CN108103243A - The detection method of one boar encephalitis B virus genetic stability and application - Google Patents
The detection method of one boar encephalitis B virus genetic stability and application Download PDFInfo
- Publication number
- CN108103243A CN108103243A CN201810007565.0A CN201810007565A CN108103243A CN 108103243 A CN108103243 A CN 108103243A CN 201810007565 A CN201810007565 A CN 201810007565A CN 108103243 A CN108103243 A CN 108103243A
- Authority
- CN
- China
- Prior art keywords
- virus
- encephalitis
- pig
- genetic stability
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Detection method and application the present invention provides a boar encephalitis B virus genetic stability, belong to bioengineering field.The present invention cultivates the host strain bacterium solution containing pig encephalitis B virus plasmid by recovering, and carry out the secondary culture of continuous multi-generation, certain algebraically is spaced to sample and detect, genetic stability by the host strain containing pig encephalitis B virus plasmid for detecting artificial preservation provides reliable support for research pig encephalitis B virus and ensures；Above-mentioned detection method is applied in pig encephalitis B virus culture, or the research and culture of pig encephalitis B virus provide reference and uses for reference, and have important application value.
Description
Technical field
The present invention relates to bioengineering field, in particular to the detection side of a boar encephalitis B virus genetic stability
Method and application.
Background technology
Epidemic encephalitis B virus abbreviation encephalitis B virus.The pathogen of Japanese Type-B encephalitis.In spherical, nucleic acid is single
Chain RNA, outer layer tool coating, envelope membrane surface have hemagglutinin.Under cryogenic conditions, can long period from bottom to top, animal, chicken embryo and
It can be proliferated in tissue culture cells.Piglet is major source of infection and the intermediate host of encephalitis B virus, and mosquito is encephalitis B virus
Communication media.
Livestock and poultry infects encephalitis B virus, generally subclinical infection in epidemic season, but virus can be proliferated in vivo at it,
Blood flow is invaded, causes of short duration viremia virusemia, becomes the temporary reservoir host of encephalitis B virus, propagate, become repeatedly through mosquito bite
The infection sources of the mankind.Particularly newborn pig is mostly important then, susceptible to encephalitis B virus, forms the propagation ring of pig-mosquito-pig
Section.The research of current few stability for the artificial preservation of pig encephalitis B virus.
The content of the invention
The first object of the present invention is the detection method for providing pig encephalitis B virus genetic stability, passes through this detection side
Method can have the genetic stability of pig encephalitis B virus more reliable understanding, be provided reliably for the research of pig encephalitis B virus
It supports.
The detection method that the second object of the present invention is to provide above-mentioned pig encephalitis B virus genetic stability is in pig encephalitis disease
Application in poison culture.
In order to realize the above-mentioned purpose of the present invention, using following technical scheme：
The detection method of one boar encephalitis B virus genetic stability, including：
The host strain bacterium solution containing pig encephalitis B virus plasmid is cultivated in fluid nutrient medium；
Continuous passage culture host strain bacterium solution；
The host strain bacterium solution of interval sampling secondary culture simultaneously carries out genetic stability detection.
Application of the detection method of above-mentioned pig encephalitis B virus genetic stability in pig encephalitis B virus culture.
Beneficial effects of the present invention are：The present invention cultivates the host strain bacterium solution containing pig encephalitis B virus plasmid by recovering,
And carry out the secondary culture of continuous multi-generation, be spaced certain algebraically and sample and detect, by detect artificial preservation containing pig second
The genetic stability of the host strain of encephalovirus plasmid provides reliable support for research pig encephalitis B virus and ensures；By above-mentioned inspection
Survey method is applied in pig encephalitis B virus culture, or the research and culture of pig encephalitis B virus provide reference and uses for reference, tool
There is important application value.
Description of the drawings
It in order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair
The restriction of scope, for those of ordinary skill in the art, without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Fig. 1 is the colonial morphology figure for the 5th generation Escherichia coli that experimental example 4 of the present invention provides；
Fig. 2 is the colonial morphology figure for the 15th generation Escherichia coli that experimental example 4 of the present invention provides；
Fig. 3 is the colonial morphology figure for the 25th generation Escherichia coli that experimental example 4 of the present invention provides；
Fig. 4 is the colonial morphology figure for the 40th generation Escherichia coli that experimental example 4 of the present invention provides；
Fig. 5 is the PCR electrophoresis result figures that experimental example 4 of the present invention provides；
Fig. 6 is the PCR electrophoresis result figures that experimental example 4 of the present invention provides；
Fig. 7 is the 5th generation Escherichia coli biochemical test result figure that experimental example 4 of the present invention provides；
Fig. 8 is the 15th generation Escherichia coli biochemical test result figure that experimental example 4 of the present invention provides；
Fig. 9 is the 25th generation Escherichia coli biochemical test result figure that experimental example 4 of the present invention provides；
Figure 10 is the 40th generation Escherichia coli biochemical test result figure that experimental example 4 of the present invention provides.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will
Understand, the following example is merely to illustrate the present invention, and is not construed as limiting the scope of the invention.It is not specified in embodiment specific
Condition person, the condition suggested according to normal condition or manufacturer carry out.Reagents or instruments used without specified manufacturer is
The conventional products that can be obtained by commercially available purchase.
Epidemic encephalitis B virus clinical signs are high fever, the disturbance of consciousness, twitch, intracranial pressure rise and meningeal irritation
Disease.Severe may die of respiratory and circulatory failure, and some patientss leave the sequelae such as aphasia, tonic spasm, psychiatric disorder after being ill.
After pig-pig infection encephalitis B virus, its growth development is seriously affected；Tremendous influence is brought to pig-breeding, in addition,
If peddled after the live pig to catch an illness is slaughtered, to consumer and a kind of insecurity, therefore to the detection of pig encephalitis B virus
It is exactly necessary；And the genetic stability of the especially artificial storage conditions of the genetic stability of pig encephalitis B virus is also necessary.
The detection method to a boar encephalitis B virus genetic stability of the embodiment of the present invention and application carry out specific below
Explanation.
The detection method of one boar encephalitis B virus genetic stability, including：
The host strain bacterium solution containing pig encephalitis B virus plasmid is cultivated in fluid nutrient medium；
Continuous passage culture host strain bacterium solution；
The host strain bacterium solution of interval sampling secondary culture simultaneously carries out genetic stability detection.
Virus usually requires host's energy growth and breeding, therefore the cell for having infected pig encephalitis B virus is cultivated and protected
It deposits, realizes and indirectly preserve pig encephalitis B virus；Host strain containing pig encephalitis B virus plasmid has in preserving process and in passage
Pig encephalitis B virus plasmid may be caused to be lost from host cell, cause the failure of preservation or the passage of pig encephalitis B virus plasmid,
Therefore the host strain containing pig encephalitis B virus plasmid for having carried out mostly generation passage is identified, it will be appreciated that contain pig encephalitis
The genetic stability of the host strain of virus particle.
Pig encephalitis B virus plasmid is by cccagtacgataccaaacttcagcagtgcagagagagcac
caagggaatgaaatagtggatgtgatgtgccatgccactctgacccacagattgatgtcaccgaacagagtgcccaa
ctataacctatttgtcatggatgaagctcatttcaccgacccagccagtatagccgcacgaggatacatcgctacca
aggtggaattaggagaggcagcagccatctttatgacagcgaccccgcctggaaccacggatccttttcctgactca
aatgccccaatccatgatctacaagatgagataccagacagggcatggagcagtggatacgaatggatcacagaata
tgcgggtaaaaccgtgtggtttgtggcgagcgtaaaaatggggaatgaaattgcaatgtgcctccaaagagcgggaa
Aaaaggtcatccaactcaaccgcaagtcctatgacacagaatacccaaaatg is connected to pUC-57 to be obtained on carrier.
The upstream sequence SEQ NO.1 for identifying primer are：5’-AGAGAGAGCACCAAGGGAATG-3’；
The downstream sequence SEQ NO.2 for identifying primer are：5’-CTTGCGGTTGAGTTGGATGAC-3’；
The fragment length of detection primer amplification is 422bp.
Further, the inoculum concentration of host strain bacterium solution is the 1%-10% of the volume of fluid nutrient medium.
Host strain and fluid nutrient medium keep a rational inoculative proportion, it is ensured that bacterium solution can recover faster and into
Enter logarithmic phase, the time of saving experiment that can be larger, accelerate experiment process.
Further, host strain bacterium solution is glycerine bacterium solution.
Usual glycerol stock is low-temperature preservation, since glycerine has antifreeze effect, by adding glycerine, can be effectively protected
Bacterial strain is not destroyed in cryogenic conditions；And since glycerine has the effect of moisturizing, can preferably ensure the moisture of bacterium solution, it protects
Demonstrate,prove the activity of strain.
Further, the preparation of glycerine bacterium solution includes：
The virus particle of the encephalitis B virus containing pig is transformed into competent escherichia coli cell, is identified by primer detection,
Obtain positive recombination bacillus coli；
Recombination bacillus coli is cultivated, and adds glycerine and glycerine culture presevation is made.
Further, competent escherichia coli cell is one in TOP10 cells, DH5 α cells and BL21 (DE3) cell
Kind.
Since the growth of Escherichia coli is rapid, using Escherichia coli as host strain, pass through culture and the passage of simply recovering
Culture, can comparatively fast obtain substantial amounts of bacterium solution, you can to obtain the virus particle of substantial amounts of pig encephalitis B virus.
Further, the volume ratio of the virus particle of the encephalitis B virus containing pig and competent escherichia coli cell is 1-4:100.
By controlling the ratio of virus particle and competent escherichia coli cell, the transformation efficiency of plasmid can be improved.
Further, the concentration of the virus particle of the encephalitis B virus containing pig is 0.1-10ng/ μ L.
Further, the method for conversion is：The virus particle and competent escherichia coli cell of the encephalitis B virus containing pig are mixed,
25-37min is placed on ice；Heat shock 60-100s, places 2-3min on ice.
Further, Testing and appraisal is reacted by PCR and realized, the annealing temperature of PCR reactions is 52-58 DEG C.
Application of the detection method of above-mentioned pig encephalitis B virus genetic stability in pig encephalitis B virus culture.
The feature and performance of the present invention are described in further detail with reference to embodiments.
Embodiment 1
The present embodiment provides the detection method of a boar encephalitis B virus genetic stability, pig encephalitis B virus genetic stability
Detection method includes the virus particle of pig encephalitis B virus being transformed into host strain cell, then by the disease containing pig encephalitis B virus
Glycerol stock is made in the host strain of toxin grain, by cultivating and passing on glycerol stock, the genetic stability of identification passage glycerol stock.
The competent cell of DH5 α is selected to implement certainly in others as competent escherichia coli cell in the present embodiment
In mode other competent escherichia coli cells can also be selected to be tested, such as TOP10 cells or BL21 (DE3) cell.
The conversion of plasmid is as follows：
1.1 take the competent cell of 100 μ L bacillus coli DH 5 alphas to be added in EP pipes, and melt on ice；
1.2 take 1 μ L concentration be 0.1ng/ μ L pig encephalitis B virus virus particle be added to melted in EP pipes it is big
In the competent cell of enterobacteria DH5 α, 25min is placed on ice；
1.3 by EP pipes under 42 DEG C of temperature conditionss heat shock 60s, by EP pipes fast transfer to cooled on ice 2min；
1.4 add in the LB liquid medium without antibiotic of 200 μ L, 150rpm cultures 45min in EP pipes；
1.5 take the bacterium solution even spread of 50 μ L to LB solid mediums (Amp+) on, 37 culture 16h.
The identification of positive host strain
From the LB solid mediums (Amp of step 1.5+) on the single spot of picking 10 respectively, cultivated in LB fluid nutrient mediums, so
Bacterium solution PCR identifications are carried out afterwards；Using the reaction system of 21.5 μ L：10 × PCR Buffer2.5 μ L, dNTPs Mixture
(2.5mM) 2 μ L, each 0.25 μ L of upstream and downstream primer, 2 μ L, Taq archaeal dna polymerase of bacterium solution (template), 1 μ L, and add in ddH2O13.5μ
L is supplied.PCR response procedures are：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 52 DEG C of annealing 30s, 72 DEG C of extension 40s, 40 are followed
Ring, 72 DEG C of extension 5min, 4 DEG C of preservations.
PCR reaction after the completion of, by reaction product with 1.5% agarose (containing 0.5 μ g/mL EB) gel electrophoresis, each
Amplified production and sample loading buffer mixture 6 μ L (wherein pcr amplification product and 6 × Loading buffer are added in electrophoresis hole
Volume be 5:1), other 6 μ L, 130V electrophoresis 40min of loading DNA Marker, then observe electrophoretic band.
Positive sample with band is enlarged culture.
It prepares glycerol stock and carries out culture presevation
2.1 prepare the spare of 30% glycerine；
2.2 take the logarithm, and thalline were collected by centrifugation by bacterium solution 400 the μ L, 2000rpm in growth period；
2.3 add in the fresh LB fluid nutrient mediums of 200 μ L, and thalline is dispelled to form bacteria suspension；
2.4 add in 30% isometric glycerine, mixing.
Embodiment 2
The present embodiment provides the detection method of a boar encephalitis B virus genetic stability, pig encephalitis B virus genetic stability
Detection method includes the virus particle of pig encephalitis B virus being transformed into host strain cell, then by the disease containing pig encephalitis B virus
Glycerol stock is made in the host strain of toxin grain, by cultivating and passing on glycerol stock, the genetic stability of identification passage glycerol stock.
The competent cell of TOP10 is selected in the present embodiment as competent escherichia coli cell, certainly other real
Applying in mode can also select other competent escherichia coli cells to be tested, such as DH5 α cells or BL21 (DE3) cell.
The conversion of plasmid is as follows：
1.1 take the competent cell of 100 μ L Escherichia coli TOP10 to be added in EP pipes, and melt on ice；
1.2 take the virus particle for the pig encephalitis B virus that 4 μ L concentration are 10ng/ μ L to be added to the large intestine melted in EP pipes
In the competent cell of bacillus TOP10,37min is placed on ice；
1.3 by EP pipes under 42 DEG C of temperature conditionss heat shock 100s, by EP pipes fast transfer to cooled on ice 3min；
1.4 add in the LB liquid medium without antibiotic of 200 μ L, 150rpm cultures 45min in EP pipes；
1.5 take the bacterium solution even spread of 50 μ L to LB solid mediums (Amp+) on, 37 culture 16h.
The identification of positive host strain
From the LB solid mediums (Amp of step 1.5+) on the single spot of picking 10 respectively, cultivated in LB fluid nutrient mediums, so
Bacterium solution PCR identifications are carried out afterwards；Using the reaction system of 21.5 μ L：10 × PCR Buffer2.5 μ L, dNTPs Mixture
(2.5mM) 2 μ L, each 0.25 μ L of upstream and downstream primer, 2 μ L, Taq archaeal dna polymerase of bacterium solution (template), 1 μ L, and add in ddH2O13.5μ
L is supplied.PCR response procedures are：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 40s, 40 are followed
Ring, 72 DEG C of extension 5min, 4 DEG C of preservations.
PCR reaction after the completion of, by reaction product with 1.5% agarose (containing 0.5 μ g/mL EB) gel electrophoresis, each
Amplified production and sample loading buffer mixture 6 μ L (wherein pcr amplification product and 6 × Loading buffer are added in electrophoresis hole
Volume be 5:1), other 6 μ L, 130V electrophoresis 40min of loading DNA Marker, then observe electrophoretic band.
Positive sample with band is enlarged culture.
It prepares glycerol stock and carries out culture presevation
2.1 prepare the spare of 30% glycerine；
2.2 take the logarithm, and thalline were collected by centrifugation by bacterium solution 400 the μ L, 2000rpm in growth period；
2.3 add in the fresh LB fluid nutrient mediums of 200 μ L, and thalline is dispelled to form bacteria suspension；
2.4 add in 30% isometric glycerine, mixing.
Embodiment 3
The present embodiment provides the detection method of a boar encephalitis B virus genetic stability, pig encephalitis B virus genetic stability
Detection method includes the virus particle of pig encephalitis B virus being transformed into host strain cell, then by the disease containing pig encephalitis B virus
Glycerol stock is made in the host strain of toxin grain, by cultivating and passing on glycerol stock, the genetic stability of identification passage glycerol stock.
The competent cell of TOP10 is selected in the present embodiment as competent escherichia coli cell, certainly other real
Applying in mode can also select other competent escherichia coli cells to be tested, such as DH5 α cells or BL21 (DE3) cell.
The conversion of plasmid is as follows：
1.1 take the competent cell of 100 μ L Escherichia coli TOP10 to be added in EP pipes, and melt on ice；
1.2 take the virus particle for the pig encephalitis B virus that 2 μ L concentration are 2ng/ μ L to be added to the large intestine melted in EP pipes
In the competent cell of bacillus TOP10,31min is placed on ice；
1.3 by EP pipes under 42 DEG C of temperature conditionss heat shock 75s, by EP pipes fast transfer to cooled on ice 3min；
1.4 add in the LB liquid medium without antibiotic of 200 μ L, 150rpm cultures 45min in EP pipes；
1.5 take the bacterium solution even spread of 50 μ L to LB solid mediums (Amp+) on, 37 culture 16h.
The identification of positive host strain
From the LB solid mediums (Amp of step 1.5+) on the single spot of picking 10 respectively, cultivated in LB fluid nutrient mediums, so
Bacterium solution PCR identifications are carried out afterwards；Using the reaction system of 21.5 μ L：10 × PCR Buffer2.5 μ L, dNTPs Mixture
(2.5mM) 2 μ L, each 0.25 μ L of upstream and downstream primer, 2 μ L, Taq archaeal dna polymerase of bacterium solution (template), 1 μ L, and add in ddH2O13.5μ
L is supplied.PCR response procedures are：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 40s, 40 are followed
Ring, 72 DEG C of extension 5min, 4 DEG C of preservations.
PCR reaction after the completion of, by reaction product with 1.5% agarose (containing 0.5 μ g/mL EB) gel electrophoresis, each
Amplified production and sample loading buffer mixture 6 μ L (wherein pcr amplification product and 6 × Loading buffer are added in electrophoresis hole
Volume be 5:1), other 6 μ L, 130V electrophoresis 40min of loading DNA Marker, then observe electrophoretic band.
Positive sample with band is enlarged culture.
It prepares glycerol stock and carries out culture presevation
2.1 prepare the spare of 30% glycerine；
2.2 take the logarithm, and thalline were collected by centrifugation by bacterium solution 400 the μ L, 2000rpm in growth period；
2.3 add in the fresh LB fluid nutrient mediums of 200 μ L, and thalline is dispelled to form bacteria suspension；
2.4 add in 30% isometric glycerine, mixing.
Embodiment 4
The present embodiment provides the detection method of a boar encephalitis B virus genetic stability, embodiment 3 is taken in the present embodiment
In the glycerol stock of the Escherichia coli for containing pig encephalitis B virus plasmid that is prepared tested as strain, specific steps are such as
Under：
1.1 add in the LB fluid nutrient mediums (ampicillin containing 100mg/L) of 3mL in test tube；
1.2 are inoculated into glycerol stock strain in test tube according to 1% inoculum concentration；
1.3 under conditions of 37 DEG C 120rpm shaken cultivations；
1.4 carry out continuous passage culture, and the sample in the 5th generation, the 15th generation, the 25th generation and the 40th generation is taken to be tested respectively.
The genetic stability detection of the Escherichia coli containing pig encephalitis B virus plasmid of continuous passage, including colonial morphology ratio
Compared with, Gram's staining and PCR identifications and biochemistry detection.
Colonial morphology compares
Appropriate eosin methylene blue culture medium is prepared, 121 DEG C of autoclave sterilization 15min prepare tablet in an aseptic environment,
5,15,25,40 generation bacterium solutions is taken to carry out line culture respectively, 37 DEG C of cultures for 24 hours, observe colonial morphology.
As a result as shown in Fig. 1 to Fig. 4, from colony morphological observation, in the 5th generation, the 15th generation, the 25th generation and the 40th generation, contain pig
The colonial morphology of the E. coli SampLes of encephalitis B virus plasmid is consistent, without apparent difference, illustrates containing pig encephalitis B virus matter
The Escherichia coli of grain still possess vigor.
Gram's staining
Contain the Escherichia coli of pig encephalitis B virus plasmid by the 5th generation of Gram's staining, the 15th generation, the 25th generation and the 40th generation
Sample.
It is red rod-shaped after 5,15,25, the 40 generation genetic engineering bacteriums dyeing of this method culture by coloration result
Or corynebacterium structure.
PCR Molecular Identifications
The E. coli SampLes that the 5th generation, the 15th generation, the 25th generation and the 40th generation contain pig encephalitis B virus plasmid is taken to carry out respectively
PCR reacts, the PCR reaction systems and response procedures of PCR reaction systems and response procedures reference embodiment 3.
As shown in Figure 5 and Figure 6, stripe size 422bp meets the size of expected purpose segment to PCR reaction results, M in figure
Represent DNA Marker, 1 is detection sample, and 2 be negative control；Left figure is the PCR product of the Escherichia coli in 5 generations of passage in Fig. 5
Electrophoresis result, right figure are the PCR product electrophoresis result of the Escherichia coli in 15 generations of passage；Left figure is the large intestine in 25 generations of passage in Fig. 6
The PCR product electrophoresis result of bacillus, right figure are the PCR product electrophoresis result of the Escherichia coli in 40 generations of passage；Pass on 5 generations, 15 generations,
The Escherichia coli in 25 generations and 40 generations can still detect pig encephalitis B virus plasmid, illustrate the large intestine bar containing pig encephalitis B virus plasmid
Bacterium can keep its genetic stability in 5 generations of passage, 15 generations, 25 generations and 40 generations.
The biochemical reaction experiment of Escherichia coli
Escherichia coli containing pig encephalitis B virus plasmid after 5 generations, 15 generations, 25 generations and 40 generations are passed on are sampled, carry out indigo
Matrix experiments, MR (methyl red) experiments, VP experiments and citrate experiment are identified.
The results are shown in Figure 7 for the 5th generation biochemical test of Escherichia coli containing pig encephalitis B virus plasmid, wherein figure upper left
Two figures in side are the front and rear comparison diagram of indole experiment, and it is comparison diagram before and after VP experiments that figure is opened in upper right side two；Wherein figure lower left
Two figures are the front and rear comparison diagram of MR experiments, and it is comparison diagram before and after citrate experiment that figure is opened in lower right two；Show containing pig second
The Escherichia coli of encephalovirus plasmid can keep its genetic stability in 5 generations of passage.
The results are shown in Figure 8 for the 15th generation biochemical test of Escherichia coli containing pig encephalitis B virus plasmid, wherein figure is left
It is the front and rear comparison diagram of indole experiment that figure is opened in top two, and it is comparison diagram before and after VP experiments that figure is opened in upper right side two；Wherein figure lower-left
Two figures in side are the front and rear comparison diagram of MR experiments, and it is comparison diagram before and after citrate experiment that figure is opened in lower right two；Show containing pig
The Escherichia coli of encephalitis B virus plasmid can keep its genetic stability in 15 generations of passage.
The results are shown in Figure 9 for the 25th generation biochemical test of Escherichia coli containing pig encephalitis B virus plasmid, wherein scheming
It is the front and rear comparison diagram of indole experiment that figure is opened on upper left side two, and it is comparison diagram before and after VP experiments that figure is opened in upper right side two；Wherein figure is left
It is the front and rear comparison diagram of MR experiments that figure is opened in lower section two, and it is comparison diagram before and after citrate experiment that figure is opened in lower right two；Show containing
The Escherichia coli of pig encephalitis B virus plasmid can keep its genetic stability in 25 generations of passage.
The results are shown in Figure 10 for the 40th generation biochemical test of Escherichia coli containing pig encephalitis B virus plasmid, wherein figure is left
It is the front and rear comparison diagram of indole experiment that figure is opened in top two, and it is comparison diagram before and after VP experiments that figure is opened in upper right side two；Wherein figure lower-left
Two figures in side are the front and rear comparison diagram of MR experiments, and it is comparison diagram before and after citrate experiment that figure is opened in lower right two；Show containing pig
The Escherichia coli of encephalitis B virus plasmid can keep its genetic stability in 40 generations of passage.
Embodiment 5
The present embodiment provides the detection method of a boar encephalitis B virus genetic stability, embodiment 3 is taken in the present embodiment
In the glycerol stock of the Escherichia coli for containing pig encephalitis B virus plasmid that is prepared tested as strain, specific steps are such as
Under：
1.1 add in the LB fluid nutrient mediums (ampicillin containing 100mg/L) of 3mL in test tube；
1.2 are inoculated into glycerol stock strain in test tube according to 10% inoculum concentration；
1.3 under conditions of 37 DEG C 120rpm shaken cultivations；
1.4 carry out continuous passage culture, and the sample in the 5th generation, the 15th generation, the 25th generation and the 40th generation is taken to be tested respectively.
The genetic stability detection of the Escherichia coli containing pig encephalitis B virus plasmid of continuous passage, including colonial morphology ratio
Compared with, Gram's staining and PCR identifications and biochemistry detection.
In conclusion then the embodiment of the present invention is made glycerol stock, leads to by the way that pig encephalitis B virus is transformed into Escherichia coli
Culture glycerol stock and continuous passage are crossed, measures the genetic stability of the Escherichia coli containing pig encephalitis B virus plasmid in different generations,
Reliable guarantee is provided for the research of pig encephalitis B virus.
Embodiments described above is part of the embodiment of the present invention, instead of all the embodiments.The reality of the present invention
The detailed description for applying example is not intended to limit the scope of claimed invention, but is merely representative of the selected implementation of the present invention
Example.Based on the embodiments of the present invention, those of ordinary skill in the art are obtained without creative efforts
Every other embodiment, belongs to the scope of protection of the invention.
SEQUENCE LISTING
<110>Hanbang Medical Science ＆ Technology Co., Ltd., Harbin City
<120>The detection method of one boar encephalitis B virus genetic stability and application
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence
<400> 1
agagagagca ccaagggaat g 21
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<400> 2
cttgcggttg agttggatga c 21
<210> 3
<211> 477
<212> DNA
<213> Japanese encephalitis virus
<400> 3
cccagtacga taccaaactt cagcagtgca gagagagcac caagggaatg aaatagtgga 60
tgtgatgtgc catgccactc tgacccacag attgatgtca ccgaacagag tgcccaacta 120
taacctattt gtcatggatg aagctcattt caccgaccca gccagtatag ccgcacgagg 180
atacatcgct accaaggtgg aattaggaga ggcagcagcc atctttatga cagcgacccc 240
gcctggaacc acggatcctt ttcctgactc aaatgcccca atccatgatc tacaagatga 300
gataccagac agggcatgga gcagtggata cgaatggatc acagaatatg cgggtaaaac 360
cgtgtggttt gtggcgagcg taaaaatggg gaatgaaatt gcaatgtgcc tccaaagagc 420
gggaaaaaag gtcatccaac tcaaccgcaa gtcctatgac acagaatacc caaaatg 477
Claims (10)
1. the detection method of a boar encephalitis B virus genetic stability, which is characterized in that including：
The host strain bacterium solution containing pig encephalitis B virus plasmid is cultivated in fluid nutrient medium；
Host strain bacterium solution described in continuous passage culture；
Interval samples the host strain bacterium solution of the secondary culture and carries out genetic stability detection.
2. the detection method of pig encephalitis B virus genetic stability according to claim 1, which is characterized in that the host strain
The inoculum concentration of bacterium solution is the 1%-10% of the volume of the fluid nutrient medium.
3. the detection method of pig encephalitis B virus genetic stability according to claim 1, which is characterized in that the host strain
Bacterium solution is glycerine bacterium solution.
4. the detection method of pig encephalitis B virus genetic stability according to claim 3, which is characterized in that the glycerol stock
The preparation of liquid includes：
The virus particle of the encephalitis B virus containing pig is transformed into competent escherichia coli cell, by identifying that primer detection is identified,
Obtain positive recombination bacillus coli；
The recombination bacillus coli is cultivated, and adds glycerine and glycerine culture presevation is made.
5. the detection method of pig encephalitis B virus genetic stability according to claim 4, which is characterized in that the large intestine bar
Bacterium competence cell is one kind in TOP10 cells, DH5 α cells and BL21 (DE3) cell.
6. the detection method of pig encephalitis B virus genetic stability according to claim 4, which is characterized in that the second containing pig
The volume ratio of the virus particle of encephalovirus and the competent escherichia coli cell is 1-4:100.
7. the detection method of pig encephalitis B virus genetic stability according to claim 6, which is characterized in that the second containing pig
The concentration of the virus particle of encephalovirus is 0.1-10ng/ μ L.
8. the detection method of pig encephalitis B virus genetic stability according to claim 4, which is characterized in that the conversion
Method is：The virus particle and the competent escherichia coli cell of the mixing encephalitis B virus containing pig, place 25- on ice
37min；Heat shock 60-100s, places 2-3min on ice.
9. the detection method of pig encephalitis B virus genetic stability according to claim 4, which is characterized in that the detection mirror
Surely reacted and realized by PCR, the annealing temperature of the PCR reactions is 52-58 DEG C.
10. the detection method such as claim 1-9 any one of them pig encephalitis B virus genetic stabilities is trained in pig encephalitis B virus
Application in supporting.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810007565.0A CN108103243A (en) | 2018-01-04 | 2018-01-04 | The detection method of one boar encephalitis B virus genetic stability and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810007565.0A CN108103243A (en) | 2018-01-04 | 2018-01-04 | The detection method of one boar encephalitis B virus genetic stability and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108103243A true CN108103243A (en) | 2018-06-01 |
Family
ID=62218360
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810007565.0A Pending CN108103243A (en) | 2018-01-04 | 2018-01-04 | The detection method of one boar encephalitis B virus genetic stability and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108103243A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6184024B1 (en) * | 1988-07-14 | 2001-02-06 | The United States Of America As Represented By The Department Of Health And Human Services | Chimeric and/or growth-restricted flaviviruses |
| WO2007102174A2 (en) * | 2006-03-06 | 2007-09-13 | Cadila Healthcare Limited | Process for preparing human g-csf |
| CN104497109A (en) * | 2014-12-05 | 2015-04-08 | 任瑞文 | Recombinant antigen protein and kit for detecting epidemic encephalitis B virus antibody |
-
2018
- 2018-01-04 CN CN201810007565.0A patent/CN108103243A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6184024B1 (en) * | 1988-07-14 | 2001-02-06 | The United States Of America As Represented By The Department Of Health And Human Services | Chimeric and/or growth-restricted flaviviruses |
| WO2007102174A2 (en) * | 2006-03-06 | 2007-09-13 | Cadila Healthcare Limited | Process for preparing human g-csf |
| CN104497109A (en) * | 2014-12-05 | 2015-04-08 | 任瑞文 | Recombinant antigen protein and kit for detecting epidemic encephalitis B virus antibody |
Non-Patent Citations (3)
| Title |
|---|
| 郝丹等: "生长分化因子(BMP11) 重组质粒在工程菌株中的稳定性研究", 《食品工业科技》 * |
| 韩秀杰等: ""猪日本脑炎病毒NS3蛋白的基因克隆、原核表达及纯化"", 《动物医学进展》 * |
| 高基民著: "《分子诊断学实验指导》", 28 February 2010, 中国医药科技出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Maan et al. | Full genome characterisation of bluetongue virus serotype 6 from the Netherlands 2008 and comparison to other field and vaccine strains | |
| Milinovich et al. | Changes in equine hindgut bacterial populations during oligofructose‐induced laminitis | |
| CN106191124A (en) | A kind of utilize fish roe to preserve liquid to improve CRISPR Cas9 gene editing and the fish breeding method of passaging efficiency | |
| Magyar et al. | Re-emergence of bovine haemorrhagic septicaemia in Hungary | |
| Duhamel et al. | Colonic spirochetal infections in nonhuman primates that were associated with Brachyspira aalborgi, Serpulina pilosicoli, and unclassified flagellated bacteria | |
| Kiss et al. | Preliminary studies on feline coronavirus distribution in naturally and experimentally infected cats | |
| CN105755143B (en) | A kind of kit and detection method for being used to detect bacterium | |
| CN106929485A (en) | Pseudorabies virus genetic engineering gB recombinates attenuated vaccine strain and application | |
| CN114350828A (en) | Specific primer for amplifying Pantoea ananatis and application thereof | |
| Pianta et al. | Isolation of Arcobacter spp from the milk of dairy cows in Brazil | |
| CN104531738A (en) | Preparation method of positive contrast plasmids for mycoplasma PCR detection and transformed strain of positive contrast plasmids | |
| CN108103243A (en) | The detection method of one boar encephalitis B virus genetic stability and application | |
| Seker et al. | Investigation of Yersinia ruckeri infection in rainbow trout (Oncorhynchus mykiss walbaum 1792) farms by polymerase chain reaction (PCR) and bacteriological culture | |
| CN108179207A (en) | For identifying the PCR primer and method of different subgroup melon bacterial Acidovorax avenae subsps | |
| CN104694432B (en) | Lack salmonella dublin and the application of phoQ and rpoS genes | |
| CN107723348A (en) | Identify the NASBA detection methods of Listeria monocytogenes 1/2c serotypes | |
| CN108085290A (en) | A kind of detection method of Hepatitis E virus genetic stability and application | |
| CN108085291A (en) | A kind of detection method of genophore genetic stability of encoding muramidase release albumen and application | |
| Shivachandra et al. | Detection of Pasteurella multocida in experimentally infected embryonated chicken eggs by PCR assay | |
| Balachandran et al. | Prevalence and predisposing factors in spontaneous cases of necrotic enteritis in cage reared commercial layer chicken | |
| CN108103172A (en) | A kind of detection method of plasmid genetic stability of Streptococcus suis extracellular factor gene and application | |
| CN108085289A (en) | A kind of detection method of plasmid genetic stability containing pig hemolysin gene and application | |
| Yang et al. | A Chelex-100-based rapid DNA extraction method and its application in the detection of shrimp pathogens | |
| Lateif et al. | Genotypic characterization of Escherichia coli isolated from infected chicken in Basrah, Iraq | |
| Rahman et al. | Pathology of pullorum disease and molecular characterization of its pthogen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180601 |