

tatccctaga tgacattacc ctgttatccc agataaactc aatgatgatg atgatgatgg 720

tcgagactca gcggccgcgg tgccagggcg tgcccttggg ctccccgggc gcgactagtg 780

aattgatact agtattatgc ccagtacatg accttatggg actttcctac ttggcagtac 840

atctacgtat tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg 900

cgtggatagc ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg 960

agtttgtttt ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca 1020

ttgacgcaaa tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcgttta 1080

gtgaaccgtc agatcgcctg gagacgccat ccacgctgtt ttgacctcca tagaagattc 1140

tagaggatcc gcggccgcaa ggatctgcga tcgctccggt gcccgtcagt gggcagagcg 1200

cacatcgccc acagtccccg agaagttggg gggaggggtc ggcaattgaa cgggtgccta 1260

gagaaggtgg cgcggggtaa actgggaaag tgatgtcgtg tactggctcc gcctttttcc 1320

cgagggtggg ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc tttttcgcaa 1380

cgggtttgcc gccagaacac agctgaagct tcgaggggct cgcatctctc cttcacgcgc 1440

ccgccgccct acctgaggcc gccatccacg ccggttgagt cgcgttctgc cgcctcccgc 1500

ctgtggtgcc tcctgaactg cgtccgccgt ctaggtaagt ttaaagctca ggtcgagacc 1560

gggcctttgt ccggcgctcc cttggagcct acctagactc agccggctct ccacgctttg 1620

cctgaccctg cttgctcaac tctacgtctt tgtttcgttt tctgttctgc gccgttacag 1680

atccaagctg tgaccggcgc ctacgctaga cgccaccatg gagagcgacg agagcggcct 1740

gcccgccatg gagatcgagt gccgcatcac cggcaccctg aacggcgtgg agttcgagct 1800

ggtgggcggc ggagagggca cccccaagca gggccgcatg accaacaaga tgaagagcac 1860

caaaggcgcc ctgaccttca gcccctacct gctgagccac gtgatgggct acggcttcta 1920

ccacttcggc acctacccca gcggctacga gaaccccttc ctgcacgcca tcaacaacgg 1980

cggctacacc aacacccgca tcgagaagta cgaggacggc ggcgtgctgc acgtgagctt 2040

cagctaccgc tacgaggccg gccgcgtgat cggcgacttc aaggtggtgg gcaccggctt 2100

ccccgaggac agcgtgatct tcaccgacaa gatcatccgc agcaacgcca ccgtggagca 2160

cctgcacccc atgggcgata acgtgctggt gggcagcttc gcccgcacct tcagcctgcg 2220

cgacggcggc tactacagct tcgtggtgga cagccacatg cacttcaaga gcgccatcca 2280

ccccagcatc ctgcagaacg ggggccccat gttcgccttc cgccgcgtgg aggagctgca 2340

cagcaacacc gagctgggca tcgtggagta ccagcacgcc ttcaagaccc ccatcgcctt 2400

cgccagatcc cgcgctcagt cgtccaattc tgccgtggac ggcaccgccg gacccggctc 2460

caccggatct cgctaagtcg acaatcaacc tctggattac aaaatttgtg aaagattgac 2520

tggtattctt aactatgttg ctccttttac gctatgtgga tacgctgctt taatgccttt 2580

gtatcatgct attgcttccc gtatggcttt cattttctcc tccttgtata aatcctggtt 2640

gctgtctctt tatgaggagt tgtggcccgt tgtcaggcaa cgtggcgtgg tgtgcactgt 2700

gtttgctgac gcaaccccca ctggttgggg cattgccacc acctgtcagc tcctttccgg 2760

gactttcgct ttccccctcc ctattgccac ggcggaactc atcgccgcct gccttgcccg 2820

ctgctggaca ggggctcggc tgttgggcac tgacaattcc gtggtgttgt cggggaaatc 2880

atcgtccttt ccttggctgc tcgcctgtgt tgccacctgg attctgcgcg ggacgtcctt 2940

ctgctacgtc ccttcggccc tcaatccagc ggaccttcct tcccgcggcc tgctgccggc 3000

tctgcggcct cttccgcgtc ttcgccttcg ccctcagacg agtcggatct ccctttgggc 3060

cgcctccccg cctggtacct ttaagaccaa tgacttacaa ggcagctgta gatcttagcc 3120

actttttaaa agaaaagggg ggactggaag ggctaattca ctcccaacga aaataagatc 3180

tgctttttgc ttgtactggg tctctctggt tagaccagat ctgagcctgg gagctctctg 3240

gctaactagg gaacccactg cttaagcctc aataaagctt gccttgagtg cttcaagtag 3300

tgtgtgcccg tctgttgtgt gactctggta actagagatc cctcagaccc ttttagtcag 3360

tgtggaaaat ctctagcagt agtagttcat gtcatcttat tattcagtat ttataacttg 3420

caaagaaatg aatatcagag agtgagagga acttgtttat tgcagcttat aatggttaca 3480

aataaagcaa tagcatcaca aatttcacaa ataaagcatt tttttcactg cattctagtt 3540

gtggtttgtc caaactcatc aatgtatctt atcatgtctg gctctagcta tcccgcccct 3600

aactccgccc agttccgccc attctccgcc cctcccgccc ctaactccgc ccaatggctg 3660

actaattttt tttatttatg cagaggccga ggccgcctcg gcctctgagc tattccagaa 3720

gtagtgagga ggcttttttg gaggcctaga cttttgcaga tcgacccatg ggggcccgcc 3780

ccaactgggg taacctttga gttctctcag ttgggggtaa tcagcatcat gatgtggtac 3840

cacatcatga tgctgattat aagaatgcgg ccgccacact ctagtggatc tcgagttaat 3900

aattcagaag aactcgtcaa gaaggcgata gaaggcgatg cgctgcgaat cgggagcggc 3960

gataccgtaa agcacgagga agcggtcagc ccattcgccg ccaagctctt cagcaatatc 4020

acgggtagcc aacgctatgt cctgatagcg gtccgccaca cccagccggc cacagtcgat 4080

gaatccagaa aagcggccat tttccaccat gatattcggc aagcaggcat cgccatgggt 4140

cacgacgaga tcctcgccgt cgggcatgct cgccttgagc ctggcgaaca gttcggctgg 4200

cgcgagcccc tgatgctctt cgtccagatc atcctgatcg acaagaccgg cttccatccg 4260

agtacgtgct cgctcgatgc gatgtttcgc ttggtggtcg aatgggcagg tagccggatc 4320

aagcgtatgc agccgccgca ttgcatcagc catgatggat actttctcgg caggagcaag 4380

gtgtagatga catggagatc ctgccccggc acttcgccca atagcagcca gtcccttccc 4440

gcttcagtga caacgtcgag cacagctgcg caaggaacgc ccgtcgtggc cagccacgat 4500

agccgcgctg cctcgtcttg cagttcattc agggcaccgg acaggtcggt cttgacaaaa 4560

agaaccgggc gcccctgcgc tgacagccgg aacacggcgg catcagagca gccgattgtc 4620

tgttgtgccc agtcatagcc gaatagcctc tccacccaag cggccggaga acctgcgtgc 4680

aatccatctt gttcaatcat gcgaaacgat cctcatcctg tctcttgatc agagcttgat 4740

cccctgcgcc atcagatcct tggcggcgag aaagccatcc agtttacttt gcagggcttc 4800

ccaaccttac cagagggcgc cccagctggc aattccggtt cgcttgctgt ccataaaacc 4860

gcccagtcta gctatcgcca tgtaagccca ctgcaagcta cctgctttct ctttgcgctt 4920

gcgttttccc ttgtccagat agcccagtag ctgacattca tccggggtca gcaccgtttc 4980

tgcggactgg ctttctacgt gctcgagggg ggccaaacgg tctccagctt ggctgttttg 5040

gcggatgaga gaagattttc agcctgatac agattaaatc agaacgcaga agcggtctga 5100

taaaacagaa tttgcctggc ggcagtagcg cggtggtccc acctgacccc atgccgaact 5160

cagaagtgaa acgccgtagc gccgatggta gtgtggggtc tccccatgcg agagtaggga 5220

actgccaggc atcaaataaa acgaaaggct cagtcgaaag actgggcctt tcgttttatc 5280

tgttgtttgt cggtgaacgc tctcctgagt aggacaaatc cgccgggagc ggatttgaac 5340

gttgcgaagc aacggcccgg agggtggcgg gcaggacgcc cgccataaac tgccaggcat 5400

caaattaagc agaaggccat cctgacggat ggcctttttg cgtttctaca aactcttttg 5460

tttatttttc taaatacatt caaatatgta tccgctcatg accaaaatcc cttaacgtga 5520

gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc 5580

tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt 5640

ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc 5700

gcagatacca aatactgtcc ttctagtgta gccgtagtta ggccaccact tcaagaactc 5760

tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg 5820

cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg 5880

gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga 5940

actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc 6000

ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg 6060

gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg 6120

atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt 6180

tttacggttc ctggcctttt gctggccttt tgctcacatg ttctttcctg cgttatcccc 6240

tgattctgtg gataaccgta ttaccgcctt tgagtgagct gataccgctc gccgcagccg 6300

aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa gagcgcctga tgcggtattt 6360

tctccttacg catctgtgcg gtatttcaca ccgcatatgg tgcactctca gtacaatctg 6420

ctctgatgcc gcatagttaa gccagtatac actccgctat cgctacgtga ctgggtcatg 6480

gctgcgcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg 6540

gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca 6600

ccgtcatcac cgaaacgcgc gaggcagcag atcaattcgc gcgcgaaggc gaagcggcat 6660

gcataatgtg cctgtcaaat ggacgaagca gggattctgc aaaccctatg ctactccgtc 6720

aagccgtcaa ttgtctgatt cgttaccaat tatgacaact tgacggctac atcattcact 6780

ttttcttcac aaccggcacg gaactcgctc gggctggccc cggtgcattt tttaaatacc 6840

cgcgagaaat agagttgatc gtcaaaacca acattgcgac cgacggtggc gataggcatc 6900

cgggtggtgc tcaaaagcag cttcgcctgg ctgatacgtt ggtcctcgcg ccagcttaag 6960

acgctaatcc ctaactgctg gcggaaaaga tgtgacagac gcgacggcga caagcaaaca 7020

tgctgtgcga cgctggcgat 7040

Claims (4)

1. the eucaryon for cellular immortalization is recombinated micro-ring expression vector Minicircle-MRP S18, it is characterized in that, this restructuring micro-ring expression vector is built by the MRP S18 gene recombination of micro-ring plasmid Minicircle and pig, and its base sequence is as shown in sequence table.

2. eucaryon described in claim 1 is recombinated the preparation method of micro-ring expression vector Minicircle-MRP S18, it is characterized in that, comprises the steps:

(1) the MRP S18 gene of PCR clone pig;

(2) the MRP S18 gene of clone in step (1) is connected with pMD19-T plasmid, builds pMD19-T-MRPS18 recombinant plasmid;

(3) recombinant plasmid pMD19-T-MRPS18 and Minicircle plasmid are carried out double digestion respectively, double digestion product connects, qualification, obtains the micro-ring expression vector Minicircle-MRP S18 of restructuring.

3. the micro-ring expression vector Minicircle-MRP S18 that recombinates of eucaryon described in claim 1 is preparing the application in immortalized cells.

4. eucaryon micro-ring expression vector Minicircle-MRP S18 that recombinates is preparing the application in immortalized cells as claimed in claim 3, it is characterized in that, micro-ring expression vector Minicircle-MRP S18 that recombinated by eucaryon is by Tubofect reagent infection protocol transfection Hela cell.