CN103834738B - The extraction of lncRNA and detection method in a kind of gastric juice - Google Patents
The extraction of lncRNA and detection method in a kind of gastric juice Download PDFInfo
- Publication number
- CN103834738B CN103834738B CN201410088376.2A CN201410088376A CN103834738B CN 103834738 B CN103834738 B CN 103834738B CN 201410088376 A CN201410088376 A CN 201410088376A CN 103834738 B CN103834738 B CN 103834738B
- Authority
- CN
- China
- Prior art keywords
- gastric juice
- lncrna
- extraction
- minutes
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
nullThe invention discloses extraction and the detection method of lncRNA in a kind of gastric juice，Extract including gastric juice、Gastric juice pre-processes、Chloroform extracts、Isopropanol precipitating、Ethanol washs、It is dried RNA、RNA reverse transcription、The steps such as PCR detection，Compared with prior art，It is an advantage of the current invention that: by gastric juice is pre-processed、Chloroform recovery、Isopropanol precipitating、Ethanol washs、RNA reverse transcription and PCR detecting step，Eliminate polysaccharide in gastric juice、The impurity such as mucoprotein，LncRNA high-quality in achieving gastric juice on the basis of simplifying laboratory operating procedures、The extraction of high yield，Achieve and target lncRNA fluorescent quantitation RT PCR is detected，By the Ct value of 130 example gastric juice sample GAPDH is analyzed，It is found that GAPDH is a good outer ginseng gene in gastric juice，Also been proposed the GAPDH for judging gastric juice total serum IgE quality on this basis with reference to Ct value scope，Occurrence law and the relation pathogenetic with physiological status and disease thereof of lncRNA in research gastric juice further are had great importance.
Description
Technical field
The present invention relates to extraction and the detection method of a kind of lncRNA, particularly relate in a kind of gastric juice the extraction of lncRNA with
Detection method.
Background technology
In human body, the gene of coded protein about 2～30,000, only account for the 2% of human genome, and remaining 98% does not encodes
The genomic DNA of protein is considered as initially not have function, is the rubbish in organism, is commonly called " rubbish
DNA”(junk DNA).But current research shows, the most transcribed generation non-coding RNA of these junk DNAs
(noncoding RNA, ncRNA), commonly used, it has surprisingly been found that feed along with high flux genome sequencing technology
In breast zooblast, the transcript of about 98% is ncRNA.These ncRNA molecules have include the most well known
" special (housekeeping) " ncRNA (such as tRNA and rRNA etc.), little ncRNA is (such as microRNA and piRNA
Deng), more then be wait further investigation long-chain non-coding RNA (long noncoding RNA, lncRNA) molecule.
LncRNA refers to that a class transcript length more than 200 nucleotides (nucleotide, nt) and does not possess coded protein
The RNA molecule of function.This quasi-molecule typically has the sequential element of high conservative, specific space secondary structure, shearing
Form and Subcellular Localization, particularly many of which member are found to have tissue or cell-specific.This conservative
Specifically determine lncRNA and there is biological function widely, relate to chromosome structure dynamically change, telomere maintain,
The life processes such as subcellular structure composition, genomic imprinting, dosage compensation effect.Just because of this, lncRNA can not be again
It is considered as " noise " of subgenomic transcription and accessory substance that rna plymerase ii is transcribed, but a class has important biomolecule
The novel ncRNA molecule of function.
For ncRNA architectural feature and the research of biological function, it be unable to do without the extraction of each pseudo body fluid ncRNA, RNA
Quality Identification and detection thereof.In gastric juice, the extraction of ncRNA is (public with a detection method such as application number 201010606089.8 at present
Accusing number be CN102127601A) Chinese invention patent application " detection method of miRNA in a kind of gastric juice " the most openly
Operating procedure, specifically includes gastric juice extraction and sodium hydroxide solution neutralizations, Trypsin Induced, adds Trizol reagent and mix
The steps such as standing, RNA release, chloroform recovery, isopropanol precipitating, ethanol washing, RNA reverse transcription and PCR detection.
Said method solves the interference problem that miRNA is extracted by acidity in gastric juice, polysaccharide and mucoprotein etc..But, by
It is only suitable for the extraction of tissue samples total serum IgE in Trizol reagent, moreover miRNA molecule is much smaller than lncRNA molecule, front
Person only has more than 20 nt, if using the similar method extraction of lncRNA in gastric juice extracting miRNA the most substantially to deposit
The defect complicated in operating procedure, RNA productivity is low.Under room temperature, lncRNA character is more unstable simultaneously, and deposits in gastric juice
At a considerable amount of nucleases, so lncRNA is easily to degrade in extraction.Factors above all can have a strong impact on gastric juice
The quality of lncRNA.
Additionally, lncRNA abundance is low in gastric juice, extraction and detection difficulty to gastric juice lncRNA are relatively big, the most still
There is no lncRNA technical method in perfect extraction, detection gastric juice.
Summary of the invention
The technical problem to be solved is to provide carrying of lncRNA in a kind of gastric juice for above-mentioned prior art present situation
Taking and detection method, the method can remove the interference of the impurity such as polysaccharide and mucoprotein in gastric juice, it is achieved that lncRNA in gastric juice
High-quality, high-load extract, and the lncRNA extracted is carried out fluorescence quantitative RT-RCR detection.
The present invention solves the technical scheme that above-mentioned technical problem used: the extracting method of lncRNA in this gastric juice, including
Following steps:
(1) use RNA extraction agent to extract human gastric juice's total serum IgE, with reverse transcription reagents, RNA extract is carried out reverse transcription
Reaction obtains cDNA；
(2) the cDNA solution to step (1) carries out pcr amplification reaction, then expands with quantitative real time PCR Instrument detection；
It is characterized in that: step (1) uses extractant Trizol LS gastric juice carries out the extraction of RNA, and in step (2)
In expand upstream and downstream primer by lncRNA specific amplification upstream and downstream primer or GAPDH cDNA solution carried out PCR
Amplified reaction.
Wherein, the concretely comprising the following steps of described step (1):
A, gastric juice extract: with stomach tube extraction human gastric juice 3～6ml on an empty stomach, putting in centrifuge tube, under room temperature, 3000rpm is centrifuged 3
Minute, supernatant is transferred to another without in RNase centrifuge tube, as on ice；
B, gastric juice pre-process: take the gastric juice 250～350 μ l of step a and are placed in 2ml without in RNase centrifuge tube, add 3 times
The Trizol LS reagent of volume, vortex oscillation 10 seconds, room temperature stands 5 minutes, and at 4 DEG C, 12000rpm is centrifuged 10 minutes,
Supernatant liquid is transferred in a new centrifuge tube without RNase；
C, chloroform extract: addition 0.2～0.3ml chloroform in the supernatant of step b, vortex oscillation 10 seconds,
Left at room temperature 5 minutes, at 4 DEG C, 12000rpm is centrifuged 15 minutes, draw upper water move into mutually new without RNase from
In heart pipe；
D, isopropanol precipitating: add and the step c isopyknic isopropanol of aqueous phase at the middle and upper levels, after mixing, stand under the conditions of 4 DEG C
20 minutes, then 12000rpm was centrifuged 10 minutes at 4 DEG C, and abandoning supernatant must precipitate；
E, ethanol wash: add the ethanol 1ml that mass fraction is 75% in the precipitation of step d, overturn for several times, at 4 DEG C
12000rpm is centrifuged 5 minutes, abandons supernatant；
F, it is dried RNA: after previous step abandons supernatant, 12000rpm is centrifuged 2 minutes at 4 DEG C again；Abandon supernatant, under room temperature
Being dried 1～2 minute, add 10 μ l and dissolve without RNase water, obtain RNA extract ,-80 DEG C save backup；
G, RNA reverse transcription: with reverse transcription reagents, the RNA extract of step f carrying out reverse transcription reaction, to obtain cDNA molten
Liquid, puts-20 DEG C and saves backup；
H, PCR detect: the cDNA solution of step g is carried out pcr amplification reaction, and amplification upstream and downstream primer is lncRNA
Specific amplification upstream and downstream primer or GAPDH expand upstream and downstream primer, then detect with quantitative real time PCR Instrument.
Further, in described step (2), lncRNA specific amplification upstream and downstream primer respectively RMRP amplification upstream and downstream is drawn
Thing.
Further, in described step (2), lncRNA specific amplification upstream and downstream primer is respectively AA174084 amplification up and down
Trip primer.
Further, in described step (2), GAPDH specific amplification upstream primer is:
5’ACCCACTCCTCCACCTTTGAC3’；With GAPDH specific amplification downstream primer it is: 5 '
TGTTGCTGTAGCCAAATTCGTT3’。
Further, described RMRP amplification upstream primer is: 5 ' ACTCCAAAGTCCGCCAAGA3 '；With
RMRP amplification downstream primer is: 5 ' TGCGTAACTAGAGGGAGCTGAC3 '.
Further, described AA174084 amplification upstream primer is: 5 ' CTGGTTCTTCATCCCTGCTATG3 '；
With AA174084 amplification downstream primer it is: 5 ' CCTGCTCCTCTTTGTGTTCTCT3 '.
Further, the pcr amplification reaction condition of described step (2) is: 95 DEG C of denaturations 5 minutes；Then 94 DEG C of sex change
15 seconds, annealing 30 seconds for 55 DEG C, 70 DEG C extend 30 seconds, totally 45 circulations.
As preferably, in described step (1), gastric juice is 1:2.5～3.5 with the additional proportion of extractant Trizol LS.
By the Ct value of 130 example gastric juice GAPDH is analyzed, find the Ct value mean of 250 μ l gastric juice sample GAPDH
It is about 32.3, and as the Ct of sample cDNAGAPDHDuring value≤34, target lncRNA can well be expanded.Therefore,
Extracting term of reference up-to-standard for gastric juice RNA with this technical method is: CtGAPDHValue≤34.
Further, in order to confirm validity and the practicality of detection gastric juice lncRNA relative level method that the present invention sets up, this
Invention have detected normal or slight gastritis (normal mucosa or minimal gastritis, NMMG), gastric ulcer (gastric
Ulcer, GU), gastric juice lncRNA in atrophic gastritis (atrophic gastritis, AG) and cancer of the stomach (gastric cancer, GC) patient
Relative level.Result shows that the method can detect the relative level of lncRNA in gastric juice effectively；And AA174084
Horizontal indifference in normal or slight gastritis, gastric ulcer and patients with atrophic gastritis gastric juice, and in Gastric Juice from Patients Suffering from Stomach Carcinoma
Level significantly raised, show the Close relation with cancer of the stomach.The cutoff value of AA174084 in gastric juice is scheduled on 4.24,
Then the sensitivity of its diagnosis of gastric cancer is 59%, is specifically 85%, and after ROC curve analysis, AUC is 0.723.
Result above shows that the method can detect the relative level of lncRNA in gastric juice effectively, and AA174084 can simultaneously
New diagnosing gastric cancer mark can be become.
Compared with prior art, it is an advantage of the current invention that: be human gastric juice lncRNA extraction and the detection method of a kind of novelty,
By to gastric juice Trizol LS pretreatment, chloroform recovery, isopropanol precipitating, 75% ethanol washing, RNA reverse transcription and PCR
Detecting step, eliminates the impurity such as polysaccharide, mucoprotein in gastric juice, achieves stomach on the basis of simplifying laboratory operating procedures
The extraction of lncRNA high-quality, high yield in liquid, it is achieved that target lncRNA fluorescence quantitative RT-RCR is detected, logical
Cross the Ct value to 130 example gastric juice sample GAPDH to analyze, it was found that GAPDH is a good outer ginseng base in gastric juice
Cause, also been proposed the GAPDH reference Ct value scope for judging gastric juice total serum IgE quality on this basis, and the present invention carries
The method of confession, to occurrence law and pass pathogenetic with physiological status and the disease cording thereof of studying lncRNA in gastric juice further
There is important meaning.
Accompanying drawing explanation
Fig. 1 is the RMRP amplification curve diagram in two gastric juice samples of embodiment 1；
Fig. 2 is the RMRP melting profile in two gastric juice samples of embodiment 1；
Fig. 3 is the AA174084 amplification curve diagram in two gastric juice samples of embodiment 2；
Fig. 4 is the AA174084 melting profile in two gastric juice samples of embodiment 2；
Fig. 5 is the GAPDH amplification curve diagram in two gastric juice samples of embodiment 3；
Fig. 6 is the GAPDH melting profile in two gastric juice samples of embodiment 3；
Fig. 7 is GAPDH water in Healthy People, patients w ith peptic ulcer disease, patients with atrophic gastritis and each phase Gastric Juice from Patients Suffering from Stomach Carcinoma
Put down and compare；
Fig. 8 is AA174084 level in normal or slight gastritis, gastric ulcer, atrophic gastritis and Gastric Juice from Patients Suffering from Stomach Carcinoma；
Fig. 9 is patients with gastric cancer and the ROC curve analysis of non-Gastric Juice from Patients Suffering from Stomach Carcinoma AA174084 level.
Detailed description of the invention
Below by way of combining drawings and Examples, the invention will be further described.
Embodiment 1
In a kind of gastric juice, the extraction of lncRNA and detection method, comprise the steps:
A, gastric juice extract: extract Fasting gastric fluid 5ml with stomach tube, put into without in RNase centrifuge tube, 3000rpm under room temperature
Centrifugal 3 minutes, supernatant is transferred to another without in RNase centrifuge tube, as on ice；
B, gastric juice pre-process: take previous step gastric juice 300 μ l and are placed in 2ml without in RNase centrifuge tube, add Trizol LS examination
Agent 900 μ l, vortex oscillation 10 seconds, room temperature stands 5 minutes, and at 4 DEG C, 12000rpm is centrifuged 10 clocks, and sample is divided into two-layer,
Upper strata is that pink homogenizes liquid, and lower floor is the thick impurity layer that color is the deepest, is turned by the supernatant liquid of 1000 μ l
Move on to one new without, in RNase centrifuge tube, abandoning precipitation, with the impurity such as Polysaccharide removing and mucoprotein；
C, chloroform extract: adding 0.2ml chloroform, vortex oscillation 10 seconds, left at room temperature is after 5 minutes, 4 DEG C
Lower 12000rpm is centrifuged 15 minutes, draws upper water and moves into one mutually newly without in RNase centrifuge tube；
D, isopropanol precipitating: in previous step is without RNase centrifuge tube, add the isopropanol with described upper water equal volume,
After mixing, standing 20 minutes under the conditions of 4 DEG C, at 4 DEG C, 12000rpm is centrifuged 10 minutes, and abandoning supernatant must precipitate；
E, 75% ethanol washing: in above-mentioned precipitation, add the ethanol 1ml that mass fraction is 75%, overturn for several times, at 4 DEG C
12000rpm is centrifuged 5 minutes, abandons supernatant；
F, it is dried RNA: after previous step abandons supernatant, 12000rpm is centrifuged 2 minutes at 4 DEG C again, it is seen that tube wall residual solution
Body comes together at the bottom of pipe, after slowly exhausting residual liquid with 100 μ l pipettors, sees a needle point size translucent white RNA precipitate,
It is dried 1 minute under room temperature condition, adds 10 μ l and dissolve without RNase water, repeatedly blow and beat, obtain RNA extract ,-80 DEG C of guarantors
Deposit standby；
G, RNA reverse transcription: the RNA of previous step is carried with GoScript Reverse Transcriptase kit (being purchased from Promega company of the U.S.)
Taking liquid and carry out reverse transcription reaction, obtain cDNA solution, put-20 DEG C and save backup, concrete operations are entered according to this kit specification
OK: add in 0.5ml centrifuge tube 9.5 μ l RNA extracts, 1 μ l Oligonucleolide primers, 1 μ l random primer, 1 μ l dNTP,
2μl MgCl2, 1 μ l reverse transcriptase, 4 μ l reaction buffers and 0.5 μ l RNase inhibitor；Then it is incubated 5 minutes at 25 DEG C,
42 DEG C 1 hour, then be incubated 15 minutes at 70 DEG C, add 80 μ l without RNase water, just obtain cDNA solution, put-20 DEG C of preservations
Standby；
H, PCR detect: useQPCR Master Mix detection kit (being purchased from Promega company of the U.S.) is to upper
The cDNA solution of step carries out quantitative fluorescent PCR (instrument is purchased from Stratagene company of the U.S.), and the primer of amplification is RMRP
Specific amplification upstream and downstream primer, concrete operations are carried out according to detection kit and quantitative real time PCR Instrument specification: saturating at thin-walled
Bright quantitative fluorescent PCR reaction tube is separately added into each 1 μ l of RMRP specific amplification upstream and downstream primer, 12.5 μ l
QPCR Master Mix detection kit, 5.5 μ l are without RNase water and 5 μ l cDNA；PCR reaction condition is: 95 DEG C pre-
Sex change 5 minutes；Then 94 DEG C of sex change 15 seconds, anneal 30 seconds for 55 DEG C, and 70 DEG C extend 30 seconds, totally 45 circulations；Unwind
Tracing analysis: 95 DEG C 1 minute, 55 DEG C 30 seconds；Then being to slowly warm up to 95 DEG C, heating rate is 0.2 DEG C/sec.Finally
Obtain RMRP amplification curve as shown in Figure 1 and RMRP melting curve as shown in Figure 2, can from amplification curve
To obtain the Ct value respectively 27.84 and 31.49 of detected two gastric juice sample, it is recognized that be somebody's turn to do from melting curve
Curve is narrower simple spike, it can be seen that the RMRP of each gastric juice sample, all by specific amplification, does not has primer dimer
Interference with miscellaneous band.
Embodiment 2
Essentially identical with embodiment 1 method, different is that the upstream and downstream primer of amplification is by AA174084 in step h
The amplification curve that specific amplification upstream and downstream primer replaces RMRP, detection to obtain AA174084 expression in gastric juice is conciliate
Chain curve, respectively such as accompanying drawing 3 and 4, the Ct value that can obtain detected two gastric juice sample from amplification curve is respectively 31.42
With 32.65；It is recognized that this curve is narrower simple spike from melting curve, it can be seen that each gastric juice sample
AA174084, all by specific amplification, does not has primer dimer and the interference of miscellaneous band.
Embodiment 3
Essentially identical with embodiment 1 method, different is that the upstream and downstream primer of amplification is by GAPDH in step h
Specific amplification upstream and downstream primer replaces RMRP, detection to obtain the amplification curve of GAPDH expression in gastric juice, respectively
Such as accompanying drawing 5 and 6, the Ct value that can obtain detected two gastric juice sample from amplification curve is respectively 28.26 and 32.45；
It is recognized that this curve is narrower simple spike from melting curve, it can be seen that GAPDH all quilts of each gastric juice sample
Specific amplification, does not has primer dimer and the interference of miscellaneous band.The Ct of this example sample cDNAGAPDHValue≤34, RNA is (i.e.
CDNA) up-to-standard.Additionally, by 130 example gastric juice CtGAPDHValue analyze, find GAPDH Healthy People (NMMG),
Horizontal stable in patients w ith peptic ulcer disease (GU), atrophic gastritis (AG) patient and each phase cancer of the stomach (GC) patient's gastric juice, and gastric juice
GAPDH level not by age, sex, drink, the factor such as smoking and helicobacter pylori infections is affected, thus propose
GAPDH is also a good outer ginseng gene (see accompanying drawing 7 and subordinate list 1) at gastric juice.
Table 1 gastric juice GAPDH level and the relation of clinical pathological factors
Embodiment 4
Utilize target lncRNA and the Ct value of GAPDH in same individual gastric juice sample, so that it may according to formula Δ Ct=
CtlncRNA-CtGAPDHCalculate the Δ Ct value of this target lncRNA, just can determine whether this target according to the size of Δ Ct value
The relative level of lncRNA；The little person of Δ Ct value, the level of its corresponding target lncRNA is high；And the big person of Δ Ct value, it is corresponding
The level of target lncRNA is low.
In examples detailed above, RMRP and AA174084 can also be with other target lncRNA specific amplification upstream and downstream primer generation
Replace, numerous to list herein；The present invention establishes extraction and the detection method of lncRNA in gastric juice, it was found that GAPDH
It is a good outer ginseng gene at gastric juice, lays a good foundation for research lncRNA function and level.
Embodiment 5
Use the level of lncRNA in the different patients with gastric disease gastric juice of method detection of above-mentioned foundation.As shown in Figure 8,45 example
AA174084 level in normal or slight gastritis, 30 example gastric ulcer, 16 example atrophic gastritis and 39 example Gastric Juice from Patients Suffering from Stomach Carcinomas,
Patients with gastric cancer group gastric juice AA174084 level apparently higher than other each group, P < 0.001.As it is shown in figure 9,39 example cancer of the stomach are suffered from
Person and the ROC curve analysis of 91 examples non-Gastric Juice from Patients Suffering from Stomach Carcinoma AA174084 level, AUC is 0.723, and critical value is
4.24, P < 0.001.
Claims (5)
1. the extraction of lncRNA and a detection method in gastric juice, comprise the steps:
(1) use RNA extraction agent to extract human gastric juice's total serum IgE, with reverse transcription reagents, RNA extract is entered
Row reverse transcription reaction obtains cDNA；
(2) the cDNA solution of step (1) is carried out pcr amplification reaction, then detect with quantitative real time PCR Instrument
Amplification；
It is characterized in that: step (1) uses extractant Trizol LS gastric juice carries out the extraction of RNA, and
Upstream and downstream primer pair is expanded by lncRNA specific amplification upstream and downstream primer or GAPDH in step (2)
CDNA solution carries out pcr amplification reaction, concretely comprising the following steps of described step (1):
A, gastric juice extract: with stomach tube extraction human gastric juice 3～6ml on an empty stomach, put in centrifuge tube, 3000rpm under room temperature
Centrifugal 3 minutes, supernatant is transferred to another without in RNase centrifuge tube, as on ice；
B, gastric juice pre-process: take the gastric juice 250～350 μ l of step a and be placed in 2ml without in RNase centrifuge tube,
Adding the Trizol LS reagent of 3 times of volumes, vortex oscillation 10 seconds, room temperature stands 5 minutes, at 4 DEG C, and 12000rpm
Centrifugal 10 minutes, supernatant liquid is transferred in a new centrifuge tube without RNase；
C, chloroform extract: add 0.2～0.3ml chloroform, vortex oscillation in the supernatant of step b
10 seconds, left at room temperature 5 minutes, at 4 DEG C, 12000rpm was centrifuged 15 minutes, draws upper water and moves into mutually
In new centrifuge tube without RNase；
D, isopropanol precipitating: add and the step c isopyknic isopropanol of aqueous phase at the middle and upper levels, after mixing, 4 DEG C of bars
Standing 20 minutes under part, then 12000rpm is centrifuged 10 minutes at 4 DEG C, and abandoning supernatant must precipitate；
E, ethanol wash: add the ethanol 1ml that mass fraction is 75%, reverse number in the precipitation of step d
Secondary, at 4 DEG C, 12000rpm is centrifuged 5 minutes, abandons supernatant；
F, it is dried RNA: after previous step abandons supernatant, 12000rpm is centrifuged 2 minutes at 4 DEG C again；Abandon supernatant,
It is dried 1～2 minute under room temperature, adds 10 μ l and dissolve without RNase water, obtain RNA extract ,-80 DEG C of preservations
Standby；
G, RNA reverse transcription: with reverse transcription reagents, the RNA extract of step f is carried out reverse transcription reaction and obtain
To cDNA solution, put-20 DEG C and save backup；
H, PCR detect: the cDNA solution of step g is carried out pcr amplification reaction, and amplification upstream and downstream is drawn
Thing is lncRNA specific amplification upstream and downstream primer or GAPDH amplification upstream and downstream primer, then uses fluorescent quantitation
PCR instrument detects；
In described step (2), GAPDH specific amplification upstream primer is: 5 '
ACCCACTCCTCCACCTTTGAC 3’；With GAPDH specific amplification downstream primer it is: 5 '
TGTTGCTGTAGCCAAATTCGTT 3’；
In described step (2), lncRNA specific amplification upstream and downstream primer is respectively AA174084 and expands upstream and downstream
Primer or RMRP expand upstream and downstream primer.
The extraction of lncRNA and detection method in a kind of gastric juice the most as claimed in claim 1, its feature exists
In: described RMRP amplification upstream primer is: 5 ' ACTCCAAAGTCCGCCAAGA 3 '；And RMRP
Amplification downstream primer is: 5 ' TGCGTAACTAGAGGGAGCTGAC 3 '.
The extraction of lncRNA and detection method in a kind of gastric juice the most as claimed in claim 1, its feature exists
In: described AA174084 amplification upstream primer is: 5 ' CTGGTTCTTCATCCCTGCTATG3 '；With
AA174084 amplification downstream primer is: 5 ' CCTGCTCCTCTTTGTGTTCTCT 3 '.
The extraction of lncRNA and detection method in a kind of gastric juice the most as claimed in claim 1, its feature exists
In: the pcr amplification reaction condition of described step (2) is: 95 DEG C of denaturations 5 minutes；Then 94 DEG C of sex change 15
Second, anneal 30 seconds for 55 DEG C, 70 DEG C extend 30 seconds, totally 45 circulations.
The extraction of lncRNA and detection method in a kind of gastric juice the most as claimed in claim 1, its feature exists
In: in described step (1), gastric juice is 1:2.5～3.5 with the additional proportion of extractant Trizol LS.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410088376.2A CN103834738B (en) | 2014-03-11 | 2014-03-11 | The extraction of lncRNA and detection method in a kind of gastric juice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410088376.2A CN103834738B (en) | 2014-03-11 | 2014-03-11 | The extraction of lncRNA and detection method in a kind of gastric juice |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834738A CN103834738A (en) | 2014-06-04 |
| CN103834738B true CN103834738B (en) | 2016-09-07 |
Family
ID=50798630
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410088376.2A Expired - Fee Related CN103834738B (en) | 2014-03-11 | 2014-03-11 | The extraction of lncRNA and detection method in a kind of gastric juice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834738B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105653897B (en) * | 2015-12-25 | 2019-02-01 | 北京百迈客生物科技有限公司 | LncRNA analysis system and method based on biological cloud platform |
| CN105695451B (en) * | 2016-04-19 | 2019-02-15 | 南京大学 | The extracting method of microorganism total DNA in a kind of human stomach |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102127601A (en) * | 2010-12-27 | 2011-07-20 | 宁波大学 | Method for detecting miRNA (micro ribonucleic acid) in stomach juice |
-
2014
- 2014-03-11 CN CN201410088376.2A patent/CN103834738B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102127601A (en) * | 2010-12-27 | 2011-07-20 | 宁波大学 | Method for detecting miRNA (micro ribonucleic acid) in stomach juice |
Non-Patent Citations (4)
| Title |
|---|
| AA174084.1;Hillier L. et al;《GenBank》;19980309;第1-1页 * |
| Intrinsic expression of host genes and intronic miRNAs in prostate carcinoma cells;Kavleen Sikand et al;《Cancer Cell International》;20090812;第9卷(第21期);第1-15页 * |
| RMRP Is a Non-Coding RNA Essential for Early Murine Development;Joseph Rosenbluh et al;《PLoS ONE》;20111031;第6卷(第10期);e26270 * |
| 胃液微小RNA的分析及其在胃癌筛查中的意义;崔龙;《中国优秀硕士学位论文全文数据库（电子期刊）》;20130315;E072-143 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834738A (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2904118B1 (en) | Urine exosome mrnas and methods of using same to detect diabetic nephropathy | |
| CN107338324B (en) | Serum lncRNA marker for diagnosing recurrent abortion caused by unknown reasons, primer set, application and kit | |
| CN105861672A (en) | Detection kit and detection method for methylation of septin9 gene in human peripheral blood cell-free DNA | |
| CN109486955A (en) | It is a kind of for excrement Detection progress phase adenoma, the kit of colorectal cancer related gene methylation sites | |
| CN110055322A (en) | For the circulation miRNA marker of Diagnosis of Acute Myocardial Infarction and its application | |
| CN103834738B (en) | The extraction of lncRNA and detection method in a kind of gastric juice | |
| CN106434982A (en) | Relevant molecular markers for cerebral ischemic stroke and application of molecular markers | |
| TW201231671A (en) | Method and kit for in vitro diagnosis of atherosclerosis | |
| CN109930206A (en) | Detection kit is sequenced in micro blood platelet RNA based on BGISEQ-500 | |
| CN110093418B (en) | piRNA-54265 detection kit for early screening, diagnosis, curative effect and prognosis evaluation of colorectal cancer | |
| CN105154533B (en) | Diagnose the miRNA combination and its kit of early liver cancer | |
| CN104651492B (en) | Applications of the miRNA410 in prostatic cancer diagnostic reagent kit is prepared | |
| CN109266751B (en) | Biomarker combination for nasopharyngeal carcinoma diagnosis and application | |
| CN112143808A (en) | lncRNA capable of being used as gastric cancer diagnosis marker and application thereof | |
| CN108165634B (en) | Detection and application of novel gastric cancer molecular marker tRF-5026a | |
| CN104059988A (en) | Marker gene CST1 and application thereof | |
| CN114214422B (en) | Application of exosome miR-106b-3P, ARPC5 in lung cancer diagnosis | |
| WO2013093016A1 (en) | Diagnosis of steatohepatitis | |
| CN110777200B (en) | GAN gene for early diagnosis of atrial fibrillation | |
| CN106554991A (en) | Can be used for the blood miR-134 detection kits of coronary artery calcification diagnosis | |
| CN107604076A (en) | Diagnosis of glioma mark Circ6:4891713 | 4892379 and application | |
| CN109517894B (en) | Non-coding RNA biomarker related to liver cancer and application thereof | |
| CN108588217B (en) | Application of LncRNA as deep venous thrombosis diagnosis marker | |
| RU2729423C2 (en) | Method of extracting free and exosomal micro-rna from saliva | |
| CN1952176B (en) | Process for extracting free mRNA from pleural fluid and ascitic fluid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160907 |