CN108018240A

CN108018240A - A kind of middle gluconacetobacter and its application

Info

Publication number: CN108018240A
Application number: CN201711434866.3A
Authority: CN
Inventors: 董耀明; 许州亿
Original assignee: Shirong Enterprise Co ltd; Shirong Holdings Ltd; Yuan'an Biotech Co ltd; Huahai Technology Co ltd
Current assignee: Shirong Enterprise Co ltd; Shirong Holdings Ltd; Yuan'an Biotech Co ltd; Huahai Technology Co ltd
Priority date: 2017-12-26
Filing date: 2017-12-26
Publication date: 2018-05-11

Abstract

The invention discloses a kind of middle gluconacetobacter (Gluconacetobacterer intermedius) for being used to prepare bacteria cellulose and its application, the bacterial strain is deposited in Guangdong Province's Culture Collection on the 4th in August in 2017, and preserving number is GDMCC NO：60218.And the method that bacteria cellulose is prepared using the gluconacetobacter is provided, the bacteria cellulose prepared, compared with other strains produce bacteria cellulose, the yield higher of bacteria cellulose prepared by the present invention, by the culture of 14 days, yield was up to more than 800mg.

Description

A kind of middle gluconacetobacter and its application

Technical field

The present invention relates to biological technical field, more particularly to a kind of middle glucose vinegar bar for being used to prepare bacteria cellulose Bacterium and the method for preparing bacteria cellulose using the middle gluconacetobacter, the bacterial strain are middle gluconacetobacter (Gluconacetobacterer intermedius), is deposited in Guangdong Province's Microbiological Culture Collection on 4th in August in 2017 Center, preserving number are GDMCC NO：60218.

Background technology

Cellulose (cellulose), is the main constituents of plant cell wall, but other biological such as algae, Mycophyta And bacterium class can also produce.However, bacteria cellulose (BC, bacterial cellulose) be one kind by all kinds of bacteriums The exocellular polysaccharide (exopolysaccharide) generated is formed, representational bacterium have acetic acid Pseudomonas (acetobacter, after It is continuous to be renamed as gluconobacter suboxydans category), rhizobium (Rhizobium), pseudomonas (Pseudomonas) etc..In Christian era After 1838 find first, until 1931 start formal scientific research, so that first scientific literature is delivered, more in 1982 Year is met the safe material of GRAS (being generally recognized as safety) by U.S. FDA identification.

The chemical composition of bacteria cellulose and plant cellulose is in fact identical, but bacteria cellulose has some speciality, all The characteristics such as the high-adaptability such as high-purity, moisture holding capacity, high-tensile strength and to live body, make it can be widely applied to food addition, electricity Sub- product, medical equipment etc..

Its characteristic includes the pure biological fiber for possessing medical grade.The 3D structures provided via nano level fiber are formed more Careful net structure.Moisture and gas are allowed to penetrate through bacteria cellulose, and aqueous solution can not be by, therefore skin can be protected The substantial amounts of water of breath bacteria cellulose receiving is held, and embodies and is not easy dry attribute, to prevent the volatilization of active ingredient.

From the origin of microbial project, medical field bacteria cellulose is widely used in artificial blood vessel abroad and corium produces Product.Because 99% cellulose, it and biology are compatible, and will not stimulate skin, and under normal conditions, final products All it may be reused, thus it is environmentally friendly.

The content of the invention

In order to solve how to prepare the bacteria cellulose of good performance of high yield, the present invention proposes a kind of middle glucose vinegar Bacillus and its application.

The technical problem of the present invention is solved by following technical solution：

A kind of middle gluconacetobacter, the bacterial strain are identified as middle gluconacetobacter (Gluconacetobacterer Intermedius), which is deposited in Guangdong Province's Culture Collection on 4th in August in 2017, and preserving number is GDMCC NO：60218.

Middle gluconacetobacter (Gluconacetobacterer intermedius) provided by the invention, is named as YA- 001, Guangdong Province's Culture Collection (English name China General are deposited within 4th in August in 2017 Microbiologial Collection Center, abbreviation GDMCC, address is：The compound 59 of Xianlie Middle Road, Guangzhou City 100 5 building, building), preserving number is GDMCC NO：60218.Middle gluconacetobacter (Gluconacetobacterer intermedius) YA-001DMCC NO：60218 referred to as middle gluconacetobacter YA-001.The middle gluconacetobacter YA-001 can be used for producing Bacteria cellulose, and by the bacteria cellulose for manufacturing dressing.

A kind of method using above-mentioned middle gluconacetobacter production bacteria cellulose, including step：By the middle Portugal Sweet and sour bacillus culture medium with the first temperature culture at the first time, afterwards with the second time of second temperature culture, finally with the 3rd The 3rd time of temperature culture, obtain the bacteria cellulose；Wherein described first temperature and the 3rd temperature are less than second temperature.

Preferably, at 10~18 DEG C, incubation time is 15~18h for first temperature or second temperature control.

Preferably, for the high-temperature control at 30~35 DEG C, incubation time is 45~54h.

Preferably, the culture medium includes：Glucose is about 11g/L, peptone is about 18g/L, yeast extract is about 10g/L, disodium hydrogen phosphate are about 3.9g/L and citric acid is about 4.2g/L, the percentage about referred in corresponding numerical value In the error range of point.

Preferably, the ratio of the first time and the incubation time of second time and the 3rd time is 1:3: 1。

Preferably, it is additionally included in the culture medium to add and supports film, the bacteria cellulose is attached on the support film.

Further, the material for supporting film includes adhesive-bonded fabric, reticular fibre cloth, nanofiber, macromolecule, waterproof One or more in cloth, polymer foam or stationery.

The present invention also proposes the bacterial fibers that a kind of method using any of the above-described production bacteria cellulose obtains Application of the element in manufacture dressing.

Preferably, the dressing includes drug paste or facial mask.

Preferably, the facial mask is about 90% including probiotics fermention thing, and trehalose is about 1%, and glucan is about 1%, Vitamin B3 is about 1%, and ceramide is about 1%, and collagen is about 1%, and sodium hyaluronate is about 1%, and aloe extract is about 1%, rose extract is about 1%, and mandarin orange fruit extract is about 1%, and jasmine extract is about 0.5%, and bergamot extract is about 0.5%, it is described about to refer in the error range of the one percentage point of corresponding numerical value.

The beneficial effect that the present invention is compared with the prior art includes：Grape acetobacter of the present invention is used for what is produced Bacteria cellulose, compared with other strains produce bacteria cellulose, the yield higher of bacteria cellulose produced by the invention, passes through The culture of 14 days, yield are up to more than mg more than 800.Using the bacteria cellulose material, the importing excellent to anti-inflammatory agents, Absorption rate when using traditional medical gauze is much larger than to the absorption rates of anti-inflammatory agents.

Brief description of the drawings

Fig. 1 is the SEM figures of bacteria cellulose in the specific embodiment of the invention, and wherein a and b is specific embodiment party of the present invention Section photo of the bacteria cellulose under 15.0KV*5.0K in formula, c and d are bacterial fibers material in the specific embodiment of the invention Expect the section photo under 15.0KV*1.0K.

Fig. 2 is the absorption curve figure of the Diclofenac drug paste that slight fiber element makes in the specific embodiment of the invention.

Fig. 3 is to expand ribosomal gene fragment result in the specific embodiment of the invention.

Fig. 4 is the testing result that PCR is extended in the specific embodiment of the invention.

Fig. 5 is the phyletic evolution tree graph of the general sweet and sour bacillus in the specific embodiment of the invention.Glucose vinegar among of the invention The preservation date of bacillus is August in 2017 4 days, and depositary institution is Guangdong Province's Culture Collection (China General Microbiologial Collection Center, CGMCC), preserving number is GDMCC NO：60218.

Fig. 6 is other strains and gluconacetobacter generation bacteria cellulose among the present invention in the specific embodiment of the invention Yield mapping.

Embodiment

Below against attached drawing and with reference to preferred embodiment, the invention will be further described.

Exist using the method for above-mentioned middle gluconacetobacter production bacteria cellulose, including by the middle gluconacetobacter Culture medium at the first time, cultivated for the second time with second afterwards with the first temperature culture, finally with the timing of second temperature culture one Between, obtain the bacteria cellulose.In the present embodiment, control at 10~18 DEG C, incubation time is 15~18h, high-temperature control At 30~35 DEG C, incubation time is 45~54h.In a further embodiment, first temperature and the high temperature and described the The incubation time of two temperature can also be controlled 1:3:1.The culture medium that this method is used includes：Glucose 11g/L, peptone 18g/L, yeast extract 10g/L, disodium hydrogen phosphate 3.9g/L and citric acid 4.2g/L.It is thin with difference in functionality in order to obtain Fungin can add support film at the same time when cultivating bacteria cellulose, according to the difference of functional requirement, support the material of film Can be that adhesive-bonded fabric, reticular fibre cloth, nanofiber, macromolecule, waterproof cloth, polymer foam or stationery are any or more Kind.It should be noted that it is described support film refer to for make the cellulose of culture be attached to above and the carrier that plays a supportive role.

The bacteria cellulose produced needs to use after sterilizing 15 minutes at 121 degree Celsius, and Fig. 1 is that the present invention does not add Support the SEM figures (scanning electron microscope (SEM) photograph) of the bacteria cellulose of film, a and b is the bacteria cellulose under low power number, it can be seen that it is layered Substantially, from the SM it can be seen from the figure thats of c and d high magnification numbes, its surface is smooth, close structure.

The bacteria cellulose of production can be applied in terms of dressing, may be used as drug paste, such as Diclofenac is loaded Membranaceous cellulose, and it is affixed on after mouse ear using Diclofenac as anti-inflammatory agents and its degree of absorption is surveyed after absorption, tie Fruit such as Fig. 2, it can be by absorption 90% in 10 minutes as seen from the figure, its speed is much larger than the gauze covering side in general curative Method, imports excellent.

The bacteria cellulose of production is also used as facial mask, such as the one of which facial mask of production includes：Probiotics fermention Thing 90%, trehalose 1%, glucan 1%, vitamin B3 1%, Cer EOS %, collagen 1%, sodium hyaluronate 1%, reed Luxuriant growth extract 1%, rose extract 1%, mandarin orange fruit extract 1%, jasmine extract 0.5%, bergamot extract 0.5%, its Middle % represents mass ratio.This facial mask has effects that releive face and increase moisturizing.

The identification of middle gluconacetobacter

The extraction of DNA

Thalline is put into the mortar of liquid nitrogen precooling after DNA extraction collections are cultivated 3 days, and the liquid that whole thalline was covered in addition is ground Nitrogen is ground, and is repeated twice to three times grinding thalline completely, addition 750mL lysis buffers after dissolving (50mM Tris-HCl, 20mM EDTA-Na2,3%SDS, 1%2- thioglycols, pH=7), 1.5mL lapping liquids are taken after mixing to microcentrifugal tube, in Reacted 30 minutes in dry bath at 65 DEG C, and not timing is stirred with toothpick, is then centrifuged (12000xg, 5min) and is collected Layer liquid is positioned over new microcentrifugal tube, adds the PCI (phenol of equivalent：Chloroform：Isoamyl alcohol/25：24：1) it is carefully turned over for several times Afterwards and centrifuge (12000xg, 10 minutes) and take upper liquid, add equivalent PCI be mixed after centrifuge (12000xg, 10 minutes), weight Multiple this step 3~4 time to no protein layer separates out.After drawing upper liquid, be incorporated as the isopropanol of 0.6 times of upper liquid volume with for The sodium acetate (pH4.8) for the 3M that 0.1 times of upper liquid volume, is positioned over -20 DEG C of refrigerators 10~60 minutes after being carefully turned over 5 times, connect (12000xg, 1 minute) removal upper liquid is centrifuged after taking-up, to be air-dried after 75% alcohol washes to after there is no alcohol smell completely, Back dissolving is in RNase solution As (1M, the Tris-HCl of 100mL：The ribonuclease A of 1%, 0.5M EDTA, pH8,20 μ g/mL) After addition, be positioned over 37 DEG C, 1~2 it is small when after add after 200 μ L of chloroform overturn 5 times after centrifuge (12000xg, 5 minutes) and take upper strata Liquid, is added the isopropanol of 0.6 times of volume and sodium acetate (pH4.8) the precipitation DNA of 0.1 times of 3M, is placed with 75% alcohol washes DNA Air-dried in 60 DEG C of dry bath grooves to after there is no alcohol smell completely, with 65 DEG C of deionized water back dissolvings of 30 μ L, take 2 μ LDNA with 0.8% Agar gel electrophoresis are observed, and determine to have extracted the DNA of the bacterium.

The amplification of ribosomal gene

This experiment is with 16S introduction (primers Fs：AGAGTTTGATCCTGGCTCAG, primer R：GGCTACCTTG TTACGACTT), ribosomal gene is expanded using polymerase chain reaction (polymerase chain reaction, PCR), PCR's is set as 94 DEG C, 5 minutes, then with 94 DEG C/30 seconds, 54 DEG C/30 seconds, circulation in 72 DEG C/2 minutes carried out 30 times, finally with 72 DEG C/after five minutes Terminate.The clean/Gel Extraction Kit (cleaning/gel extraction kit) of BioKit are used afterwards, are firstly added The Binding Buffer (combination buffer) of amount (50 μ L) are mixed afterwards, move to centrifugation after the collecting pipe of column spinner (12000xg, one minute), outwells the liquid in Collection tube (collecting pipe), adds the lavation buffer solution of 600 μ L Centrifuge (12000xg, one minute) afterwards remove collecting pipe in liquid, repeat once after directly idle running centrifugation (12000xg, three Minute), column spinner is then moved to new pipe, adds the deionized water of 50~100 μ L, is centrifuged after standing three minutes (12000xg, three minutes), is removed rotation column, takes 2 μ L to be observed with 0.8~1.0% agar gel electrophoresis, as shown in figure 3, fragment is big Small about 1500bp, close to the size for the fragment estimated, has successfully expanded 16S rDNA fragments.

The choosing of ribosomal gene is grown

Vector in ribosomal gene after cleaning and yT＆AKit (YC001, yT＆A) is subjected to yT＆A connections at 4 DEG C, Overnight (12 it is small when~16 it is small when) after, by 5 μ L of connection product add 100 μ L pre-productions bacillus coli DH 5 alpha gametid simultaneously It is placed in 5 minutes on ice, then reacts 90 seconds postpositions 5 minutes on ice in 42 DEG C of water baths, adds 400 μ L's LuriaBertanimedium culture mediums, then in 37 DEG C of incubator, shake culture 45 minutes under 225rpm, take out 100 μ L and apply Be put in the plate of LB+ ampicillins (100 μ g/mL) (be coated in advance with 40 μ L2%X-gal and 7 μ L0.5M isopropyisulfanyls-β- Galactoside (IPTG)), it is positioned over 37 DEG C of incubator culture.The white single bacterium colony on LB+ ampicillin plates is selected, is connect Kind continues to cultivate (37 DEG C, 225rpm, O/N) in the incubator, draws afterwards to the nutrient solution of 2mL LB+Amplicillin The pipe centrifugation (12000 xg, 1 minute) of the bacterium solution of 0.8~1mL to 1.5mL leave thalline after removing upper liquid afterwards, use BioKit plasmid miniprep Kit (BioKit plasmid miniprep kits) carry out the extraction of plastid, are firstly added Appropriate solution (such as solution of Bio-P100 30ml, Bio-P300 70ml) to the vortex after thalline of 200 μ L mixes, and is subsequently added into Slightly upset pipe 5~10 times afterwards of the appropriate solution (being same as above) of 200 μ L, the appropriate solution (being same as above) for adding 200 μ L is slight afterwards Overturn pipe 5~10 times, then centrifuging (12000xg, 10 minutes), absorption upper liquid is inserted in the collecting pipe of column spinner afterwards, is centrifuged (12000xg, 1 minute) removes filtrate afterwards, and the lavation buffer solution of 600 μ L is added in Spin column column spinners (Washing Buffer) centrifuges (12000xg, 1 minute) and removes filtrate and repeat this step once afterwards, then centrifuges Column spinner is moved to new pipe after (12000xg, one minute), three minutes are stood after adding the deionized water of 50~100 μ L, then with Centrifugation (12000xg, 3 minutes) makes plastid remove rotation column after collecting to pipe, draws 2 μ L plastids with 0.8~1.0% agar gel electrophoresis Observe result.Plastid is diluted 200 times as template using deionized water, PCR amplification setting is the same, after amplification, takes 2 μ L with 0.8 ~1.0% agar gel electrophoresis observation is as a result, as shown in figure 4, transition strain 2,6,7 can not measure ribosomes Insert Fragment, but its He has successfully amplified expected fragment at the strain that makes the transition, followed by Genetic relationship.Transition strain 1 is chosen, and with Automatic sequencing instrument measures vector insert gene order, obtains the fragment that 1 section of sequence fragment length is 1480bp.

Genetic relationship

YT＆A carriers containing ribosomal gene sequence are carried out to the sequencing at 5' and 3' both ends with automatic nucleic acid sequencing instrument, it is fixed Sequence result recycles the integration of software sequence, you can obtains the sequence of Rumen Fungi 18S rDNAs.In addition from NCBI data The ribosomal gene sequence of reference strain is downloaded in storehouse, and the ribosomal gene that these sequences and this experiment are made with After ClustalW multiple labellings are ranked up, using software MEGA6.0, with adjacent method (NJ) analysis bacterial strain and other reference strains Affiliation, as shown in figure 5, showing the new strain branch.

Living resources preserve and research center (Bioresource Collection and Research Center, BCRC Komagataeibacter hansenii, Cellulomonas uda, Komagataeibacter xylinus) are obtained, The strains such as Komagataeibacter europaeus and Gluconacetobacter europaeus and YA-001 (this hair Strain in bright) with respective some days of strain appropriate culture medium culture after, collect respective product and registered its yield, as a result As shown in fig. 6, compared with other strains, it can be seen that the yield of YA-001 is located for 4 days, 7 days and 14 days always in different time sections In leading position, by the culture of 14 days, final yield reached more than 820mg.

Above content is that a further detailed description of the present invention in conjunction with specific preferred embodiments, it is impossible to is assert The specific implementation of the present invention is confined to these explanations.For those skilled in the art, do not taking off On the premise of from present inventive concept, some equivalent substitutes or obvious modification can also be made, and performance or purposes are identical, all should When being considered as belonging to protection scope of the present invention.

Claims

1. a kind of middle gluconacetobacter for being used to prepare bacteria cellulose, the middle gluconacetobacter are named as YA-001, Deposit number is GDMCC NO：60218.

2. a kind of method that middle gluconacetobacter using described in claim 1 prepares bacteria cellulose, it is characterised in that bag Include following steps：By the middle gluconacetobacter in culture medium with the first temperature culture first time, afterwards with second temperature Cultivated for the second time, finally with the 3rd time of the 3rd temperature culture, obtain the bacteria cellulose；Wherein described first temperature and 3rd temperature is less than second temperature.

3. the method that gluconacetobacter prepares bacteria cellulose among as claimed in claim 2, it is characterised in that described first At 10~18 DEG C, incubation time is 15~18h for temperature or second temperature control.

4. the method that gluconacetobacter prepares bacteria cellulose among as claimed in claim 2, it is characterised in that the high temperature At 30~35 DEG C, incubation time is 45~54h for control.

5. the method that gluconacetobacter prepares bacteria cellulose among as claimed in claim 2, it is characterised in that the culture Base includes：Glucose is about 11g/L, peptone is about 18g/L, yeast extract is about 10g/L, disodium hydrogen phosphate is about 3.9g/L and citric acid are about 4.2g/L, described about to refer in the error range of the one percentage point of corresponding numerical value.

6. the method that gluconacetobacter prepares bacteria cellulose among as claimed in claim 2, it is characterised in that described first Time is 1 with the proportionate relationship of second time and the 3rd time:3:1.

7. the method that gluconacetobacter prepares bacteria cellulose among as claimed in claim 2, it is characterised in that be additionally included in Added in the culture medium and support film, the bacteria cellulose is attached on the support film.

8. the method that gluconacetobacter prepares bacteria cellulose among as claimed in claim 7, it is characterised in that the support The material of film includes one kind in adhesive-bonded fabric, reticular fibre cloth, nanofiber, macromolecule, waterproof cloth, polymer foam or stationery It is or a variety of.

9. a kind of bacteria cellulose obtained using any methods for preparing bacteria cellulose of claim 1-8 is being manufactured The application of dressing.

10. as claimed in claim 9 in the application of manufacture dressing, it is characterised in that the dressing includes drug paste or facial mask.

11. as claimed in claim 10 in the application of manufacture dressing, it is characterised in that the facial mask includes prebiotic by weight Bacterium fermentate is about 90%, and trehalose is about 1%, and glucan is about 1%, and vitamin B3 is about 1%, and ceramide is about 1%, Collagen is about 1%, and sodium hyaluronate is about 1%, and aloe extract is about 1%, and rose extract is about 1%, mandarin orange fruit extract About 1%, jasmine extract is about 0.5%, and bergamot extract is about 0.5%, described about to refer to the one of corresponding numerical value Percentage point error range in.