CN107858417A - Detect versicanV1mRNA kit and its application in urine - Google Patents

Abstract

The invention belongs to medical science, more particularly to detects versican V1mRNA kit and its application in urine, gathers Urine in Patients, and measure arena versican V1mRNA are horizontal；As a result show that FSGS patient arena versican V1mRNA are horizontal significantly to increase, and minute nephropathy (MCD) patient arena versican V1mRNA levels are unchanged；FSGS patient arena versican V1mRNA are horizontal related to tubulointerstitial lesions of patients with active Fibrosis score and significantly correlated with eGFR rates of descent in follow-up of patients；Therefore versican V1mRNA expression quantity can be used for the Prognosis of FSGS patient in urine；The reagent for detecting versican V1mRNA expression quantity in urine can be used for preparing detection reagent or detection kit；Realize the non-invasive diagnosis of FSGS Index for diagnosis.

Description

Detect versican V1 mRNA kit and its application in urine

Technical field

The invention belongs to medical science, more particularly to detect in urine versican V1mRNA kit and its Application in Focal segmental glomerulosclerosis disease Prognosis.

Background technology

Focal segmental glomerulosclerosis disease (Focal Segmental Glomerular Sclerosis, FSGS) is a kind of Typical sertoli cell disease.Patient is mostly nonselective proteinuria, and hypertension and kidney function damage are more common during onset, are often accompanied by kidney Tubule function damage.On pathology, the visible glomerulus focal segmental sample lesion of FSGS patient and tubulo-interstital acute and chronic lesion.FSGS Though belonging to sertoli cell disease with minute nephropathy (minimal change disease, MCD), clinical pathology damage overweights MCD, prognosis at a specified future date are worse than MCD.Chronic tubulo-interstital lesion degree and FSGS disease prognosis are closely related.It is small to find FSGS patient The non-invasive diagnosis mark of pipe interstitial fibrosis and Index for diagnosis, has important practical significance.

Extracellular matrix is distributed across extracellular space, the network structure being made up of the albumen and polysaccharide of cell secretion. Cytoadherence is formed tissue by extracellular matrix together, while provides an extracellular rack, in the tissue or between tissue Play supporting function.It is by many different multi-functional collagen superfamily molecules and non-collagen stroma molecular composition, including hyalomitome Acid, proteoglycans and glycoprotein etc..Extracellular matrix protein versican is a kind of very big chondroitin sulfate proteoglycan of molecular weight Glycan, it is made up of a protein core and 12-15 chondroitin sulfate side chain being connected thereto.Versican mRNA Alternative splicing, four kinds of hypotypes, i.e. V0, V1, V2 and V3 can be produced.Their core protein molecule amount is respectively 370KDa, 263KDa, 180KDa and 74KDa.

The past Bukong TN et al. reports that HSCs versican expression increase, strikes low liver in liver fibrosis process In sternzellen versican expression quantity can significantly inhibit hepatic fibrosis-renal tubular ectasia syndrome (referring to document Bukong TN, Maurice SB, Chahal B,Schaeffer DF,Winwood PJ.Versican:a novel modulator of hepatic fibrosis.Lab Invest.2016.96(3):361-74.).Rienstra H etc. are reported, small in experimental rat transplanted kidney In pipe interstitial fibrosis chondroitin sulfate proteoglycan versican expression quantity dramatically increase (referring to document Rienstra H, Katta K,Celie JW,et al.Differential expression of proteoglycans in tissue remodeling and lymphangiogenesis after experimental renal transplantation in rats.PLoS One.2010.5(2):e9095).Rudnicki M et al. report, versican V0 and V1 table in nephridial tissue Up to related to the progress of chronic renal disease (referring to document Rudnicki M, Perco P, Neuwirt H, et al.Increased renal versican expression is associated with progression of chronic kidney disease.PLoS One.2012.7(9):e44891.)。

The content of the invention

The present invention solves above-mentioned technical problem present in prior art, and noninvasive examine is provided for FSGS patient's Index for diagnosis Versican V1 mRNA kit and its in FSGS Prognosis in disconnected mark versican V1 mRNA, detection urine In application.

To solve the above problems, technical scheme is as follows：

Urine in Patients is gathered, determines arena versican V1 mRNA level in-sites；As a result FSGS patient's arena is shown Versican V1 mRNA level in-sites significantly increase, and MCD patient's arena versican V1 mRNA level in-sites are unchanged；FSGS suffers from Person's arena versican V1 mRNA level in-sites are related to tubulointerstitial lesions of patients with active Fibrosis score, and with eGFR in follow-up of patients Drop rate is significantly correlated；Predict that follow-up eGFR month rates of descent are bent more than 2 ‰, ROC with arena versican V1 mRNA level in-sites Area AUC reaches 1.000 under line.Therefore versican V1 mRNA level in-sites can be used for the Prognosis of FSGS patient in urine； The reagent for detecting versican V1 mrna expression amounts in urine can be used for preparing detection reagent or detection kit.

Preferably, the reagent of versican V1 mRNA expression quantity is in detection urine：To versican V1 mRNA With detection specific probe, genetic chip or PCR primer.

Preferably, it is described that there is the specific PCR primer of detection to include to versican V1 mRNA：

Versican V1 mRNA specific primers

Forward primer：TCGTTTTGAGAACCAGACAGG(SEQ ID NO.1)；

Reverse primer：CTCAAATCACTCATTCGACGTT(SEQ ID NO.2).

Preferably, it is described that there is the specific PCR primer of detection also to include to versican V1 mRNA

Endogenous control ACTB mRNA specific primer：

Forward primer：5’-CTTGACAAAACCTAACTTGCG-3’(SEQ ID NO.3)；

Reverse primer：5’-TGCTGTCACCTTCACCGTTC-3’(SEQ ID NO.4).

For the kit of FSGS Prognosis, including：

A, Transcription System, formed by reverse transcriptase mixture, 2 × reaction liquid mixture and without RNase water；

B, PCR analysis systems, by versican V1 mRNA specific primers, ACTB mRNA specific primers, 2 × QPCR reactant mixtures, fluorescence correction dyestuff and distilled water composition.

Relative to prior art, advantages of the present invention is as follows,

Relative to prior art, urine detection has non-invasive in the present invention, can significantly facilitate clinical practice；Detection refers to Mark is closely related with eGFR rates of descent, can the kidney prognosis of early stage Accurate Prediction FSGS；The detection method of the kit is quick, letter Just, safety, can larger scale clinical application；

The reagent for detecting versican V1 mRNA level in-sites in urine is applied to prepare detection reagent or detection by the present invention Kit, the Index for diagnosis of FSGS patient is used for by detecting versican V1 mRNA level in-sites in urine, it is pre- to realize FSGS Non-invasive diagnosis afterwards；

For the kit of FSGS Prognosis, the expression of versican V1 mRNA in urine can quickly, be accurately detected Amount.

Brief description of the drawings

Fig. 1 is FSGS, MCD and normal control arena versican V1 mRNA contents；

Fig. 2 is FSGS patient's arena versican V1 mRNA level in-sites and Tubulointerstitial fibrosis correlation analysis；

Fig. 3 is FSGS patient's arena versican V1 mRNA level in-sites and eGFR rate of descent correlation analysis；

Fig. 4 is that ROC analyzes FSGS patient arena versican V1 mRNA level in-sites for predicting eGFR month rates of descent> 2 ‰ Sensitivity and Specificity；

Fig. 5 is FSGS, MCD and normal control arena versican V0 mRNA contents.

Embodiment

Embodiment 1：Arena versican V1 mRNA RT-PCR analyses

Patient's 50ml urines are collected, 700g centrifugation 15min, obtain arena.

Total serum IgE is extracted using Trizol methods.Specific method is：1ml Trizol is added in the sample, is stored at room temperature 5 points Clock, fully cracking, to be completely separated nucleoprotein complex.1/5 chloroform of Trizol volumes is added, overturns concussion 15 seconds, room Temperature stands 5 minutes, centrifuges (12000g, 15 minutes, 4 DEG C).Upper strata aqueous phase is transferred in another clean EP pipes, the body such as addition Long-pending isopropanol, it is stored at room temperature 5 minutes, centrifuges (12000g, 10 minutes, 4 DEG C).Supernatant is removed, adds the washing of the ethanol of 1ml 75% RNA precipitate, oscillator mix, and centrifuge (12000g, 5 minutes, 4 DEG C)；Repeated washing 1 time；Remove supernatant, blank pipe centrifugation (12000g, 1 minute, 4 DEG C).Supernatant is removed, dissolving RNA precipitate is resuspended with 30ul ddH2O (RNase free).

Template cDNA is prepared using reverse transcriptase, reverse transcription condition is as follows：

Using ACTB mRNA as endogenous control, versican V1 mRNA RT-PCR analyses, PCR analysis conditions are carried out It is as follows：

*SEQ ID NO.1NO.3；**SEQ ID NO.2NO.4

Above-mentioned PCR analyzes versican V1 and ACTB mRNA specific primers：

As a result show, FSGS patient's arena versican V1 mRNA level in-sites significantly increase, and MCD patient's arena Versican V1 mRNA level in-sites are unchanged (Fig. 1).

Embodiment 2：

It is fine to tubulo-interstital with Masson stained areas with PASM staining evaluations renal damage and interstitial fibrosis degree Dimensionization carries out semi-quantitative analysis,<25% is 1 point, and 25%~50% is 2 points,>50% is 3 points.FSGS patient's arena Significant correlation, P values be present with tubulointerstitial lesions of patients with active Fibrosis score in versican V1 mRNA level in-sites<0.001 (Fig. 2).

Embodiment 3：

EGFR month rates of descent are calculated using mixed linear effect model：

GFR_ij=beta0+beta1*time_ij+b_0i+b_1i*time_ij+epsilon_ij

EGFR rates of descent=(beta1+b_1i)/(beta0+b_0i)

Significant correlation be present with patient's eGFR month rates of descent in FSGS patient's arena versican V1 mRNA level in-sites, P value=0.001 (Fig. 3).

Embodiment 4：

Judge that eGFR month rates of descent are more than 2 ‰ in follow-up with arena versican V1 mRNA level in-sites, under ROC curve Area AUC reaches 1.000.It is dividing value with arena versican V1 mRNA relative quantifications value 4.380, judges the follow-up eGFR months For rate of descent more than 2 ‰, Sensitivity and Specificity reaches 100% (Fig. 4).

Comparative example 1：Arena versican V0 mRNA RT-PCR analyses

Method is the same as embodiment 1

Versican V0 mRNA, which have, detects specific PCR primer：

As a result show, FSGS patient and MCD patient's arena versican V0 mRNA level in-sites have no significant change and (schemed 5)。

It should be noted that above-described embodiment is only presently preferred embodiments of the present invention, it is not used for limiting the present invention's Protection domain, the equivalent substitution or replacement made on the basis of the above belong to protection scope of the present invention.

Sequence table

<110>Nanjing General Hospital, PLA Nanjing Region

<120>Detect versican V1 mRNA kit and its application in urine

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

tcgttttgag aaccagacag g 21

<210> 2

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

ctcaaatcac tcattcgacg tt 22

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

cttgacaaaa cctaacttgc g 21

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

tgctgtcacc ttcaccgttc 20

<210> 5

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

cagcaagcac aaaatttcac c 21

<210> 6

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

ctcaaatcac tcattcgacc tg 22

Claims (5)

1. the reagent of versican V1 mrna expression amounts is examined preparing Focal segmental glomerulosclerosis disease prognosis in detection urine Application in disconnected detection reagent or detection kit.

2. application as claimed in claim 1, it is characterised in that versican V1 mrna expression amounts in described detection urine Reagent include：Have to versican V1 mRNA and detect specific probe, genetic chip or PCR primer.

3. application as claimed in claim 2, it is characterised in that described to have detection specific versican V1 mRNA PCR primer includes

Versican V1 mRNA specific primers：

Forward primer：TCGTTTTGAGAACCAGACAGG(SEQ ID NO.1)；

Reverse primer：CTCAAATCACTCATTCGACGTT(SEQ ID NO.2).

4. application as claimed in claim 3, it is characterised in that described to have detection specific versican V1 mRNA PCR primer also includes

Endogenous control ACTB mRNA specific primer：

Forward primer：5’-CTTGACAAAACCTAACTTGCG-3’(SEQ ID NO.3)；

Reverse primer：5’-TGCTGTCACCTTCACCGTTC-3’(SEQ ID NO.4).

5. the kit as described in claim 1-3, it is characterised in that including：

A, Transcription System, formed by reverse transcriptase mixture, 2 × reaction liquid mixture and without RNase water；

B, PCR analysis systems, it is anti-by versican V1 mRNA specific primers, ACTB mRNA specific primers, 2 × qPCR Answer mixture, fluorescence correction dyestuff and distilled water composition.