KR102323535B1 - A composition for diagnosing diabetic nephropathy - Google Patents

A composition for diagnosing diabetic nephropathy Download PDF

Info

Publication number
KR102323535B1
KR102323535B1 KR1020190083157A KR20190083157A KR102323535B1 KR 102323535 B1 KR102323535 B1 KR 102323535B1 KR 1020190083157 A KR1020190083157 A KR 1020190083157A KR 20190083157 A KR20190083157 A KR 20190083157A KR 102323535 B1 KR102323535 B1 KR 102323535B1
Authority
KR
South Korea
Prior art keywords
hsa
mir
diabetic nephropathy
micro rna
vesicles
Prior art date
Application number
KR1020190083157A
Other languages
Korean (ko)
Other versions
KR20210007180A (en
Inventor
김윤근
이대호
Original Assignee
주식회사 엠디헬스케어
(의료)길의료재단
가천대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 엠디헬스케어, (의료)길의료재단, 가천대학교 산학협력단 filed Critical 주식회사 엠디헬스케어
Priority to KR1020190083157A priority Critical patent/KR102323535B1/en
Priority to PCT/KR2020/002033 priority patent/WO2021006449A1/en
Publication of KR20210007180A publication Critical patent/KR20210007180A/en
Application granted granted Critical
Publication of KR102323535B1 publication Critical patent/KR102323535B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 소변 유래 소포 내에 포함되어 있는 마이크로 RNA 분석을 통하여 진행성 당뇨병성 신증을 예측 또는 진단하는 방법에 관한 것으로, 보다 구체적으로는 소변 유래 소포 내의 마이크로 RNA 분석을 수행하여 특정 마이크로 RNA의 발현 수준의 증감을 분석함으로써 진행성 당뇨병성 신증의 발병 위험도를 예측하거나 진단하는 방법에 관한 것이다.The present invention relates to a method for predicting or diagnosing progressive diabetic nephropathy through microRNA analysis contained in urine-derived vesicles. To a method for predicting or diagnosing the risk of developing progressive diabetic nephropathy by analyzing the increase or decrease.

Description

당뇨병성 신증 진단용 조성물{A composition for diagnosing diabetic nephropathy}Composition for diagnosing diabetic nephropathy {A composition for diagnosing diabetic nephropathy}

본 발명은 당뇨병성 신증 진단용 조성물, 상기 조성물을 이용한 당뇨병성 신증 진단에 관한 정보 제공 방법 등에 관한 것으로, 보다 자세하게는 소변 유래 소포 내의 마이크로 RNA를 이용한 당뇨병성 신증을 진단하는 방법 등에 관한 것이다.The present invention relates to a composition for diagnosing diabetic nephropathy, a method for providing information on diagnosing diabetic nephropathy using the composition, and more particularly, to a method for diagnosing diabetic nephropathy using microRNA in urine-derived vesicles.

당뇨병은 혈중 포도당 농도가 비정상적으로 상승된 상태로 장기간 지속되는 것을 특징으로 하는 일련의 대사이상을 지칭하는 질환으로, 생활의 서구화와 비만증의 증가로 인하여 2030 년 이후에는 국내 5백 20만 명 포함, 전 세계적으로는 5억 9천만 명까지 증가할 것으로 예측되고 있다. 대다수의 당뇨병 환자들은 혈당이 적절히 조절되지 않더라도 특별한 증상을 느끼지 못하는 경우가 많이 있으며, 당장 심각한 증상이 나타나지 않으므로 당뇨병에 의한 합병증의 심각성을 잘 인지하지 못할 때가 많다. 당뇨병에 의한 합병증으로는 신증(신장), 미세혈관 합병증, 대혈관 합병증 등이 있으며, 이 중 대혈관 합병증의 경우에는 약제와 의학의 발달로 증가 추세가 둔화된 반면, 당뇨병성 신증에 의한 말기신부전증(end state renal disease; ESRD)의 발생은 오히려 증가되는 추세를 보이고 있다.Diabetes mellitus is a disease that refers to a series of metabolic abnormalities characterized by an abnormally elevated blood glucose concentration that persists for a long time. Globally, the number is projected to increase to 590 million. Most diabetic patients do not feel any special symptoms even if their blood sugar is not properly controlled, and since serious symptoms do not appear immediately, they are often unaware of the seriousness of complications caused by diabetes. Complications caused by diabetes include nephropathy (kidney), microvascular complications, and macrovascular complications. Among these, macrovascular complications have slowed their increase due to the development of pharmaceuticals and medicine, while end-stage renal failure due to diabetic nephropathy. The incidence of end state renal disease (ESRD) is rather increasing.

당뇨병성 신증은 만성신장질환(chronic kidney disease; CKD)의 대표질환으로서 말기신부전증의 약 50 % 정도가 당뇨병성 신증에 의한 것임을 감안하면 매우 중대한 질환이다. 현재 국내에는 약 7만 여명의 말기신부전증 환자가 투석치료를 받고 있으며 이들이 차지하는 의료 비용은 신장 질환이 없는 환자와 비교하여 10배 이상을 차지하고 있으며, 말기신부전증 환자의 5 년 생존율은 40 % 미만으로서, 일반인의 사망률에 비하여 30 배 이상 높다. 따라서, 말기신부전증을 예방하기 위해서는, 진행성 당뇨병성 신증을 조기에 진단하는 것이 매우 중요하기 때문에 진단을 위한 다양한 방법의 개발이 활발히 이루어지고 있다.Diabetic nephropathy is a representative disease of chronic kidney disease (CKD), and considering that about 50% of end-stage renal disease is caused by diabetic nephropathy, it is a very serious disease. Currently, about 70,000 patients with end-stage renal disease in Korea are receiving dialysis treatment, and their medical cost is 10 times higher than that of patients without kidney disease. It is 30 times higher than the general mortality rate. Therefore, in order to prevent end-stage renal disease, early diagnosis of progressive diabetic nephropathy is very important, and thus various methods for diagnosis are being actively developed.

이러한 당뇨병성 신증을 진단하거나 진행을 예측하는 방법으로는 신장 조직 검사, 사구체 여과율을 직접 측정하거나 추정 사구체 여과율을 계산하는 방법, 알부민뇨를 측정하는 방법 등이 있으나, 조직 검사는 현실적으로 모든 당뇨병성 신증 환자에 적용하는 것은 불가능하기 때문에 일반적으로 사용하기에는 어려움이 있으며, 추정 사구체 여과율은 몇 년에 걸쳐 종적 추정을 진행해야하기 때문에 진단까지 긴 시간이 소요된다는 한계점이 있다. 또한 알부민뇨는 변이가 있거나 알부민뇨 증상 없이 당뇨병성 신증으로 진행되는 경우가 많아, 진단 정확성이 떨어진다는 한계점이 있다.Methods for diagnosing or predicting the progression of diabetic nephropathy include renal biopsy, direct measurement of glomerular filtration rate, a method of calculating estimated glomerular filtration rate, and a method of measuring albuminuria. Because it is impossible to apply it to the study, it is difficult to use it in general, and the estimated glomerular filtration rate has a limitation in that it takes a long time to diagnose because it is necessary to proceed with longitudinal estimation over several years. In addition, albuminuria often has mutations or progresses to diabetic nephropathy without albuminuria symptoms, so there is a limitation in that the diagnosis accuracy is poor.

따라서, 이러한 한계점을 극복하기 위하여, uric acid, TNFR1, TNFR2, FGF23 등과 같은 바이오 마커가 개발되었으나, 이러한 바이오 마커들도 알부민뇨나 추정 사구체 여과율로 보정하면, 신기능 감소 또는 말기신부전증 발생에 대한 예측도가 현저히 감소되기 때문에, 실질적으로 진행성 당뇨병성 신증을 진단하는 데는 적용되기 어려움이 있다.Therefore, in order to overcome this limitation, biomarkers such as uric acid, TNFR1, TNFR2, FGF23, etc. have been developed, but when these biomarkers are also corrected for albuminuria or estimated glomerular filtration rate, the predictive value of renal function decrease or end-stage renal failure Since it is significantly reduced, it is difficult to apply it in practically diagnosing progressive diabetic nephropathy.

따라서, 진단 정확성이 증가된 진행성 당뇨병성 신증을 진단할 수 있는 신규 바이오 마커가 개발된다면, 말기신부전증으로 진행되는 것을 조기에 예방 또는 치료함으로써, 이로 인한 사망률 및 의료 비용을 현저히 낮출 수 있을 것으로 기대된다.Therefore, if a new biomarker capable of diagnosing progressive diabetic nephropathy with increased diagnostic accuracy is developed, it is expected that it will be possible to significantly reduce mortality and medical costs by preventing or treating the progression to end-stage renal disease at an early stage. .

국내등록특허 10-1240208Domestic Registered Patent 10-1240208

본 발명은 상기와 같은 종래 기술상의 문제점을 해결하기 위해 안출된 것으로, 소변으로부터 분리된 소포 내에 포함되어 있는 마이크로 RNA 중 hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290으로 이루어진 군으로부터 선택된 어느 하나 이상의 마이크로 RNA 또는 이의 단편의 발현 수준의 변화를 측정하는 단계를 포함하는 진행성 당뇨병성 신증의 진단 방법, 상기 마이크로 RNA 또는 이의 단편에 특이적으로 결합하는 프라이머 또는 프로브를 유효성분으로 포함하는 진행성 당뇨병성 신증 진단용 조성물, 및 진단용 키트 등을 제공하는 것을 그 목적으로 한다. The present invention has been devised to solve the problems in the prior art as described above, and among microRNAs contained in vesicles isolated from urine, hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR- 1246, hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 comprising the step of measuring a change in the expression level of any one or more microRNAs or fragments thereof selected from the group consisting of An object of the present invention is to provide a method for diagnosing diabetic nephropathy, a composition for diagnosing progressive diabetic nephropathy comprising a primer or probe specifically binding to the microRNA or fragment thereof as an active ingredient, a diagnostic kit, and the like.

그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical task to be achieved by the present invention is not limited to the tasks mentioned above, and other tasks not mentioned can be clearly understood by those of ordinary skill in the art to which the present invention belongs from the following description. will be.

본 발명은 (a) 생물학적 시료로부터 분리된 소포(extracellular vesicles)로부터 마이크로 RNA를 추출하는 단계; (b) 상기 추출된 마이크로 RNA 내에서 hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290으로 이루어진 군으로부터 선택된 어느 하나 이상의 마이크로 RNA 또는 이의 단편의 발현 수준을 측정하는 단계; 및 (c) 상기 발현 수준이 대조군과 비교하여 증가 또는 감소되었을 때 진행성 당뇨병성 신증으로 분류하는 단계를 포함하는 진행성 당뇨병성 신증의 예측 또는 진단을 위한 정보 제공 방법을 제공한다.The present invention comprises the steps of (a) extracting micro RNA from extracellular vesicles isolated from a biological sample; (b) hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, and hsa in the extracted microRNA - Measuring the expression level of any one or more microRNAs or fragments thereof selected from the group consisting of miR-1290; And (c) provides a method for predicting or diagnosing progressive diabetic nephropathy, comprising the step of classifying it as progressive diabetic nephropathy when the expression level is increased or decreased compared to the control group.

본 발명의 일 구체예에 있어서, 상기 생물학적 시료는 바람직하게는 소변 또는 혈액일 수 있으며, 상기 혈액은 혈장이나 혈청일 수 있으나, 마이크로 RNA가 포함된 소포를 가지고 있는 시료라면 이에 제한되지 않는다.In one embodiment of the present invention, the biological sample may preferably be urine or blood, and the blood may be plasma or serum, but is not limited thereto as long as it has a vesicle containing microRNA.

본 발명의 다른 구체예에 있어서, 상기 대조군은 정상인 또는 진행성 당뇨병성 신증을 가지고 있지 않은 당뇨병 환자인 것을 특징으로 한다.In another embodiment of the present invention, the control group is a normal person or a diabetic patient without progressive diabetic nephropathy.

본 발명의 또 다른 구체예에 있어서, 상기 발현 수준을 측정하는 단계는 바람직하게는 역전사효소 중합효소연쇄반응(RT-PCR), 경쟁적 역전사효소 중합효소연쇄반응(competitive RT-PCR), 실시간 정량 역전사효소 중합효소연쇄반응(real-time quantitative RT-PCR; qRT-PCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(Northern blotting), 유전자 칩, 차세대염기서열분석(next generation sequencing) 등일 수 있으며, 가장 바람직하게는 차세대염기서열분석(next generation sequencing) 방법이나, 마이크로 RNA의 발현 수준을 측정하는 방법이라면 이에 제한되지 않는다.In another embodiment of the present invention, the step of measuring the expression level is preferably reverse transcriptase polymerase chain reaction (RT-PCR), competitive reverse transcriptase polymerase chain reaction (competitive RT-PCR), real-time quantitative reverse transcription It can be enzyme polymerase chain reaction (real-time quantitative RT-PCR; qRT-PCR), RNase protection method, Northern blotting, gene chip, next generation sequencing, etc. and, most preferably, a next generation sequencing method or a method for measuring the expression level of microRNA, but is not limited thereto.

본 발명의 또 다른 구체예에 있어서, 상기 (c) 단계는 바람직하게는 hsa-let-7a-5p, hsa-miR-146a-5p, 및 hsa-miR-1246으로 이루어진 군으로부터 선택된 두 개 이상의 마이크로 RNA 또는 이의 단편의 발현 수준이 대조군과 비교하여 증가 또는 감소되었을 때 진행성 당뇨병성 신증으로 분류할 수 있으며, 또는 hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290으로 이루어진 군으로부터 선택된 두 개 이상의 마이크로 RNA 또는 이의 단편의 발현 수준이 대조군과 비교하여 증가 또는 감소되었을 때 진행성 당뇨병성 신증으로 분류할 수 있으며, 또는 hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1246으로 이루어진 군으로부터 선택된 두 개 이상의 마이크로 RNA 또는 이의 단편의 발현 수준이 대조군과 비교하여 증가 또는 감소되었을 때 진행성 당뇨병성 신증으로 분류할 수 있으나, hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290의 조합이라면 이에 제한되지 않는다.In another embodiment of the present invention, step (c) preferably comprises two or more micro-microorganisms selected from the group consisting of hsa-let-7a-5p, hsa-miR-146a-5p, and hsa-miR-1246. When the expression level of RNA or a fragment thereof is increased or decreased compared to the control group, it can be classified as progressive diabetic nephropathy, or hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290. When the expression level of two or more microRNAs selected from the group consisting of or a fragment thereof is increased or decreased compared to the control group, it can be classified as progressive diabetic nephropathy, or hsa-miR-142-5p, hsa-miR-187 When the expression level of two or more microRNAs or fragments thereof selected from the group consisting of -3p, and hsa-miR-1246 is increased or decreased compared to the control group, it can be classified as progressive diabetic nephropathy, but hsa-let-7a A combination of -5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 is not limited thereto.

또한, 본 발명은 hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290으로 이루어진 군으로부터 선택된 어느 하나 이상의 마이크로 RNA 또는 이의 단편에 특이적으로 결합하는 프라이머 또는 프로브를 유효성분으로 포함하는 소포를 이용한 진행성 당뇨병성 신증 예측 또는 진단용 조성물을 제공한다.In addition, the present invention is hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 Provided is a composition for predicting or diagnosing progressive diabetic nephropathy using a vesicle comprising, as an active ingredient, a primer or probe that specifically binds to any one or more microRNAs or fragments thereof selected from the group consisting of.

또한, 본 발명은 hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290으로 이루어진 군으로부터 선택된 어느 하나 이상의 마이크로 RNA 또는 이의 단편에 특이적으로 결합하는 프라이머 또는 프로브를 유효성분으로 포함하는 소포를 이용한 진행성 당뇨병성 신증 예측 또는 진단용 키트를 제공한다.In addition, the present invention is hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 Provided is a kit for predicting or diagnosing progressive diabetic nephropathy using a vesicle comprising as an active ingredient a primer or probe that specifically binds to any one or more microRNAs or fragments thereof selected from the group consisting of.

본 발명의 일 구체예에 있어서, 상기 소포는 소변 또는 혈액으로부터 분리된 것을 특징으로 한다.In one embodiment of the present invention, the vesicle is characterized in that it is isolated from urine or blood.

본 발명의 다른 구체예에 있어서, 상기 키트는 소포로부터 마이크로 RNA를 분리하는 물질을 추가로 포함할 수 있다.In another embodiment of the present invention, the kit may further include a material for isolating micro RNA from vesicles.

본 발명에 따른 진행성 당뇨병성 신증 진단을 위한 정보 제공 방법은 소변으로부터 분리된 소포 내의 마이크로 RNA를 이용하기 때문에 모든 환자에 적용이 용이할 뿐만 아니라, 비침습적 방법으로 높은 정확성을 가지고 진행성 당뇨병성 신증을 조기에 진단할 수 있다. 진행성 당뇨병성 신증은 말기 신장 질환의 가장 중요한 위험인자이며 진행을 평가하여 조기부터 적극적이고 포괄적인 관리를 하는 것이 무엇보다도 중요한데, 본 발명의 비침습적 바이오 마커는 진행성 당뇨병성 신증을 조기에 정확히 예측 및 진단할 수 있기 때문에, 말기신부전증으로 진행될 수 있는 고위험군 환자를 조기에 예측할 수 있다. 또한, 이를 통하여 적극적이고 포괄적인 관리를 통하여 말기신부전증으로 진행되는 것을 조기에 예방 또는 치료함으로써, 이로 인한 합병증, 사망률 및 의료 비용을 현저히 낮출 수 있을 것으로 기대된다.Since the information providing method for diagnosing progressive diabetic nephropathy according to the present invention uses microRNA in vesicles isolated from urine, it is not only easy to apply to all patients, but also has high accuracy in a non-invasive method to diagnose progressive diabetic nephropathy. can be diagnosed early. Progressive diabetic nephropathy is the most important risk factor for end-stage renal disease, and it is most important to evaluate the progression and conduct active and comprehensive management from an early stage. Because it can be diagnosed, it is possible to predict early in high-risk patients who may progress to end-stage renal disease. In addition, it is expected that complications, mortality and medical costs can be significantly reduced by preventing or treating the progression to end-stage renal disease at an early stage through active and comprehensive management.

도 1은 본 발명의 일 실시예에 따른 다양한 소포 추출법에 따라 소변으로부터 추출된 소포를 확인한 결과를 나타낸 도면이다.
도 2는 본 발명의 일 실시예에 따른 다양한 소포 추출법에 따라 추출된 소포가 exosomal marker를 가지고 있는지 웨스턴 블롯팅으로 확인한 결과를 나타낸 도면이다.
도 3은 본 발명의 일 실시예에 따른 소변으로부터 추출된 소포 내에 포함되어 있는 작은 크기의 RNA(A) 및 큰 크기의 RNA(B)의 크기를 확인한 결과를 나타낸 도면이다.
도 4는 본 발명의 일 실시예에 따른 소변으로부터 추출된 소포 내에 포함되어 있는 마이크로 RNA의 프로파일을 확인한 결과를 나타낸 도면이다.
도 5는 본 발명의 일 실시예에 따른 hsa-let-7a-5p, hsa-miR-146a-5p, 및 hsa-miR-1246 마이크로 RNA의 진단학적 유의성을 확인한 결과를 나타낸 도면이다.
도 6은 본 발명의 일 실시예에 따른 hsa-let-7a-5p, hsa-miR-146a-5p, 및 hsa-miR-1246 마이크로 RNA 발현 수준의 증감에 따른 진단학적 유의성을 확인한 결과를 나타낸 도면이다.
도 7은 본 발명의 일 실시예에 따른 hsa-let-7a-5p, hsa-miR-146a-5p, 및 hsa-miR-1246 마이크로 RNA의 ROC 커브를 확인한 결과를 나타낸 도면이다.
도 8은 본 발명의 일 실시예에 따른 hsa-let-7a-5p, hsa-miR-146a-5p, 및 hsa-miR-1246 마이크로 RNA의 진행성 당뇨병성 신증 진단을 위한 결정 트리를 나타낸 도면이다.
도 9는 본 발명의 일 실시예에 따른 hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290 마이크로 RNA의 진단학적 유의성을 확인한 결과를 나타낸 도면이다.
도 10은 본 발명의 일 실시예에 따른 hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290 마이크로 RNA 발현 수준의 증감에 따른 진단학적 유의성을 확인한 결과를 나타낸 도면이다.
도 11은 본 발명의 일 실시예에 따른 hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290 마이크로 RNA의 ROC 커브를 확인한 결과를 나타낸 도면이다.
도 12는 본 발명의 일 실시예에 따른 hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290 마이크로 RNA의 진행성 당뇨병성 신증 진단을 위한 결정 트리를 나타낸 도면이다.
도 13은 본 발명의 일 실시예에 따른 hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1246 마이크로 RNA의 진단학적 유의성을 확인한 결과를 나타낸 도면이다.
도 14는 본 발명의 일 실시예에 따른 hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1246 마이크로 RNA 발현 수준의 증감에 따른 진단학적 유의성을 확인한 결과를 나타낸 도면이다.
도 15는 본 발명의 일 실시예에 따른 hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1246 마이크로 RNA의 ROC 커브를 확인한 결과를 나타낸 도면이다.
도 16은 본 발명의 일 실시예에 따른 hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1246 마이크로 RNA의 진행성 당뇨병성 신증 진단을 위한 결정 트리를 나타낸 도면이다.
1 is a view showing the results of checking vesicles extracted from urine according to various vesicle extraction methods according to an embodiment of the present invention.
2 is a view showing the result of confirming by Western blotting whether the vesicles extracted according to various vesicle extraction methods according to an embodiment of the present invention have an exosomal marker.
3 is a view showing the results of confirming the sizes of small RNA (A) and large RNA (B) contained in vesicles extracted from urine according to an embodiment of the present invention.
4 is a view showing the result of confirming the profile of the microRNA contained in the vesicle extracted from urine according to an embodiment of the present invention.
5 is a view showing the results of confirming the diagnostic significance of hsa-let-7a-5p, hsa-miR-146a-5p, and hsa-miR-1246 microRNA according to an embodiment of the present invention.
6 is a view showing the results of confirming the diagnostic significance according to the increase or decrease of hsa-let-7a-5p, hsa-miR-146a-5p, and hsa-miR-1246 microRNA expression levels according to an embodiment of the present invention; am.
7 is a view showing the results of confirming the ROC curves of hsa-let-7a-5p, hsa-miR-146a-5p, and hsa-miR-1246 microRNA according to an embodiment of the present invention.
8 is a diagram illustrating a decision tree for diagnosing progressive diabetic nephropathy of hsa-let-7a-5p, hsa-miR-146a-5p, and hsa-miR-1246 microRNAs according to an embodiment of the present invention.
9 is a view showing the results of confirming the diagnostic significance of hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 microRNAs according to an embodiment of the present invention.
10 is a view showing the results of confirming the diagnostic significance according to the increase or decrease of hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 microRNA expression levels according to an embodiment of the present invention; am.
11 is a view showing the results of confirming the ROC curves of hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 microRNA according to an embodiment of the present invention.
12 is a diagram illustrating a decision tree for diagnosing progressive diabetic nephropathy of hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 microRNAs according to an embodiment of the present invention.
13 is a view showing the results of confirming the diagnostic significance of hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1246 microRNAs according to an embodiment of the present invention.
14 is a view showing the results of confirming the diagnostic significance according to the increase or decrease of hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1246 microRNA expression levels according to an embodiment of the present invention; am.
15 is a view showing the results of confirming the ROC curves of hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1246 microRNAs according to an embodiment of the present invention.
16 is a diagram illustrating a decision tree for diagnosing progressive diabetic nephropathy of hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1246 microRNAs according to an embodiment of the present invention.

본 발명은 당뇨병 환자의 소변 유래 소포 내에 포함되어 있는 마이크로 RNA 분석을 통하여 진행성 당뇨병성 진증을 조기에 진단하거나 예측하는 방법에 관한 것으로서, 본 발명자들은 피검자의 소변 시료를 이용하여 소변 유래 소포로부터 마이크로 RNA를 추출하고, 이에 대하여 분석을 수행하여 진행성 당뇨병성 신증의 바이오 마커로 활용할 수 있는 소변 유래 소포 내의 마이크로 RNA를 발굴하고 qRT-PCR을 통하여 확인하였다.The present invention relates to a method for diagnosing or predicting advanced diabetic diabetes mellitus early through microRNA analysis contained in urine-derived vesicles of a diabetic patient. was extracted and analyzed to discover microRNA in urine-derived vesicles that can be used as a biomarker for progressive diabetic nephropathy and confirmed through qRT-PCR.

이에, 본 발명자들은 (a) 생물학적 시료로부터 분리된 소포(extracellular vesicles)로부터 마이크로 RNA를 추출하는 단계; (b) 상기 추출된 마이크로 RNA 내에서 hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290으로 이루어진 군으로부터 선택된 어느 하나 이상의 마이크로 RNA 또는 이의 단편의 발현 수준을 측정하는 단계; 및 (c) 상기 발현 수준이 대조군과 비교하여 증가 또는 감소되었을 때 진행성 당뇨병성 신증으로 분류하는 단계를 포함하는 진행성 당뇨병성 신증 진단을 위한 정보 제공 방법, hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290으로 이루어진 군으로부터 선택된 어느 하나 이상의 마이크로 RNA 또는 이의 단편에 특이적으로 결합하는 프라이머 또는 프로브를 유효성분으로 포함하는, 소포를 이용한 진행성 당뇨병성 신증 진단용 조성물, 상기 진단용 조성물을 포함하는 소포를 이용한 진행성 당뇨병성 신증 진단용 키트를 제공한다.Accordingly, the present inventors (a) extracting micro RNA from vesicles isolated from a biological sample (extracellular vesicles); (b) hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, and hsa in the extracted microRNA - Measuring the expression level of any one or more microRNAs or fragments thereof selected from the group consisting of miR-1290; And (c) the information providing method for diagnosing progressive diabetic nephropathy comprising the step of classifying it as progressive diabetic nephropathy when the expression level is increased or decreased compared to the control, hsa-let-7a-5p, hsa-miR -146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, and any one or more selected from the group consisting of hsa-miR-1290 micro RNA or a fragment thereof specifically Provided are a composition for diagnosing progressive diabetic nephropathy using a vesicle, comprising a binding primer or probe as an active ingredient, and a kit for diagnosing progressive diabetic nephropathy using a vesicle comprising the composition for diagnosis.

본 명세서에 있어서 "생물학적 시료(biological sample)"란, 비침습적으로 획득될 수 있는 시료로서, 소포를 포함하고 있는 모든 시료를 의미하며, 바람직하게는 혈액, 혈장, 혈청, 골수, 조직, 세포, 타액, 객담, 머리카락, 소변, 대변 등일 수 있으며, 더욱 바람직하게는 혈액, 또는 소변이나, 마이크로 RNA를 포함하고 있는 소포를 가지고 있는 시료라면 이에 제한되지 않는다.As used herein, the term "biological sample" is a sample that can be obtained non-invasively, and means any sample containing vesicles, preferably blood, plasma, serum, bone marrow, tissue, cells, It may be saliva, sputum, hair, urine, feces, etc., and more preferably blood or urine, but is not limited thereto if the sample has a vesicle containing microRNA.

본 명세서에 있어서, "소포(extracellular vesicle)"란 다양한 세포로부터 분비되는 나노 크기의 막으로 된 구조물을 의미하며, 본 발명에서는 세포로부터 자연적으로 분비되거나, 인공적으로 생산된, 소변 또는 혈액 내에 포함되어 있는 막으로 된 모든 구조물을 총칭한다. 이러한 소포는 세포밖 소포체, 세포외 소포체, 세포외 소포, 엑소좀, 나노소포, 나노베지클, 미세소포체, 미세소포 등과 혼용되어 사용될 수 있다. 상기 소포는 대략 30 내지 200 nm의 직경을 가지고 있으며, 소포 내에는 세포로부터 유래된 다양한 종류의 단백질, DNA, mRNA, 마이크로 RNA 등이 포함되어 있다. 상기 소포는 소변 또는 혈액으로부터 원심분리, 초고속원심분리, 고압처리, 압출, 초음파분해, 세포 용해, 균질화, 냉동-해동, 전기천공, 기계적 분해, 화학물질 처리, 필터에 의한 여과, 겔 여과 크로마토그래피, 프리-플로우 전기영동, 및 모세관 전기영동으로 이루어진 군에서 선택된 하나 이상의 방법을 사용하여 분리할 수 있다. 또한, 불순물의 제거를 위한 세척, 수득된 소포의 농축 등의 과정을 추가로 포함할 수 있다.As used herein, the term "vesicle (extracellular vesicle)" refers to a structure made of a nano-sized membrane secreted from various cells, and in the present invention, naturally secreted from cells or artificially produced, contained in urine or blood. It is a generic term for all structures made of membranes. These vesicles may be used in combination with extracellular vesicles, extracellular vesicles, extracellular vesicles, exosomes, nanovesicles, nanovesicles, microvesicles, microvesicles, and the like. The vesicle has a diameter of about 30 to 200 nm, and various types of proteins, DNA, mRNA, micro RNA, etc. derived from cells are contained in the vesicle. The vesicles are centrifuged from urine or blood, ultracentrifugation, high pressure treatment, extrusion, sonication, cell lysis, homogenization, freeze-thaw, electroporation, mechanical degradation, chemical treatment, filtration by filter, gel filtration chromatography , free-flow electrophoresis, and capillary electrophoresis. In addition, it may further include processes such as washing for removal of impurities, concentration of the obtained vesicles, and the like.

본 명세서에 있어서, "마이크로 RNA(micro RNA; miRNA)"는 약 10 내지 30 개의 뉴클레오티드로 구성되는 작은 비암호(non-coding) RNA 분자를 총칭한다. 이러한 마이크로 RNA는 식물, 동물, 바이러스 등에서 내인적으로 관찰되 전사(transcription) 후 유전자 발현, RNA 억제(silencing)에 관여하여 단백질의 생산을 조절하는 것으로 알려져 있다.As used herein, "micro RNA (miRNA)" refers to a small non-coding RNA molecule consisting of about 10 to 30 nucleotides. These microRNAs are endogenously observed in plants, animals, viruses, etc. and are known to regulate protein production by participating in gene expression and RNA silencing after transcription.

본 명세서에 있어서 "정보 제공 방법(method for providing information)”이란, 당뇨병 환자에서 진행성 당뇨병성 신증이 발병할 가능성이 있는지, 또는 진행성 당뇨병성 신증이 발병할 가능성이 상대적으로 높은지, 또는 진행성 당뇨병성 신증이 이미 발병하였는지에 대한 정보를 제공하는 방법으로서, 상기 방법을 통하여 진행성 당뇨병성 신증이 발병으로 이한 말기신부전증 유발 위험성, 즉, 고위험군에 대해서도 예측할 수 있으며, 이를 말기신부전증의 예방 및 치료에 관한 정보를 제공하는 방법으로서도 사용할 수도 있다. As used herein, the term "method for providing information" refers to whether there is a possibility of developing progressive diabetic nephropathy in a diabetic patient, or whether the possibility of developing progressive diabetic nephropathy is relatively high, or progressive diabetic nephropathy. As a method of providing information on whether or not this has already occurred, the risk of inducing end-stage renal disease due to the onset of progressive diabetic nephropathy, that is, the high-risk group, can also be predicted through the method, which provides information on the prevention and treatment of end-stage renal disease It can also be used as a method to

본 명세서에 있어서 “마이크로 RNA의 발현 수준을 측정하는 방법”은 진행성 당뇨병성 신증을 예측 또는 진단하기 위하여 소변 유래 소포 내에 포함되어 있는 hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, 및/또는 hsa-miR-1290 마이크로 RNA의 양을 측정함으로써 확인할 수 있다. 이를 위한 분석 방법으로는 RT-PCR, 경쟁적 RT-PCR(competitive RT-PCR), 실시간 정량 RT-PCR(Real-time qRT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(northern blotting), DNA 마이크로어레이 칩, Luminex를 이용한 Target-Specific PCR sequence detection with MagPlex®™Microsphere 등이 있으나, 이들로 한정되는 것은 아니다. As used herein, the “method for measuring the expression level of microRNA” refers to hsa-let-7a-5p, hsa-miR-146a-5p, hsa contained in urine-derived vesicles to predict or diagnose progressive diabetic nephropathy. It can be confirmed by measuring the amount of -miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, and/or hsa-miR-1290 microRNA. Analysis methods for this are RT-PCR, competitive RT-PCR (competitive RT-PCR), real-time quantitative RT-PCR (Real-time qRT-PCR), RNase protection assay (RPA; RNase protection assay), Northern blotting ( Northern blotting), DNA microarray chip, Target-Specific PCR sequence detection using Luminex with MagPlex® Microsphere, etc., but are not limited thereto.

본 명세서에 있어서, "키트(kit)"란 소변 유래 소포 내에 포함되어 있는 hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, 및/또는 hsa-miR-1290 마이크로 RNA의 양을 측정하여 진행성 당뇨병성 신증의 발병 여부를 예측할 수 있는 검진용 기기를 의미하며, 환자로부터 분리된 생물학적 시료로부터 상기 마이크로 NA 양을 측정할 수 있는 형태라면 제한이 없다. 바람직하게는 상기 마이크로 RNA에 대하여 상보적인 서열을 가지는 프로브(probe) 또는 프라이머(primer) 세트를 포함할 수 있으며, 상기 "프로브 또는 프라이머"는 상기 마이크로 RNA 또는 이의 단편에 상보적인 서열을 가지는 올리고뉴클레오타이드(oliogonucleotide)를 의미하나, 상기 마이크로 RNA 또는 이의 단편의 양을 측정할 수 있는 물질이라면 이에 제한되지 않는다.As used herein, "kit" means hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa contained in urine-derived vesicles. -MiR-187-3p, and/or hsa-miR-1290 means a screening device that can predict the onset of progressive diabetic nephropathy by measuring the amount of microRNA, and the microNA from a biological sample isolated from a patient There is no limitation as long as it is a form in which the quantity can be measured. Preferably, a probe or primer set having a sequence complementary to the microRNA may be included, and the "probe or primer" is an oligonucleotide having a sequence complementary to the microRNA or a fragment thereof. (oliogonucleotide), but is not limited thereto, as long as it is a substance capable of measuring the amount of the microRNA or fragment thereof.

본 명세서에 있어서, “단편(fragment)”이란 마이크로 RNA의 서열과 비교하여 일부가 결실되거나, 또는 일부가 추가되거나, 또는 마이크로 RNA 서열과 상응하는 위치와 동일한 서열의 분절을 포함하는 것일 수 있으며, 본 발명의 마이크로 RNA 발현 수준을 측정할 수 있는 서열이라면 이에 제한되지 않는다.As used herein, the term "fragment" may include a fragment of a sequence in which a part is deleted or a part is added compared to the sequence of the microRNA, or a sequence identical to the position corresponding to the microRNA sequence, If it is a sequence capable of measuring the expression level of the microRNA of the present invention, it is not limited thereto.

이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[실시예][Example]

실시예 1: 소변으로부터 소포 추출Example 1: Extraction of Vesicles from Urine

소변으로부터 추출된 소포를 진단에 사용 가능한지 확인하기 위하여, 제2형 당뇨병 환자의 소변으로부터 다양한 방법을 이용하여 소포(extracellular vesicle)를 추출하였다.In order to confirm whether the vesicles extracted from the urine can be used for diagnosis, vesicles (extracellular vesicles) were extracted from the urine of type 2 diabetes patients using various methods.

1.1. 초원심분리법(ultracentrifugation)1.1. Ultracentrifugation

일차적으로 소변 내에 포함되어 있는 파편(debris)들을 제거하기 위하여, 100 mL의 소변을 50 mL의 튜브에 나누어 담고, 2,000 g, 4 ℃의 조건으로 20 분 동안 원심분리하고, 상층액을 수거하여 새로운 50 mL의 튜브에 옮겨 담았다. 이후 큰 막 소포(large membrane vesicle)를 제거하기 위하여, 13,500 g, 4 ℃의 조건으로 20 분 동안 원심분리하고, 상층액을 다시 새로운 튜브로 옮겨 담았다. 그리고 200,000 g, 4 ℃의 조건으로 60 분 동안 초고속 원심분리를 실시하고 상층액을 제거하여, 소포 펠릿(pellet)을 획득하였다. 획득된 소포 펠릿은 400 μL의 인산염완충용액(phosphate buffered saline; PBS)을 이용하여 재부유시킨 후에 사용하기 전까지 -80 ℃에서 보관하였다.First, in order to remove the debris contained in the urine, 100 mL of urine is divided into 50 mL tubes, centrifuged at 2,000 g and 4 ° C for 20 minutes, and the supernatant is collected and fresh. Transferred to a 50 mL tube. Afterwards, in order to remove large membrane vesicles, centrifugation was performed at 13,500 g, 4 °C for 20 minutes, and the supernatant was transferred to a new tube again. And 200,000 g, ultra-high speed centrifugation was performed for 60 minutes under the conditions of 4 °C, and the supernatant was removed to obtain a vesicle pellet. The obtained vesicle pellet was resuspended using 400 μL of phosphate buffered saline (PBS) and stored at -80°C until use.

1.2. 침전법(Precipitation)1.2. Precipitation

일차적으로 소변 내에 포함되어 있는 파편(debris)들을 제거하기 위하여, 100 mL의 소변을 50 mL의 튜브에 나누어 담고, 2,000 g, 4 ℃의 조건으로 20 분 동안 원심분리하고, 상층액을 수거하여 새로운 50 mL의 튜브에 옮겨 담았다. 이후 큰 막 소포(large membrane vesicle)를 제거하기 위하여, 13,500 g, 4 ℃의 조건으로 20 분 동안 원심분리하고, 획득된 상층액은 0.22 μm 필터를 이용하여 여과하였다. 그리고 amicon tube(100 K)를 이용하여 5 mL로 농축시켰다. 농축된 5 mL의 소변 시료에 1 mL의 ExoQuick-TC 용액을 첨가하고 혼합한 후에, 4 ℃에서 16 시간 동안 반응시켜 소포 펠릿을 획득하였다. 획득된 소포 펠릿은 400 μL의 인산염완충용액(phosphate buffered saline; PBS)을 이용하여 재부유시킨 후에 사용하기 전까지 -80 ℃에서 보관하였다.First, in order to remove the debris contained in the urine, 100 mL of urine is divided into 50 mL tubes, centrifuged at 2,000 g and 4 ° C for 20 minutes, and the supernatant is collected and fresh. Transferred to a 50 mL tube. Afterwards, in order to remove large membrane vesicles, centrifugation was performed at 13,500 g, 4 °C for 20 minutes, and the obtained supernatant was filtered using a 0.22 μm filter. Then, it was concentrated to 5 mL using an amicon tube (100 K). 1 mL of ExoQuick-TC solution was added to the concentrated 5 mL urine sample and mixed, followed by reaction at 4° C. for 16 hours to obtain vesicle pellets. The obtained vesicle pellet was resuspended using 400 μL of phosphate buffered saline (PBS) and stored at -80°C until use.

1.3. 크로마토그래피법(Chromatography)1.3. Chromatography

일차적으로 소변 내에 포함되어 있는 파편(debris)들을 제거하기 위하여, 100 mL의 소변을 50 mL의 튜브에 나누어 담고, 2,000 g, 4 ℃의 조건으로 20 분 동안 원심분리하고, 상층액을 수거하여 새로운 50 mL의 튜브에 옮겨 담았다. 이후 큰 막 소포(large membrane vesicle)를 제거하기 위하여, 13,500 g, 4 ℃의 조건으로 20 분 동안 원심분리하고, 획득된 상층액은 0.22 μm 필터를 이용하여 여과하였다. 그리고 amicon tube(100 K)를 이용하여 500 μL로 농축시켰다. 그리고 qEV 컬럼에 10 mL의 인산염완충용액을 주입한 뒤에, 500 μL로 농축시킨 시료를 주입하였다. 그리고 인산염완충용액을 1 mL씩 연속적으로 주입하며, 컬럼을 통과하여 나온 용액을 회수하였다. 회수 방법은 fraction 1에서 5까지는 2.5 mL씩 회수하였고, 이후 fraction 15까지는 500 μ씩 회수하였다. 그리고 소포가 포함되어 있는 fraction 7 내지 11은 사용하기 전까지 -80 ℃에서 보관하였다.First, in order to remove the debris contained in the urine, 100 mL of urine is divided into 50 mL tubes, centrifuged at 2,000 g and 4 ° C for 20 minutes, and the supernatant is collected and fresh. Transferred to a 50 mL tube. Afterwards, in order to remove large membrane vesicles, centrifugation was performed at 13,500 g, 4 °C for 20 minutes, and the obtained supernatant was filtered using a 0.22 μm filter. Then, it was concentrated to 500 μL using an amicon tube (100 K). Then, 10 mL of a phosphate buffer solution was injected into the qEV column, and a sample concentrated to 500 μL was injected. Then, 1 mL of the phosphate buffer solution was continuously injected, and the solution passed through the column was recovered. According to the recovery method, 2.5 mL was recovered from fractions 1 to 5, and 500 μL was recovered for fraction 15 thereafter. And fractions 7 to 11 containing vesicles were stored at -80 °C until use.

1.4. 한외여과법(Ultrafiltration)1.4. Ultrafiltration

일차적으로 소변 내에 포함되어 있는 파편(debris)들을 제거하기 위하여, 100 mL의 소변을 50 mL의 튜브에 나누어 담고, 2,000 g, 4 ℃의 조건으로 20 분 동안 원심분리하고, 상층액을 수거하여 새로운 50 mL의 튜브에 옮겨 담았다. 이후 큰 막 소포(large membrane vesicle)를 제거하기 위하여, 13,500 g, 4 ℃의 조건으로 20 분 동안 원심분리하고, 획득된 상층액은 0.22 μm 필터를 이용하여 여과하였다. 그리고 amicon tube(100 K)를 이용하여 400 μL로 농축시킨 후, 사용하기 전까지 -80 ℃에서 보관하였다.First, in order to remove the debris contained in the urine, 100 mL of urine is divided into 50 mL tubes, centrifuged at 2,000 g and 4 ° C for 20 minutes, and the supernatant is collected and fresh. Transferred to a 50 mL tube. Afterwards, in order to remove large membrane vesicles, centrifugation was performed at 13,500 g, 4 °C for 20 minutes, and the obtained supernatant was filtered using a 0.22 μm filter. And after concentration to 400 μL using an amicon tube (100 K), it was stored at -80 ℃ until use.

실시예Example 2: 소변으로부터 추출된 소포의 확인 2: Identification of vesicles extracted from urine

실시예 1과 동일한 방법으로 추출된 소포를 Malvern NanoSight NS300 장비를 이용하여 확인하였다. 그 결과는 도 1에 나타내었다. 또한, 추출된 소포를 이용하여 웨스턴 블롯팅을 실시하였다. 그 결과는 도 2에 나타내었다.Vesicles extracted in the same manner as in Example 1 were identified using Malvern NanoSight NS300 equipment. The results are shown in FIG. 1 . In addition, Western blotting was performed using the extracted vesicles. The results are shown in FIG. 2 .

도 1에 나타난 바와 같이, 각 추출법들 모두에서 100 내지 300 nm의 직경을 가진 소포가 추출되었다는 것을 확인하였다.As shown in FIG. 1 , it was confirmed that vesicles having a diameter of 100 to 300 nm were extracted in all of the extraction methods.

또한 도 2에 나타난 바와 같이, 소변으로부터 추출된 소포가 모두 exosomal marker인 CD-9, TSG101, 및 베타-액틴을 포함하고 있는 것을 확인하였다.In addition, as shown in FIG. 2 , it was confirmed that all vesicles extracted from urine contained exosomal markers CD-9, TSG101, and beta-actin.

상기 결과들을 통하여, 소변으로부터 정상적으로 소포가 분리되었다는 것을 확인할 수 있었다.Through the above results, it was confirmed that the vesicles were normally separated from the urine.

실시예Example 3: 소변으로부터 추출된 소포 내에 포함된 RNA 확인 3: Identification of RNA contained in vesicles extracted from urine

소변으로부터 추출된 소포 내에 마이크로 RNA(micro RNA; miRNA)가 포함되어 있는지 확인하기 위하여, miRNeasy Serum/Plasma Kit(Qiagen)를 이용하여 실시예 1과 동일한 방법으로 추출한 소포로부터 RNA를 추출하였다. 그리고 추출된 RNA는 Agilent 2100 Bioanalyzer(Agilent Technologies)를 이용하여 크기를 확인하였다. 200 nt 이하의 작은 크기의 RNA는 Agilent Small RNA Kit를 이용하여 그 크기를 측정하였으며, 그 결과는 도 3A에 나타내었다. 또한, 약 4,200 nt 정도의 큰 크기의 RNA는 Agilent RNA 6000 Pico Kit로 측정하였으며, 그 결과는 도 3B에 나타내었다. In order to check whether micro RNA (miRNA) is contained in the vesicles extracted from urine, RNA was extracted from the vesicles extracted in the same manner as in Example 1 using the miRNeasy Serum/Plasma Kit (Qiagen). And the size of the extracted RNA was confirmed using an Agilent 2100 Bioanalyzer (Agilent Technologies). Small RNA sizes of 200 nt or less were measured using the Agilent Small RNA Kit, and the results are shown in FIG. 3A. In addition, a large RNA size of about 4,200 nt was measured with the Agilent RNA 6000 Pico Kit, and the results are shown in FIG. 3B.

도 3에 나타난 바와 같이, 500 nt 이상의 RNA는 포함되지 않은 반면, 200 nt 이하의 small RNA가 소포에 포함되어 있는 것을 확인하였다. As shown in FIG. 3 , it was confirmed that RNA of 500 nt or more was not included, whereas small RNA of 200 nt or less was included in the vesicle.

실시예Example 4: 소변으로부터 추출된 소포 내에 포함된 마이크로 RNA 프로파일 확인 4: Confirmation of microRNA profile contained in vesicles extracted from urine

4.1. 진행성 당뇨병성 4.1. progressive diabetic 신증Nephropathy 환자의 소변으로부터 추출된 소포 내의 마이크로 RNA 프로파일 확인 Confirmation of microRNA profile in vesicles extracted from patient's urine

제2형 당뇨병 환자 중에서 진행성 당뇨병성 신증이 있다고 판단되는 환자의 소변으로부터 추출된 소포 내의 마이크로 RNA의 프로파일을 확인하기 위하여, 차세대염기서열분석(next generation sequencing; NGS)을 실시하였다. 그 결과는 도 4에 나타내었다.Next generation sequencing (NGS) was performed to confirm the profile of microRNAs in vesicles extracted from urine of patients with advanced diabetic nephropathy among type 2 diabetes patients. The results are shown in FIG. 4 .

도 4A에 나타난 바와 같이, 초원심분리법(UC)으로 추출한 소포에서는 314 종류의 마이크로 RNA가 검출되었으며, 크로마토그래피법(qEV)으로 추출한 소포에서는 174 종류의 마이크로 RNA가 검출되었다. 또한, 침전법(Exoquick)으로 추출한 소포에서는 91 종류의 마이크로 RNA가 검출되었으며, 한외여과법(Amicon)으로 추출한 소포에서는 130 종류의 마이크로 RNA가 검출되었다. As shown in FIG. 4A , 314 types of microRNAs were detected in vesicles extracted by ultracentrifugation (UC), and 174 types of microRNAs were detected in vesicles extracted by chromatography (qEV). In addition, 91 types of microRNAs were detected in the vesicles extracted by the exoquick method, and 130 types of microRNAs were detected in the vesicles extracted by the ultrafiltration method (Amicon).

또한 도 4B에 나타난 바와 같이, 모든 추출법에서 동일하게 검출된 마이크로 RNA는 57 종류였다.Also, as shown in FIG. 4B , 57 types of microRNAs were identically detected in all extraction methods.

4.2. 진행성 당뇨병성 신증을 예측할 수 있는 마이크로 RNA 확인4.2. Identification of microRNAs that could predict progressive diabetic nephropathy

진행성 당뇨병성 신증을 예측할 수 있는 마이크로 RNA를 확인하기 위하여, 실험군으로는 제2형 당뇨병 환자 중에서 진행성 당뇨병성 신증이 있다고 판단되는 환자 60 명의 소변으로부터 추출된 소포 내의 마이크로 RNA를 이용하였다. 그리고 대조군으로는 제2형 당뇨병 환자 중에서 비진행성 당뇨병성 신증이 있거나, 신증이 없다고 판단되는 환자 58 명의 소변으로부터 추출된 소포 내의 마이크로 RNA를 이용하였다. 각각의 마이크로 RNA를 차세대염기서열분석법으로 확인하여, 대조군과 실험군에서 유의성있는 차이를 보이는 마이크로 RNA를 확인하였다.In order to identify microRNAs that can predict progressive diabetic nephropathy, microRNAs in vesicles extracted from the urine of 60 patients judged to have progressive diabetic nephropathy among type 2 diabetes patients were used as the experimental group. And, as a control group, microRNAs in vesicles extracted from the urine of 58 patients with or without non-progressive diabetic nephropathy among type 2 diabetes patients were used. Each microRNA was confirmed by next-generation sequencing, and microRNAs showing a significant difference between the control group and the experimental group were identified.

그 결과, hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290의 마이크로 RNA의 프로파일에서 유의성있는 차이를 나타내는 것을 확인하였다. 각각의 마이크로 RNA 서열은 표 1에 나타내었다. As a result, the microRNAs of hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 It was confirmed that there was a significant difference in the profile of Each microRNA sequence is shown in Table 1.

miRNAmiRNA SequenceSequence 서열번호SEQ ID NO: hsa-let-7a-5phsa-let-7a-5p ugagguaguagguuguauaguuugagguaguagguuguauaguu 1One hsa-miR-146a-5phsa-miR-146a-5p ugagaacugaauuccauggguuugagaacugaauuccauggguu 22 hsa-miR-1246hsa-miR-1246 aauggauuuuuggagcaggaauggauuuuuggagcagg 33 hsa-miR-142-5phsa-miR-142-5p cauaaaguagaaagcacuacucauaaaguagaaagcacuacu 44 hsa-miR-187-3phsa-miR-187-3p ucgugucuuguguugcagccggucgugucuuguguugcagccgg 55 hsa-miR-1290hsa-miR-1290 uggauuuuuggaucagggauggauuuuuggaucaggga 66

4.3. 진행성 당뇨병성 4.3. progressive diabetic 신증을testify 예측할 수 있는 마이크로 RNA 검증 Predictable Micro RNA Validation

실시예 4.2에서 확인된 6 개의 마이크로 RNA의 조합을 이용하여 진행성 당뇨병성 신증의 진단 예측 정확성을 높일 수 있는지 확인하기 위하여, 각각의 마이크로 RNA의 발현 정도 및 이의 조합을 이용한 진단 예측 정확성은 차세대염기서열분석법을 이용하여 확인하였다.In order to confirm that the diagnostic prediction accuracy of progressive diabetic nephropathy can be improved using the combination of the six microRNAs identified in Example 4.2, the expression level of each microRNA and the diagnostic prediction accuracy using a combination thereof It was confirmed using the analytical method.

hsa-let-7a-5p, hsa-miR-146a-5p, 및 hsa-miR-1246의 조합에 대한 진단 예측 정확성 결과는 도 5 내지 7에 나타내었다. 예측 모델을 위한 결정 트리(decision tree)는 도 8에 나타내었다.The diagnostic prediction accuracy results for the combination of hsa-let-7a-5p, hsa-miR-146a-5p, and hsa-miR-1246 are shown in FIGS. 5 to 7 . A decision tree for the predictive model is shown in FIG. 8 .

도 5에 나타난 바와 같이, hsa-let-7a-5p, hsa-miR-146a-5p, 및 hsa-miR-1246는 진행성 당뇨병성 신증의 진단 예측에 있어서 유의성있는 결과를 나타낸다는 것을 확인하였다. 그리고 도 6에 나타난 바와 같이, has-miR-146a-5p 및 has-miR-1246은 진행성 당뇨병성 신증 환자에서 유의성있게 증가되며, has-let-7a-5p는 감소되는 것을 확인하였다. 또한, 도 7에 나타난 바와 같이, ROC 커브를 통하여, 평균 77 %의 진단 정확성을 나타내는 것을 확인하였다.As shown in FIG. 5 , it was confirmed that hsa-let-7a-5p, hsa-miR-146a-5p, and hsa-miR-1246 showed significant results in predicting the diagnosis of progressive diabetic nephropathy. And, as shown in FIG. 6 , it was confirmed that has-miR-146a-5p and has-miR-1246 were significantly increased in patients with advanced diabetic nephropathy, and has-let-7a-5p was decreased. In addition, as shown in FIG. 7 , through the ROC curve, it was confirmed that the average diagnostic accuracy was 77%.

hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290의 조합에 대한 진단 예측 정확성 결과는 도 9 내지 11에 나타내었다. 예측 모델을 위한 결정 트리(decision tree)는 도 12에 나타내었다.The diagnostic prediction accuracy results for the combination of hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 are shown in FIGS. 9 to 11 . A decision tree for the predictive model is shown in FIG. 12 .

도 9에 나타난 바와 같이, hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290는 진행성 당뇨병성 신증의 진단 예측에 있어서 유의성있는 결과를 나타낸다는 것을 확인하였다. 그리고 도 10에 나타난 바와 같이, hsa-miR-142-5p 및 hsa-miR-1290은 진행성 당뇨병성 신증 환자에서 유의성있게 증가되며, hsa-miR-187-3p는 감소되는 것을 확인하였다. 또한, 도 11에 나타난 바와 같이, ROC 커브를 통하여, 평균 85 %의 진단 정확성을 나타내는 것을 확인하였다.As shown in FIG. 9 , it was confirmed that hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 showed significant results in predicting the diagnosis of progressive diabetic nephropathy. And as shown in FIG. 10 , it was confirmed that hsa-miR-142-5p and hsa-miR-1290 were significantly increased in patients with advanced diabetic nephropathy, and hsa-miR-187-3p was decreased. In addition, as shown in FIG. 11 , it was confirmed that the average diagnostic accuracy was 85% through the ROC curve.

hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1246의 조합에 대한 진단 예측 정확성 결과는 도 13 내지 15에 나타내었다. 예측 모델을 위한 결정 트리(decision tree)는 도 16에 나타내었다.The diagnostic prediction accuracy results for the combination of hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1246 are shown in FIGS. 13 to 15 . A decision tree for the predictive model is shown in FIG. 16 .

도 13에 나타난 바와 같이, hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1246은 진행성 당뇨병성 신증의 진단 예측에 있어서 유의성있는 결과를 나타낸다는 것을 확인하였다. 그리고 도 14에 나타난 바와 같이, hsa-miR-142-5p 및 hsa-miR-1246은 진행성 당뇨병성 신증 환자에서 유의성있게 증가되며, hsa-miR-187-3p는 감소되는 것을 확인하였다. 또한, 도 15에 나타난 바와 같이, ROC 커브를 통하여, 평균 86 %의 진단 정확성을 나타내는 것을 확인하였다.As shown in FIG. 13 , it was confirmed that hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1246 showed significant results in predicting the diagnosis of progressive diabetic nephropathy. And as shown in FIG. 14 , it was confirmed that hsa-miR-142-5p and hsa-miR-1246 were significantly increased in patients with advanced diabetic nephropathy, and hsa-miR-187-3p was decreased. In addition, as shown in FIG. 15 , it was confirmed that the average diagnostic accuracy was 86% through the ROC curve.

상기 결과들을 통하여, 본 발명의 차세대염기서열분석법을 이용한 진단 방법은 소변, 혈청 등의 용이하게 획득이 가능한 생물학적 시료로부터 분리된 소포에 포함되어 있는 hsa-let-7a-5p, hsa-miR-146a-5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, 및 hsa-miR-1290 마이크로 RNA를 이용함으로써, 모든 환자에게 적용이 용이할 뿐만 아니라, 높은 진단 정확성을 가지고 있기 때문에 진행성 당뇨병성 신증의 예측 또는 진단에 효과적으로 사용하여, 말기신부전증으로 진행될 수 있는 고위험군 환자를 조기에 예측하여 적극적이고 포괄적인 관리를 통하여 말기신부전증으로 진행되는 것을 조기에 예방 또는 치료함으로써, 이로 인한 합병증, 사망률 및 의료 비용을 현저히 낮출 수 있을 것으로 기대된다.Through the above results, the diagnostic method using the next-generation sequencing method of the present invention is hsa-let-7a-5p, hsa-miR-146a contained in vesicles isolated from easily obtainable biological samples such as urine and serum. By using -5p, hsa-miR-1246, hsa-miR-142-5p, hsa-miR-187-3p, and hsa-miR-1290 microRNAs, not only easy application to all patients, but also high diagnostic accuracy It is effectively used for predicting or diagnosing progressive diabetic nephropathy because it has a It is expected to significantly reduce complications, mortality, and medical costs.

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다. The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> MD Healthcare Inc. GIL MEDICAL CENTER Gachon University of Industry-Academic cooperation Foundation <120> A composition for diagnosing diabetic nephropathy <130> MP18-323 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-let-7a-5p <400> 1 ugagguagua gguuguauag uu 22 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-146a-5p <400> 2 ugagaacuga auuccauggg uu 22 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-1246 <400> 3 aauggauuuu uggagcagg 19 <210> 4 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-142-5p <400> 4 cauaaaguag aaagcacuac u 21 <210> 5 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-187-3p <400> 5 ucgugucuug uguugcagcc gg 22 <210> 6 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-1290 <400> 6 uggauuuuug gaucaggga 19 <110> MD Healthcare Inc. GIL MEDICAL CENTER Gachon University of Industry-Academic cooperation Foundation <120> A composition for diagnosing diabetic nephropathy <130> MP18-323 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-let-7a-5p <400> 1 ugagguagua gguuguauag uu 22 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-146a-5p <400> 2 ugagaacuga auuccauggg uu 22 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-1246 <400> 3 aauggauuuu uggagcagg 19 <210> 4 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-142-5p <400> 4 cauaaaguag aaagcacuac u 21 <210> 5 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-187-3p <400> 5 ucgugucuug uguugcagcc gg 22 <210> 6 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-1290 <400> 6 uggauuuuug gaucaggga 19

Claims (12)

(a) 생물학적 시료로부터 분리된 소포(extracellular vesicles)로부터 마이크로 RNA를 추출하는 단계;
(b) 상기 추출된 마이크로 RNA 내에서 hsa-miR-142-5p 마이크로 RNA 및 hsa-miR-187-3p 마이크로 RNA, 또는 이들의 단편의 발현 수준을 측정하는 단계; 및
(c) 상기 발현 수준이 대조군과 비교하여 증가 또는 감소되었을 때 진행성 당뇨병성 신증으로 분류하는 단계를 포함하는, 진행성 당뇨병성 신증의 예측 또는 진단을 위한 정보 제공 방법.
(a) extracting micro RNA from extracellular vesicles isolated from a biological sample;
(b) measuring the expression level of hsa-miR-142-5p micro RNA and hsa-miR-187-3p micro RNA, or fragments thereof in the extracted micro RNA; and
(c) a method of providing information for prediction or diagnosis of progressive diabetic nephropathy, comprising the step of classifying as progressive diabetic nephropathy when the expression level is increased or decreased compared to the control group.
제 1 항에 있어서,
상기 생물학적 시료는 소변 또는 혈액인 것을 특징으로 하는, 정보 제공 방법.
The method of claim 1,
The method for providing information, characterized in that the biological sample is urine or blood.
제 1 항에 있어서,
상기 대조군은 정상인 또는 진행성 당뇨병성 신증을 가지고 있지 않은 당뇨병 환자인 것을 특징으로 하는, 정보 제공 방법.
The method of claim 1,
The control group, characterized in that a normal person or a diabetic patient without progressive diabetic nephropathy, information providing method.
제 1 항에 있어서,
상기 발현 수준을 측정하는 단계는 차세대염기서열분석(next generation sequencing), 역전사효소 중합효소연쇄반응(RT-PCR), 경쟁적 역전사효소 중합효소연쇄반응(competitive RT-PCR), 실시간 정량 역전사효소 중합효소연쇄반응(real-time quantitative RT-PCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(Northern blotting), 및 유전자 칩으로 이루어진 군으로부터 선택된 어느 하나 이상의 방법으로 측정하는 것을 특징으로 하는, 정보 제공 방법.
The method of claim 1,
The step of measuring the expression level includes next generation sequencing, reverse transcriptase polymerase chain reaction (RT-PCR), competitive reverse transcriptase polymerase chain reaction (competitive RT-PCR), real-time quantitative reverse transcriptase polymerase Information characterized in that it is measured by any one or more methods selected from the group consisting of real-time quantitative RT-PCR, RNase protection method, Northern blotting, and gene chip. How to provide.
삭제delete 제 1 항에 있어서,
상기 (b) 단계는 hsa-miR-1290, hsa-miR-1246, hsa-let-7a-5p, 및 hsa-miR-146a-5p로 이루어진 군으로부터 선택된 한 개 이상의 마이크로 RNA 또는 이의 단편의 발현 수준을 측정하는 단계를 추가로 포함하는 것을 특징으로 하는, 정보 제공 방법.
The method of claim 1,
In step (b), the expression level of one or more microRNAs or fragments thereof selected from the group consisting of hsa-miR-1290, hsa-miR-1246, hsa-let-7a-5p, and hsa-miR-146a-5p Method for providing information, characterized in that it further comprises the step of measuring.
삭제delete hsa-miR-142-5p 마이크로 RNA 및 hsa-miR-187-3p 마이크로 RNA, 또는 이들의 단편에 특이적으로 결합하는 프라이머 또는 프로브를 유효성분으로 포함하는, 소포를 이용한 진행성 당뇨병성 신증 예측 또는 진단용 조성물.For predicting or diagnosing progressive diabetic nephropathy using vesicles, comprising as an active ingredient a primer or probe that specifically binds to hsa-miR-142-5p micro RNA and hsa-miR-187-3p micro RNA, or fragments thereof composition. 제 8 항에 있어서,
상기 진단용 조성물은 hsa-miR-1290, hsa-miR-1246, hsa-let-7a-5p, 및 hsa-miR-146a-5p로 이루어진 군으로부터 선택된 한 개 이상의 마이크로 RNA 또는 이의 단편에 특이적으로 결합하는 프라이머 또는 프로브를 추가로 포함하는 것을 특징으로 하는, 예측 또는 진단용 조성물.
9. The method of claim 8,
The diagnostic composition specifically binds to one or more microRNAs or fragments thereof selected from the group consisting of hsa-miR-1290, hsa-miR-1246, hsa-let-7a-5p, and hsa-miR-146a-5p. A composition for prediction or diagnosis, characterized in that it further comprises a primer or probe.
hsa-miR-142-5p 마이크로 RNA 및 hsa-miR-187-3p 마이크로 RNA, 또는 이들의 단편에 특이적으로 결합하는 프라이머 또는 프로브를 유효성분으로 포함하는, 소포를 이용한 진행성 당뇨병성 신증 예측 또는 진단용 키트.For predicting or diagnosing progressive diabetic nephropathy using vesicles, comprising as an active ingredient a primer or probe that specifically binds to hsa-miR-142-5p micro RNA and hsa-miR-187-3p micro RNA, or fragments thereof kit. 제 10 항에 있어서,
상기 키트는 hhsa-miR-1290, hsa-miR-1246, hsa-let-7a-5p, 및 hsa-miR-146a-5p로 이루어진 군으로부터 선택된 한 개 이상의 마이크로 RNA 또는 이의 단편에 특이적으로 결합하는 프라이머 또는 프로브를 추가로 포함하는 것을 특징으로 하는, 예측 또는 진단용 키트.
11. The method of claim 10,
The kit specifically binds to one or more microRNAs or fragments thereof selected from the group consisting of hhsa-miR-1290, hsa-miR-1246, hsa-let-7a-5p, and hsa-miR-146a-5p. A kit for prediction or diagnosis, characterized in that it further comprises a primer or probe.
제 10 항에 있어서,
상기 키트는 소포로부터 마이크로 RNA를 분리하는 물질을 추가로 포함하는 것을 특징으로 하는, 예측 또는 진단용 키트.
11. The method of claim 10,
The kit is a kit for prediction or diagnosis, characterized in that it further comprises a material for isolating micro RNA from a vesicle.
KR1020190083157A 2019-07-10 2019-07-10 A composition for diagnosing diabetic nephropathy KR102323535B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020190083157A KR102323535B1 (en) 2019-07-10 2019-07-10 A composition for diagnosing diabetic nephropathy
PCT/KR2020/002033 WO2021006449A1 (en) 2019-07-10 2020-02-13 Composition for diagnosing diabetic nephropathy

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190083157A KR102323535B1 (en) 2019-07-10 2019-07-10 A composition for diagnosing diabetic nephropathy

Publications (2)

Publication Number Publication Date
KR20210007180A KR20210007180A (en) 2021-01-20
KR102323535B1 true KR102323535B1 (en) 2021-11-08

Family

ID=74113991

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190083157A KR102323535B1 (en) 2019-07-10 2019-07-10 A composition for diagnosing diabetic nephropathy

Country Status (2)

Country Link
KR (1) KR102323535B1 (en)
WO (1) WO2021006449A1 (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5902088B2 (en) * 2009-09-10 2016-04-13 フレミング・ヴェリンFlemming VELIN MicroRNA production method and therapeutic application thereof
KR101240208B1 (en) 2010-06-09 2013-03-06 고려대학교 산학협력단 Proteinic markers for diagnosing type I diabetic nephropathy
GB201601544D0 (en) * 2016-01-28 2016-03-16 Univ Cardiff Kidney disease diagnostic

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Int. J. Mol. Sci. 2017, 18, 456; doi:10.3390/ijms18030456
Kidney International Reports, (2018) Vol. 3, pp 555-572. 1부.*

Also Published As

Publication number Publication date
WO2021006449A1 (en) 2021-01-14
KR20210007180A (en) 2021-01-20

Similar Documents

Publication Publication Date Title
US20190264283A1 (en) URINE EXOSOME mRNAS AND METHODS OF USING SAME TO DETECT DIABETIC NEPHROPATHY
US9012615B2 (en) Methods for characterizing kidney function
US20160222456A1 (en) URINE EXOSOME mRNAs AND METHODS OF USING SAME TO DETECT DIABETIC NEPHROPATHY
EP3218521B1 (en) Method for diagnosing organ injury
KR102178922B1 (en) Biomarker microRNA let-7 or microRNA-150 for diagnosing diabetic nephropathy and use thereof
EP3452613B1 (en) Profiling microvesicle nucleic acids and uses thereof as signatures in diagnosis of renal transplant rejection
CN104278105A (en) Serological biomarker miR-19a for detecting coronary heart disease and application of serological biomarker miR-19a
US20190390275A1 (en) Chronic kidney disease diagnostic
KR102178919B1 (en) Biomarker microRNAs for diagnosing diabetic nephropathy and use thereof
KR102323535B1 (en) A composition for diagnosing diabetic nephropathy
KR102069435B1 (en) Method for diagnosing parkinson&#39;s disease using nasal mucus, composition therefore, and kit comprising the same
CN114959003A (en) Acute myocardial infarction marker and application thereof
CN114959001A (en) Product for diagnosing acute myocardial infarction and application thereof
US10913979B2 (en) Determination of miR-423-5p in heart failure
CN113025707A (en) Application of biomarker in preparation of product for diagnosing damp-heat spleen-encumbering type 2 diabetes and kit
AU2015323513B2 (en) Determination of risk for development of cardiovascular disease by measuring urinary levels of podocin and nephrin messenger RNA
US11655507B2 (en) Method for diagnosing Parkinson&#39;s disease using nasal mucus, composition therefore, and kit comprising the same
CN108220427B (en) Plasma microRNA marker for differential diagnosis of BHD syndrome and primary spontaneous pneumothorax and application
CN116411060A (en) Marker, kit and application of GDF15 gene in auxiliary diagnosis of sarcopenia
CN114107487A (en) Product for diagnosing cerebral apoplexy
CN105648074A (en) Application of FAN1 genes in II-type diabetes diagnosis

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant