CN107858417B

CN107858417B - Kit for detecting versican V1mRNA in urine and application thereof

Info

Publication number: CN107858417B
Application number: CN201710866676.2A
Authority: CN
Inventors: 鲍浩; 刘志红; 韩润鸿; 秦卫松
Original assignee: Nanjing General Hospital of Nanjing Command PLA
Current assignee: Nanjing General Hospital of Nanjing Command PLA
Priority date: 2017-09-22
Filing date: 2017-09-22
Publication date: 2020-06-05
Anticipated expiration: 2037-09-22
Also published as: CN107858417A

Abstract

The invention belongs to the field of medical detection, and particularly relates to a kit for detecting versican V1mRNA in urine and application thereof, wherein the kit is used for collecting the urine of a patient and measuring the level of the versican V1mRNA in urinary sediment; the results show that the urinary sediment versican V1mRNA level of the FSGS patients is remarkably increased, and the urinary sediment versican V1mRNA level of the minimal change nephropathy (MCD) patients is unchanged; urinary sediment versican V1mRNA levels in FSGS patients correlate with patient tubulointerstitial fibrosis scores and significantly with the rate of eGFR decline during patient follow-up; therefore, the expression level of the versican V1mRNA in urine can be used for the prognosis of the FSGS patients; the reagent for detecting the expression quantity of versican V1mRNA in urine can be used for preparing a detection reagent or a detection kit; and the noninvasive diagnosis of the FSGS prognosis judgment is realized.

Description

Kit for detecting versican V1mRNA in urine and application thereof

Technical Field

The invention belongs to the field of medical detection, and particularly relates to a kit for detecting versican V1mRNA in urine and application of the kit in focal-segment glomerulosclerosis prognosis diagnosis.

Background

Focal Segmental Glomerulosclerosis (FSGS) is a typical podocytosis. Most patients suffer from non-selective proteinuria, and hypertension and renal function damage are common in onset, and renal tubular function damage is often accompanied. Pathologically, the FSGS patient can be seen with glomerular focal segmental lesion and tubulointerstitial acute and chronic lesion. Although FSGS is a podocyte disease together with Minimal Change Disease (MCD), clinical pathological damage is more severe than MCD, and the prognosis of FSGS is worse than MCD. The degree of chronic tubulointerstitial lesions is closely related to the prognosis of the FSGS disease. Finds out the noninvasive diagnosis marker for tubulointerstitial fibrosis and prognosis judgment of the FSGS patient, and has important practical significance.

The extracellular matrix is a network structure distributed in the extracellular space and composed of proteins and polysaccharides secreted by cells. The extracellular matrix binds cells together to form tissues and provides an extracellular matrix that supports tissue in and between tissues. It is composed of many different multifunctional collagen superfamily molecules and non-collagenous matrix molecules, including hyaluronic acid, proteoglycans, and glycoproteins, etc. The extracellular matrix protein versican is a chondroitin sulfate proteoglycan with a large molecular weight, and is composed of a protein core and 12-15 chondroitin sulfate side chains connected to the protein core. Selective splicing of Versican mRNA can produce four subtypes, namely V0, V1, V2 and V3. Their core protein molecular weights are 370kDa, 263kDa, 180kDa and 74kDa, respectively.

It has been reported by Bukong TN et al that hepatic stellate cell versican expression is increased during hepatic fibrosis, and that liver fibrosis can be significantly inhibited by knocking down versican expression in hepatic stellate cells (see Bukong TN, Maurice SB, Chahal B, Schaeffer DF, Winwood PJ. versican: a novel modulator of hepatic fibrosis. Lab invest.2016.96(3): 361-74.). Rienstra H et al reported that chondroitin sulfate proteoglycan versican expression was significantly increased in experimental rat transplanted tubule interstitial fibrosis (see Rienstra H, Katta K, Celie JW, et al. differential expression of proteins in tissue engineering and lymphangenesis after plos one.2010.5(2): e 9095). Rudnicki M et al reported that expression of versican V0 and V1 in kidney tissue was correlated with progression of chronic kidney disease (see document Rudnicki M, Perco P, neuwitt H, et al, incorporated, crude version expression, associated with clinical disease, plos one, 2012.7(9): e 44891.).

Disclosure of Invention

The invention solves the technical problems in the prior art, and provides a noninvasive diagnosis marker versican V1mRNA, a kit for detecting versican V1mRNA in urine and application thereof in FSGS prognosis diagnosis for FSGS patient prognosis judgment.

In order to solve the problems, the technical scheme of the invention is as follows:

collecting urine of a patient, and measuring the mRNA level of urinary sediment versican V1; the results show that the urinary sediment versican V1mRNA level of the FSGS patients is obviously increased, and the urinary sediment versican V1mRNA level of the MCD patients is not changed; urinary sediment versican V1mRNA levels in FSGS patients correlated with patient tubulointerstitial fibrosis scores and significantly correlated with the rate of eGFR decline during patient follow-up; the urinary sediment versican V1mRNA level is used for predicting that the reduction rate of the follow-up eGFR month exceeds 2 per thousand, and the area AUC under the ROC curve reaches 1.000. Therefore, the urine levels of versican V1mRNA can be used for prognostic diagnosis in patients with FSGS; the reagent for detecting the expression quantity of versican V1mRNA in urine can be used for preparing a detection reagent or a detection kit.

Preferably, the reagent for detecting the expression level of versican V1mRNA in urine is: probes, gene chips or PCR primers with detection specificity for versican V1 mRNA.

Preferably, the PCR primers with detection specificity for versican V1mRNA include:

versican V1mRNA specific primer

A forward primer: TCGTTTTGAGAACCAGACAGG (SEQ ID NO. 1);

reverse primer: CTCAAATCACTCATTCGACGTT (SEQ ID NO. 2).

Preferably, the PCR primers with detection specificity for versican V1mRNA further comprise

Primers specific for endogenous control ACTB mRNA:

a forward primer: 5'-CTTGACAAAACCTAACTTGCG-3' (SEQ ID NO. 3);

reverse primer: 5'-TGCTGTCACCTTCACCGTTC-3' (SEQ ID NO. 4).

A kit for the prognostic diagnosis of FSGS comprising:

A. a reverse transcription system consisting of a reverse transcriptase mixture, a 2 × reaction solution mixture and rnase-free water;

B. the PCR analysis system consisted of versacan V1mRNA specific primers, ACTB mRNA specific primers, 2 XqqPCR reaction mix, fluorescent calibration dye and double distilled water.

Compared with the prior art, the invention has the advantages that,

compared with the prior art, the urine detection method has the advantages that the urine detection is noninvasive, and the clinical application can be greatly facilitated; the detection index is closely related to the eGFR reduction rate, and the FSGS kidney prognosis can be accurately predicted in an early stage; the detection method of the kit is rapid, simple, convenient and safe, and can be applied to large-scale clinical application;

the reagent for detecting the versican V1mRNA level in urine is applied to the preparation of a detection reagent or a detection kit, and the noninvasive diagnosis of FSGS prognosis is realized by detecting the versican V1mRNA level in urine for the prognosis judgment of an FSGS patient;

the kit for FSGS prognosis diagnosis can quickly and accurately detect the expression quantity of versican V1mRNA in urine.

Drawings

FIG. 1 shows FSGS, MCD and normal control urinary sediment versican V1mRNA levels;

FIG. 2 is a graph showing the correlation between urinary sediment versican V1mRNA level and tubulointerstitial fibrosis in FSGS patients;

FIG. 3 is a graph showing the correlation between urinary sediment versican V1mRNA level and eGFR reduction rate in FSGS patients;

FIG. 4 shows the sensitivity and specificity of ROC analysis of urinary sediment versican V1mRNA levels in FSGS patients for predicting month-to-month reduction of eGFR by >2 ‰;

FIG. 5 shows the FSGS, MCD and normal control urinary sediment versican V0 mRNA levels.

Detailed Description

Example 1: RT-PCR analysis of urinary sediment versican V1mRNA

Collecting 50ml urine of a patient, centrifuging for 15min at 700g, and obtaining urine sediments.

Total RNA was extracted using Trizol method. The specific method comprises the following steps: 1ml of Trizol was added to the sample, left to stand at room temperature for 5 minutes, and sufficiently lysed to completely isolate the nucleoprotein complex. Trizol volume of 1/5 chloroform was added, shaken for 15 seconds by inversion, allowed to stand at room temperature for 5 minutes, and centrifuged (12000g, 15 minutes, 4 ℃). The upper aqueous phase was transferred to another clean EP tube, an equal volume of isopropanol was added, allowed to stand at room temperature for 5 minutes, and centrifuged (12000g, 10 minutes, 4 ℃). Removing supernatant, adding 1ml of 75% ethanol to wash RNA precipitate, mixing with a shaker, and centrifuging (12000g, 5min, 4 ℃); washing is repeated for 1 time; the supernatant was removed and centrifuged in an empty tube (12000g, 1 min, 4 ℃). The supernatant was removed and the RNA pellet was resuspended in 30ul of ddH2O (RNase free).

The template cDNA was prepared using reverse transcriptase under the following conditions:

RT-PCR analysis of versican V1mRNA was performed using ACTB mRNA as an endogenous control, with the following PCR analysis conditions:

*SEQ ID NO.1NO.3；**SEQ ID NO.2NO.4

the primers specific for versican V1 and ACTB mRNA analyzed above were:

the results showed that urinary sediment versican V1mRNA levels were significantly increased in FSGS patients, while urinary sediment versican V1mRNA levels were unchanged in MCD patients (fig. 1).

Example 2:

the degree of renal tubular injury and interstitial fibrosis was evaluated by PASM staining, and tubulointerstitial fibrosis was semi-quantitatively analyzed by Masson staining area with < 25% for score 1, 25% -50% for score 2, and > 50% for score 3. There was a significant correlation between urinary sediment versican V1mRNA levels in FSGS patients and the patient tubulointerstitial fibrosis score with a P value <0.001 (figure 2).

Example 3:

calculating the month decline rate of eGFR by applying a mixed linear effect model:

GFR_ij＝beta0+beta1*time_ij+b_0i+b_1i*time_ij+epsilon_ij

eGFR rate of decrease (beta1+ b _1i)/(beta0+ b _0i)

There was a significant correlation between urinary sediment versican V1mRNA levels in FSGS patients and the monthly decline rate of eGFR in patients, with a P-value of 0.001 (fig. 3).

Example 4:

the urinary sediment versican V1mRNA level is used for judging that the month reduction rate of the eGFR in follow-up visit exceeds 2 per thousand, and the area AUC under the ROC curve reaches 1.000. By taking the relative quantitative value 4.380 of urinary sediment versican V1mRNA as a threshold value, the month decline rate of the follow-up eGFR is judged to exceed 2 per thousand, and the sensitivity and the specificity reach 100 percent (figure 4).

Comparative example 1: RT-PCR analysis of urinary sediment versican V0 mRNA

The procedure is as in example 1

PCR primers for detection of versican V0 mRNA:

the results showed no significant change in urinary sediment versican V0 mRNA levels in FSGS patients and MCD patients (fig. 5).

It should be noted that the above-mentioned embodiments are only preferred embodiments of the present invention, and are not intended to limit the scope of the present invention, and all equivalent substitutions or substitutions made on the above-mentioned embodiments are included in the scope of the present invention.

Sequence listing

<110> China general hospital for liberation army area Nanjing

<120> kit for detecting versican V1mRNA in urine and application thereof

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

tcgttttgag aaccagacag g 21

<210>2

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ctcaaatcac tcattcgacg tt 22

<210>3

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

cttgacaaaa cctaacttgc g 21

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

tgctgtcacc ttcaccgttc 20

<210>5

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

cagcaagcac aaaatttcac c 21

<210>6

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ctcaaatcac tcattcgacc tg 22

Claims

1. The application of the reagent for detecting the expression quantity of versican V1mRNA in urine in preparing the focal segment glomerulosclerosis prognostic diagnosis detection reagent or detection kit.

2. The use of claim 1, wherein the reagent for detecting the expression level of versican V1mRNA in urine comprises: probes, gene chips or PCR primers with detection specificity for versican V1 mRNA.

3. The use of claim 2, wherein the PCR primers specific for detection of versican V1mRNA comprise

Versican V1mRNA specific primers:

a forward primer: TCGTTTTGAGAACCAGACAGG (SEQ ID NO. 1);

reverse primer: CTCAAATCACTCATTCGACGTT (SEQ ID NO. 2).

4. The use of claim 3, wherein said PCR primers further comprise

Primers specific for endogenous control ACTB mRNA:

a forward primer: 5'-CTTGACAAAACCTAACTTGCG-3' (SEQ ID NO. 3);

reverse primer: 5'-TGCTGTCACCTTCACCGTTC-3' (SEQ ID NO. 4).